the primers you are using f3 and b3 may not be very specific
please conisder the primer below Tm is on lower side but higher Mg2+ of Bst3.0 to induce RT activity should help.
As for bar coding doing RT-LAMP using two sets will not increase cost much but can address and identify more samples.
Following primers were designed detection of SARS-CoV-2 isolate Wuhan-Hu-1 (NCBI Accession: NC_045512; GI:1798174254); isolate SARS-CoV-2/166/human/2020/IND (NCBI Accession: MT050493) and isolate SARS-CoV-2/29/human/2020/IND (NCBI Accession: MT012098). The region between Bases 1951 to 2950 and 21500 to 22500 was found to be divergent when compared to SARS-Coronavirus isolate Tor2 (NCBI Accession: AY274119). Sequence of this was region utilized to design primers for detection of COVID-19. The LAMP primers were designed using Primer Explorer Version 5 software (FUJITSU LIMITED, Japan; URL: http://primerexplorer.jp/lampv5e/index.html)
The primer sequence identified were checked for sequence homology to SARS-Coronavirus isolate Tor2 (NCBI Accession: AY274119) using NCBI-BLAST nucleotide alignment tool with blastn algorithm settings and CLUSTAL Omega. All the primers were considered unique to SARS-CoV-2.
Target Region 1951 to 2950
Primer Name |
Genomic location 5’ |
Sequence (5’to 3’) |
Tm |
F3 |
2483 |
ATCTTCTTAGAGGGAGAAACA |
55 |
B3 |
2761 |
GCCTTTGAGTGTGAAGGTA |
56 |
F2 |
2507 |
CCCACAGAAGTGTTAACAGA |
56 |
F1c |
2585 |
CAGCTTCACTAGTAGGTTGTTCTAA |
60 |
B2 |
2683 |
CATATTAGGTGCAAGGGCA |
56 |
B1c |
2601 |
TTGGTACACCAGTTTGTATTAACGG |
61 |
LF |
2550 |
TCACCAGTTTTCAAGACAACTTCC |
61 |
LB |
2626 |
GCTTATGTTGCTCGAAATCAAAGAC |
62 |
FIP |
CAGCTTCACTAGTAGGTTGTTCTAA-CCCACAGAAGTGTTAACAGA |
|
|
BIP |
TTGGTACACCAGTTTGTATTAACGG-CATATTAGGTGCAAGGGCA |
|
Target Region 21500 to 22500
Primer Name |
Genomic location 5’ |
Sequence (5’to 3’) |
Tm |
F3 |
21665 |
GGTGTTTATTACCCTGACAAAG |
56 |
B3 |
21867 |
GTACCAAAAATCCAGCCTC |
55 |
F2 |
21687 |
TTTTCAGATCCTCAGTTTTACATTC |
57 |
F1c |
21737 |
CATGGAACCAAGTAACATTGGAAAA |
60 |
B2 |
21838 |
GACTTCTCAGTGGAAGCA |
55 |
B1c |
21772 |
CTCTGGGACCAATGGTACTAAGAG |
61 |
LF |
21712 |
GAAAGGTAAGAACAAGTCCTGAGTT |
60 |
LB |
21807 |
CTGTCCTACCATTTAATGATGGTGT |
60 |
FIP |
CATGGAACCAAGTAACATTGGAAAA-TTTTCAGATCCTCAGTTTTACATTC |
|
|
BIP |
CTCTGGGACCAATGGTACTAAGAG-GACTTCTCAGTGGAAGCA |
|
My Scheme designed for optimization of RT-LAMP. This was made for visual assay for detection with phenol red
Temp at 62°C, was considered and fixed Rxn vol 20-25 µL(variable) based on suitability for implementation on wide scale
Concentration of primers to test based on review of literature for ZIKA, DENV, and some other papers which implemented Lateral flow with product.
