LRE implementation, Chris Krohn, LaTrobe University, Australia

[Christian Krohn]

Dear Bob,

Thank you very much for the thorough documentation on LRE analysis/quantification. I just started my PhD project on soil bioremediation and have explored the available documents of the LRE-method for absolute quantifying and am interested in applying it.

 

My aim is to quantify total number of bacterial and fungal copy numbers of soil-DNA and compare relative differences between soil samples.

I was wondering if you could help by answering some questions if any possible?

 

1. Do you think that calibration of fluorescence using any purified amplicon would be suitable to generate a universal OCF. Why is Lambda the genome of choice otherwise?
   E.g. I have imported some recent fluorescence readings of serial diluted purified EcoliDH5alpha into the calibration window of the ‘LREanalyser’ (see attached for reference - these are first qPCR attempts on my behalf). Amplicon target was in the 16S RNA region (universal bacteria). I then calculated an OCF in Excel separately as the software refers back to the lambda genome size only.
2. Do you think calibration with Lambda DNA or otherwise would be applicable even when later sample amplification is done on soil-DNA, i.e. amplifying a target across all bacteria and/or fungi (see below details)?
   I understand I would have to do separate calibrations for bacteria and fungi due to different reaction mixtures and cycle conditions.
3. Unfortunately, all my soil-DNA samples showed profile arcing as seen attached, while the Ecoli standards seemed fine - despite using the same reaction mixture. Do you have any recommendations on how I can improve that? 

 

Thank you for any comments!! It would be fantastic to use this method as I think I would be able to compare different soil samples without potential biases from using different quantification standards over time.

 

Method 16S RNA amplicon; bacteria

• Primer bacteria: 1114f / SD00413743-001 (5'CGGCAACGAGCGCAACCC*) and 1275r/SD00413744-001 (5' CCATTGTAGCACGTGTGTAGC*) (Sigma-Aldrich)
• Reagents: 20µl reactions containing 20 ng (2 µl) of soil DNA, 3.3 µl of Sensifast™SYBR®&Fluorescein mix (Bioline), and 2.7 µmole (0.27 µl) of each 1114f and 1275r plus sterile water.
• Quantification standard: Accession number of gene used in standard dilution series = 2YKR_A / Escherichia coli DH5alpha
• On CFX Connect Real-Time PCR Detection System (BioRad)

 

Kind Regards, 

Christian Krohn

Graduate Researcher (PhD candidate)

Department of Animal, Plant and Soil Sciences
AgriBio, the Centre for AgriBioscience | La Trobe University | Victoria 3086 Australia

T: +61 420535348 | 1799...@students.latrobe.edu.au

[Bob Rutledge]

Dear Christian,

My apologies for the delay in responding. I am now retired and do not monitor my emails as rigorously as I should, in part because now so few are of significance. I looked briefly at your profiles, but would like to take more time to review your work, as many of the technical details of LRE analysis have become foggy over the two years after retiring. Nonetheless, my first impression is that your profiles look very good. Why some of your plateaus are falling is something I do not recall seeing, but need to review our work with multiple commercial reaction mixes to be sure. For the most part however, your Emax values look good, which is the most parameter of the analysis but I hope to better elaborate on the details. Note that this is not the arcing that I have observed previously, which is actually an increase, not decrease, in reaction florescence. Also, on first reflection use of another calibration target would be fine, if it is properly quantified, but I do need to look more carefully at your method. I used lambda DNA simply because of its ubiquitous availability. Indeed, it may also be useful for normalization of your soil sample preparations, i.e. via spiking the soil samples before DNA extraction?

Give me sometime to put together an overview of OCF calibration, and more specifically absolute quantification, in part because most (all?) Ct-based analysis's have serious flaws that have led to many (all?) senior researchers to believe that absolute quantification is simply not possible, which of course in nonsense. Sadly, you are one of only a handful of researchers that have implemented LRE (and is impressive in quality...congrads), and, maybe not surprisingly, tend to be grad students (i.e. young), as examples can be found of other technological advancements that have taken over a generation to be adopted, which sadly are particularly prominent in medical research. 

Anyway, I will get back to you as soon as I can. Unfortunately, my 7 month old grandson is scheduled for surgery this Thursday to fix a hole in his heart, so I am not sure when I will be able to properly respond. However, you have relight my interest in LRE analysis, so I am looking forward to better understanding your assays.  

Upon reflection, I suggest you have a look at my latest, and likely last publication: 

http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0185015

Although this is a gene expression analysis-based study, I do address in some detail aspects of sample normalization, which may be relevant to your project (e.g. variance in DNA extraction efficiency?), along with trashing Ct-based "relative quantification". This may be useful to you when (likely) you will have to justify/convince others, of not only the utility of absolute quantification, but of its validity. 

Thanks again for your interest and efforts in implementing LRE.

Take care.

Bob

--
You received this message because you are subscribed to the Google Groups "LRE qPCR" group.
To unsubscribe from this group and stop receiving emails from it, send an email to lreqpcr+unsubscribe@googlegroups.com.
For more options, visit https://groups.google.com/d/optout.

[Christian Krohn]

Dear Bob, 

Thank you very much for your response. I will continue to investigate taking your comments and latest paper into account. 

In any case your feedback was/is much appreciated and I wish you and your grandson all the best!

Kind regards, 

Chris

You received this message because you are subscribed to a topic in the Google Groups "LRE qPCR" group.
To unsubscribe from this topic, visit https://groups.google.com/d/topic/lreqpcr/UviFpSA8zZ4/unsubscribe.
To unsubscribe from this group and all its topics, send an email to lreqpcr+u...@googlegroups.com.