primers set for RT-LAMP

26 views
Skip to first unread message

Dineshkumar Dandekar

unread,
Apr 10, 2020, 4:15:09 AM4/10/20
to LAMP-Seq

the primers you are using f3 and b3 may not be very specific

please conisder the primer below Tm is on lower side but higher Mg2+ of Bst3.0 to induce RT activity should help.

As for bar coding doing RT-LAMP using two sets will not increase cost much but can address and identify  more samples. 


Following primers were designed detection of SARS-CoV-2 isolate Wuhan-Hu-1 (NCBI Accession: NC_045512; GI:1798174254); isolate SARS-CoV-2/166/human/2020/IND (NCBI Accession: MT050493) and isolate SARS-CoV-2/29/human/2020/IND (NCBI Accession: MT012098). The region between Bases 1951 to 2950 and 21500 to 22500 was found to be divergent when compared to SARS-Coronavirus isolate Tor2 (NCBI Accession: AY274119). Sequence of this was region utilized to design primers for detection of COVID-19. The LAMP primers were designed using Primer Explorer Version 5 software (FUJITSU LIMITED, Japan; URL: http://primerexplorer.jp/lampv5e/index.html)


The primer sequence identified were checked for sequence homology to SARS-Coronavirus isolate Tor2 (NCBI Accession: AY274119) using NCBI-BLAST nucleotide alignment tool with blastn algorithm settings and CLUSTAL Omega. All the primers were considered unique to SARS-CoV-2.



Target Region 1951 to 2950

Primer Name

Genomic location 5’

Sequence (5’to 3’)

Tm

F3

2483

ATCTTCTTAGAGGGAGAAACA

55

B3

2761

GCCTTTGAGTGTGAAGGTA

56

F2

2507

CCCACAGAAGTGTTAACAGA

56

F1c

2585

CAGCTTCACTAGTAGGTTGTTCTAA

60

B2

2683

CATATTAGGTGCAAGGGCA

56

B1c

2601

TTGGTACACCAGTTTGTATTAACGG

61

LF

2550

TCACCAGTTTTCAAGACAACTTCC

61

LB

2626

GCTTATGTTGCTCGAAATCAAAGAC

62

FIP

CAGCTTCACTAGTAGGTTGTTCTAA-CCCACAGAAGTGTTAACAGA

 

BIP

TTGGTACACCAGTTTGTATTAACGG-CATATTAGGTGCAAGGGCA

 

 

Target Region 21500 to 22500

Primer Name

Genomic location 5’

Sequence (5’to 3’)

Tm

F3

21665

GGTGTTTATTACCCTGACAAAG

56

B3

21867

GTACCAAAAATCCAGCCTC

55

F2

21687

TTTTCAGATCCTCAGTTTTACATTC

57

F1c

21737

CATGGAACCAAGTAACATTGGAAAA

60

B2

21838

GACTTCTCAGTGGAAGCA

55

B1c

21772

CTCTGGGACCAATGGTACTAAGAG

61

LF

21712

GAAAGGTAAGAACAAGTCCTGAGTT

60

LB

21807

CTGTCCTACCATTTAATGATGGTGT

60

FIP

CATGGAACCAAGTAACATTGGAAAA-TTTTCAGATCCTCAGTTTTACATTC

 

BIP

CTCTGGGACCAATGGTACTAAGAG-GACTTCTCAGTGGAAGCA

 

 

Jonathan Schmid-Burgk

unread,
Apr 10, 2020, 4:22:46 AM4/10/20
to LAMP-Seq
Thanks Dineshkumar! I will include your primers in our next round of optimization. For us, the most critical parameter is sensitivity, do you have experience chemically modifying one of the primers, or titrating it in order to aid the RT step?

Thanks,
Jonathan

Dineshkumar Dandekar

unread,
Apr 10, 2020, 4:55:19 AM4/10/20
to LAMP-Seq
Hi Jonathan
A clarification I haven't had a chance to test these in lab since India is under lockdown.
No, I haven't given a thought to chemical modification for primers. Based on literature use of PNA hybrid will improve sensitive of binding
Will look it up

Dineshkumar Dandekar

unread,
Apr 11, 2020, 3:15:57 AM4/11/20
to LAMP-Seq

My Scheme designed for optimization of RT-LAMP. This was made for visual assay for detection with phenol red


Temp at 62°C, was considered and fixed  Rxn vol 20-25 µL(variable) based on suitability for implementation on wide scale 

Concentration of primers to test  based on review of literature for ZIKA, DENV, and some other papers which implemented Lateral flow with product.