dNTP optimization considered essential as it will affect available Mg2+ ions and MgSO4 conc. requirements
Buffer already has 2mM MgSO4 so values table are in addition to it
F3 |
0.2 µM |
0.2 µM |
0.2 µM |
0.2 µM |
0.2 µM |
0.2 µM |
0.2 µM |
0.4 µM |
0.4 µM |
0.4 µM |
0.4 µM |
|
B3 |
0.2 µM |
0.2 µM |
0.2 µM |
0.2 µM |
0.2 µM |
0.2 µM |
0.2 µM |
0.4 µM |
0.4 µM |
0.4 µM |
0.4 µM |
|
FIP |
1.6 µM |
1.6 µM |
1.6 µM |
1.6 µM |
1.6 µM |
1.6 µM |
1.6 µM |
1.6 µM |
1.6 µM |
1.6 µM |
1.6 µM |
|
BIP |
1.6 µM |
1.6 µM |
1.6 µM |
1.6 µM |
1.6 µM |
1.6 µM |
1.6 µM |
1.6 µM |
1.6 µM |
1.6 µM |
1.6 µM |
|
F2 |
0.1 µM |
0.1 µM |
0.1 µM |
0.1 µM |
0.1 µM |
0.2 µM |
0.2 µM |
0.2 µM |
0.2 µM |
0.2 µM |
0.2 µM |
|
F1c |
0.1 µM |
0.1 µM |
0.1 µM |
0.1 µM |
0.1 µM |
0.2 µM |
0.2 µM |
0.2 µM |
0.2 µM |
0.2 µM |
0.2 µM |
|
B2 |
0.1 µM |
0.1 µM |
0.1 µM |
0.1 µM |
0.1 µM |
0.2 µM |
0.2 µM |
0.2 µM |
0.2 µM |
0.2 µM |
0.2 µM |
|
B1c |
0.1 µM |
0.1 µM |
0.1 µM |
0.1 µM |
0.1 µM |
0.2 µM |
0.2 µM |
0.2 µM |
0.2 µM |
0.2 µM |
0.2 µM |
|
MgSO4 |
4.5 mM |
4.5 mM |
6 mM |
6 mM |
6 mM |
6 mM |
6 mM |
6 mM |
6 mM |
6 mM |
6 mM |
|
dNTP |
0.2 mM |
0.2 mM |
0.4 mM |
0.2 mM |
0.4 mM |
0.4 mM |
0.4 mM |
0.4 mM |
0.4 mM |
0.2 mM |
0.2 mM |
|
Bst 3.0 |
2 U |
4 U |
2 U |
4 U |
4 U |
2 U |
4 U |
2 U |
4 U |
2 U |
4 U |
|
Note Buffer already has 2mM MgSO4 so final will more by 2mM
Optimization for Bst 3.0 considered as it is most expensive component. If cost is non-issue then use 6.5 U without optimization
The best condition found would be tested with 1 Unit enzyme also
Primer Titration if required
F3 1.6 µM and 0.8 µM, B3 vairable 0.5 to 2 µM , FIP and BIP 1.6 µM fixed based of literature Rest primers 0.1 µM Fixed
Primer | Sequence | Tm(1) | Tm(2) | Tm(1)-Tm(2) | Tm(3) | Tm(1)-Tm(3) | Tm(4) | Tm(1)-Tm(4) | Tm(5) | Tm(1)-Tm(5) |
F3 | ATCTTCTTAGAGGGAGAAACA | 55 | 51.6576 | 3.3424 | 56.6123 | -1.6123 | 55.9247 | -0.924700000000001 | 56.0868 | -1.0868 |
B3 | GCCTTTGAGTGTGAAGGTA | 56 | 52.9143 | 3.0857 | 58.6039 | -2.6039 | 57.3318 | -1.3318 | 57.4679 | -1.4679 |
F2 | CCCACAGAAGTGTTAACAGA | 56 | 53.0905 | 2.9095 | 58.5688 | -2.5688 | 57.9344 | -1.9344 | 57.8695 | -1.8695 |
F1c | CAGCTTCACTAGTAGGTTGTTCTAA | 60 | 56.3314 | 3.6686 | 61.2276 | -1.2276 | 61.6264 | -1.6264 | 61.6355 | -1.6355 |
B2 | CATATTAGGTGCAAGGGCA | 56 | 53.196 | 2.804 | 58.8734 | -2.8734 | 58.4484 | -2.4484 | 58.4041 | -2.4041 |
B1c | TTGGTACACCAGTTTGTATTAACGG | 61 | 57.5257 | 3.4743 | 62.3652 | -1.3652 | 61.6909 | -0.690899999999999 | 61.5568 | -0.556800000000003 |
LF | TCACCAGTTTTCAAGACAACTTCC | 61 | 57.6674 | 3.3326 | 62.6468 | -1.6468 | 60.9274 | 0.072600000000001 | 61.0375 | -0.037500000000002 |
LB | GCTTATGTTGCTCGAAATCAAAGAC | 62 | 57.2039 | 4.7961 | 62.0586 | -0.058599999999999 | 61.3447 | 0.655299999999997 | 61.3449 | 0.655099999999997 |
Tm Range= | 7 | 6.0098 | 6.0345 | 5.7662 | 5.5487 | |||||
Average difference= | 3.42665 | -1.744575 | -1.0285875 | -1.050375 | ||||||
Tm(1)=reported by primer explorer v5 | ||||||||||
Tm(2)=following http://primerexplorer.jp/e/v5_manual/03.html (SantaLucia1998@[Na+]=1000 mM + Schildkraut salt correction [Na+]=162 mM) | ||||||||||
Tm(3)=SantaLucia1998@[Na+]=1000 mM + Owczarzy 2004 salt correction [Na+]=162 mM | ||||||||||
Tm(4)=Weber15@[Na+]=220 mM + Owczarzy 2004 salt correction [Na+]=162 mM | ||||||||||
Tm(5)=Weber15@[Na+]=119 mM + Owczarzy 2004 salt correction [Na+]=162 mM | ||||||||||
SantaLucia98=SantaLucia, John. "A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics." Proceedings of the National Academy of Sciences 95.4 (1998): 1460-1465. | ||||||||||
Owczarzy 2004=Owczarzy, Richard, et al. "Effects of sodium ions on DNA duplex oligomers: improved predictions of melting temperatures." Biochemistry 43.12 (2004): 3537-3554. | ||||||||||
Weber15=Weber, Gerald. "Optimization method for obtaining nearest-neighbour DNA entropies and enthalpies directly from melting temperatures." Bioinformatics 31.6 (2015): 871-877. |