dNTP optimization considered essential as it will affect available Mg2+ ions and MgSO4 conc. requirements

Buffer already has 2mM MgSO4 so values table are in addition to it


F3

0.2 µM

0.2 µM

0.2 µM

0.2 µM

0.2 µM

0.2 µM

0.2 µM

0.4 µM

0.4 µM

0.4 µM

0.4 µM

 

B3

0.2 µM

0.2 µM

0.2 µM

0.2 µM

0.2 µM

0.2 µM

0.2 µM

0.4 µM

0.4 µM

0.4 µM

0.4 µM

 

FIP

1.6 µM

1.6 µM

1.6 µM

1.6 µM

1.6 µM

1.6 µM

1.6 µM

1.6 µM

1.6 µM

1.6 µM

1.6 µM

 

BIP

1.6 µM

1.6 µM

1.6 µM

1.6 µM

1.6 µM

1.6 µM

1.6 µM

1.6 µM

1.6 µM

1.6 µM

1.6 µM

 

F2

0.1 µM

0.1 µM

0.1 µM

0.1 µM

0.1 µM

0.2 µM

0.2 µM

0.2 µM

0.2 µM

0.2 µM

0.2 µM

 

F1c

0.1 µM

0.1 µM

0.1 µM

0.1 µM

0.1 µM

0.2 µM

0.2 µM

0.2 µM

0.2 µM

0.2 µM

0.2 µM

 

B2

0.1 µM

0.1 µM

0.1 µM

0.1 µM

0.1 µM

0.2 µM

0.2 µM

0.2 µM

0.2 µM

0.2 µM

0.2 µM

 

B1c

0.1 µM

0.1 µM

0.1 µM

0.1 µM

0.1 µM

0.2 µM

0.2 µM

0.2 µM

0.2 µM

0.2 µM

0.2 µM

 

MgSO4

4.5 mM

4.5 mM

6 mM

6 mM

6 mM

6 mM

6 mM

6 mM

6 mM

6 mM

6 mM

 

dNTP

0.2 mM

0.2 mM

0.4 mM

0.2 mM

0.4 mM

0.4 mM

0.4 mM

0.4 mM

0.4 mM

0.2 mM

0.2 mM

 

Bst 3.0

2 U

4 U

2 U

4 U

4 U

2 U

4 U

2 U

4 U

2 U

4 U

 


 

Note Buffer already has 2mM MgSO4 so final will more by 2mM

Optimization for Bst 3.0 considered as it is most expensive component. If cost is non-issue then use 6.5 U without optimization

                     

The best condition found would be tested with 1 Unit enzyme also

 Primer Titration if required 

F3 1.6  µM and 0.8  µM, B3 vairable 0.5 to 2 µM , FIP and BIP 1.6 µM fixed based of literature Rest primers 0.1 µM Fixed


 

Mikolaj Slabicki

unread,
Apr 14, 2020, 1:09:33 AM4/14/20
to LAMP-Seq
Dear Dineshkumar,
Thanks a lot for this detailed protocol! I am sure it will be useful for future optimization.
Best,
Mikolaj

LIVIO MARTINS COSTA JUNIOR

unread,
Apr 15, 2020, 12:31:29 AM4/15/20
to LAMP-Seq
Dear Dandekar,
Thank you so much for your work. Very well done.
I have a question about the primer design. Did you design the primers in PrimerExplorer and after added the barcode?
Cheers

Dineshkumar Dandekar

unread,
Apr 15, 2020, 1:07:55 AM4/15/20
to LAMP-Seq
Hi Livio 

The primers were designed in primer explorer and these are not bar coded

These are regular primers have been designed to just amplify the target by RT-LAMP. 

Bar code need to be introduced in them at - location of FIP and BIP as per requirement 

I am not an expert in Bar coding please correct me if I am wrong.

Sorry if I have caused any confusion

Regards

Dinesh

Gerald Weber

unread,
Apr 21, 2020, 8:46:04 PM4/21/20
to LAMP-Seq
I have a question regarding these melting temperatures: Are they from the  primerexplorer software? 

If so, I'm finding them impossible to reproduce with the concentrations listed in the PrimerExplorerV5_Manual_1, its written that C=0.1 μM, but I only get close these values using a much higher concentration C=100 μM or even =200 μM.  Also, the sodium correction mentioned in http://primerexplorer.jp/e/v5_manual/03.html is quite outdated (1965), this could add a lot of error into these estimates.

best wishes

Gerald


Message has been deleted

Dineshkumar Dandekar

unread,
Apr 21, 2020, 11:45:49 PM4/21/20
to LAMP-Seq
Hi Gerald 

Thanks for looking at these sequence. The Tm estimates are from primer explorer v5. I understand these are not very accurate.
anyways most primers will be used at following working conc. and reaction done at Temp 62°C (initially fixed, minor optimization if required 62°C to 65°C)

F3, B3, F2, B2, F1c, B1c between about  0.1 to 0.2 μM   (approx)

FIP, BIP 1.6μM  (fixed)

Buffer 

20 mM Tris-HCl pH 8.8 @ 25°C


SALT   

10 mM (NH4)2SO4
150 mM KCl 
2 to 8 mM MgSO4

0.1% Tween® 20

dNTP about 2.5 mM

[minor correction required based on Bst 3.0 enzyme dilution (stoarge buffer is 100 mM KCl, 10 mM Tris-HCl, 0.1 mM EDTA, 1 mM DTT, 0.1% Triton® X-100, 50% Glycerol pH 7.4 @ 25°C) ]

Thanks for help

Regards

Dinesh

Gerald Weber

unread,
Apr 23, 2020, 8:31:45 PM4/23/20
to LAMP-Seq
I've tried to reproduce the Tm's following the instructions in the primer explorer website, Tm(2) below, and they are very different from the Tm(1) that software provided. However, if I change the salt correction I do get much closer, T(3). Tm(4) and Tm(5) are more up to date ways to calculate and the agree much better, on average, to Tm(1).

So my conclusion is that the Tm(1) calculation in the software was upgraded but the documentation apparently was not.

best regards

Gerald


PrimerSequenceTm(1)Tm(2)Tm(1)-Tm(2)Tm(3)Tm(1)-Tm(3)Tm(4)Tm(1)-Tm(4)Tm(5)Tm(1)-Tm(5)
F3ATCTTCTTAGAGGGAGAAACA5551.65763.342456.6123-1.612355.9247-0.92470000000000156.0868-1.0868
B3GCCTTTGAGTGTGAAGGTA5652.91433.085758.6039-2.603957.3318-1.331857.4679-1.4679
F2CCCACAGAAGTGTTAACAGA5653.09052.909558.5688-2.568857.9344-1.934457.8695-1.8695
F1cCAGCTTCACTAGTAGGTTGTTCTAA6056.33143.668661.2276-1.227661.6264-1.626461.6355-1.6355
B2CATATTAGGTGCAAGGGCA5653.1962.80458.8734-2.873458.4484-2.448458.4041-2.4041
B1cTTGGTACACCAGTTTGTATTAACGG6157.52573.474362.3652-1.365261.6909-0.69089999999999961.5568-0.556800000000003
LFTCACCAGTTTTCAAGACAACTTCC6157.66743.332662.6468-1.646860.92740.07260000000000161.0375-0.037500000000002
LBGCTTATGTTGCTCGAAATCAAAGAC6257.20394.796162.0586-0.05859999999999961.34470.65529999999999761.34490.655099999999997












Tm Range=76.0098
6.0345
5.7662
5.5487

Average difference=

3.42665
-1.744575
-1.0285875
-1.050375























Tm(1)=reported by primer explorer v5









Tm(2)=following http://primerexplorer.jp/e/v5_manual/03.html (SantaLucia1998@[Na+]=1000 mM + Schildkraut salt correction [Na+]=162 mM)

Tm(3)=SantaLucia1998@[Na+]=1000 mM + Owczarzy 2004 salt correction [Na+]=162 mM

Tm(4)=Weber15@[Na+]=220 mM + Owczarzy 2004 salt correction [Na+]=162 mM

Tm(5)=Weber15@[Na+]=119 mM + Owczarzy 2004 salt correction [Na+]=162 mM












SantaLucia98=SantaLucia, John. "A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics." Proceedings of the National Academy of Sciences 95.4 (1998): 1460-1465.

Owczarzy 2004=Owczarzy, Richard, et al. "Effects of sodium ions on DNA duplex oligomers: improved predictions of melting temperatures." Biochemistry 43.12 (2004): 3537-3554.

Weber15=Weber, Gerald. "Optimization method for obtaining nearest-neighbour DNA entropies and enthalpies directly from melting temperatures." Bioinformatics 31.6 (2015): 871-877.

Dineshkumar Dandekar

unread,
Apr 24, 2020, 5:49:39 AM4/24/20
to LAMP-Seq
Thanks Gerald,
Reply all
Reply to author
Forward
0 new messages