ERROR!! If this is a FASTQ file with integer (non-ASCII-encoded) qualities, try re-running with the --integer-quals option. Where to give this option?

107 views
Skip to first unread message

sandeep singh

unread,
Feb 28, 2018, 11:52:34 AM2/28/18
to jaffa-project

My JAFFA installation runs fine on demo data

Usually I use following command to run JAFFA
bpipe run --threads 1 ~/JAFFA-version-1.09/JAFFA_direct.groovy inputfile.fastq.gz

In one of the fastq file when I am running JAFFA, it throws me following error:
If this is a FASTQ file with integer (non-ASCII-encoded) qualities, try re-running with the --integer-quals option


I tried running JAFFA again by adding it in the command as given below (as there is nowhere written on how to include this option)

bpipe run --threads 1 -p --integer-quals ~/JAFFA-version-1.09/JAFFA_direct.groovy inputfile.fastq.gz

However, still I am getting the same error.

Can anyone please help me out in how to provide this option to run JAFFA successfully?

Nadia Davidson

unread,
Feb 28, 2018, 5:02:50 PM2/28/18
to jaffa-...@googlegroups.com
Hi, 

Can you try unzipping the fastq files to check they are good. If you have checksums for them even better.
Another options could be that the Phred scores are not 33 offset, but 64.

Cheers,
Nadia.

sandeep singh

unread,
Apr 19, 2018, 1:57:13 PM4/19/18
to jaffa-project
Sorry for so late reply.

The fastq file is correct.

My fastq file is as follows
@9f64d3c8-12d3-4941-a2b9-4c911483c79a runid=684c24d8ac976e22df9155764b5e11985ac563d1 sampleid=DNGQT0041_DirectRNA read=6814 ch=63 start_time=2018-03-29T04:39:23Z
CAGAGGCGGGCGCGAGGTAGTCCAGCTACTGGGAGGCTGAGGCAGGAGAATGGCGTGAACCGGGAAGAAGCTTGCAGTGAGCCGAGATTGCGCCACTGCGATGTGTCCGGCCTGGGGCAGAGCGAGACTCCGTCTCATCAATCCCATTTATATTCCATCAACCAACCTACAACCTAATCCACT
+
%%&%%)')//*(%%#''$')(./+,+)%()+5)%-)((('((&'%(%').(2,(('())-(,/+'&))-*&((''-,,-//950*-.22+,+,20-.+()&&&**..3/1.7))-1.%%&'(*)),**)*,,(&('')(+,%)'&$$$(&'(%'-*&%$%(')'$)(#$&'))&#'+&'(#$"
@0ab4c934-ad60-4d42-ba53-a1500737778e runid=684c24d8ac976e22df9155764b5e11985ac563d1 sampleid=DNGQT0041_DirectRNA read=1956 ch=78 start_time=2018-03-29T04:39:20Z
CAGTAAGGCGAAAATGAGTTGATGCAAACTTGCAGATTTTGTTGAAGACACCTACTGGCAAACCATTACCTTGAGGTCGAGGCCCAGTGACACCATTGAGAATGCATAAGCCAAAAATTCTAGACAAGGAGTATCCCACCTGACCAGCAGCGTCTGATATTTCTGCCAGCAACAGCTGGAGGACGGCCGTGTCATTTTCAGAACAACATTCCAGAAAGAGTCTCCAGCCTTGGTTGTTGTTTGCCTGTAGAGGTGGCTATTGAAAGCCTTACCACGTTCAGCTTGCCTCAGAAATACAACTGCGAATAAGATGATCGTTTGTAAGTGCTATTGCTGCCTTACCTTGCGTTGCTGCATAGAAGTGTGGTACACCAACAACTTATCCAAGAAGTCAAAATAAGGTTGTTTTGAAGGGCGTACCATCCAGGCCTCGAGCCTGGAGCCTTTAGTAAAGTGTCCTCTTTGAATACCTCTCCACATCCATATTTCACATCCGCCCATATCCCCTCCCCTACAAAATCCAG
+
%%&&%%&)$&&-0-0)%('*,)'%$'61%$$#%))--*)+).*(*-)*+%,)()(((4'*73,.(%(#&*),*)(($$'$+''/*',,.++((''&)*)++.&&#$#',)+1/775*-)%)((/-,-++(*(+&./)#+.).450+,,((((&$++,.+.*)$'')*&,+1)'$'&&(2((0(''/(,)))*%&&/,+&''--,)(##%&%+())2.))*(%%')#&'(),'-$*'$*(+'-18-,(%%%$'*),)((()+'*2.)*(&&$%((*,+,)+)(+4/-&$$%')-0/*(#$#&%%'%&)/4,,,,/.&&%'(&'()*()%'&&((&+*/'**&)(%$$#'*/1'*$#"%&&+*(%)'))&%%%%(-*(+.*%&#$&+(,(,)'%')-7+)//(.&,)&((*%/,)0+&%&%()&$.)&0-'($''('./-5'*+.-+*)%%'+81***((,(&')*$,/'$()#%#,(#%#$&'$$&$('&$($##$"&/'#$$$,6,+%+8;2%%%()-,&,-%$


Error message when parameter 'scores' set to 33

Running JAFFA version 1.09
Checking for required data files...
/software/jaffa/hg38files/hg38_genCode22.fa
/software/jaffa/hg38files/hg38_genCode22.tab
/software/jaffa/hg38files/known_fusions.txt
/software/jaffa/hg38fastafile/hg38.fa
/software/jaffa/hg38files/Masked_hg38.1.bt2
/software/jaffa/hg38files/hg38_genCode22.1.bt2
All looking good

================================== Stage prepare_reads (combined) ==================================
TrimmomaticSE: Started with arguments: -threads 1 -phred33 ~/jaffa_input/combined_a_b.fastq.gz ~/run_jaffa/combined/combined_trim.fastq LEADING:0 TRAILING:0 MINLEN:35
Input Reads: 324371 Surviving: 291309 (89.81%) Dropped: 33062 (10.19%)
TrimmomaticSE: Completed successfully
291309 reads; of these:
  291309 (100.00%) were unpaired; of these:
    287387 (98.65%) aligned 0 times
    3922 (1.35%) aligned exactly 1 time
    0 (0.00%) aligned >1 times
1.35% overall alignment rate
Error: Encountered one or more spaces while parsing the quality string for read 07788117-030a-418b-8531-e2db3eee45cd runid=71c99e5b3ce7c1e3e205be00398a299dd54e249b sampleid=DNGQT0041_DirectRNA read=44 ch=253 start_time=2018-03-29T02:26:58Z.  If this is a FASTQ file with integer (non-ASCII-encoded) qualities, try re-running with the --integer-quals option.
terminate called after throwing an instance of 'int'
(ERR): bowtie2-align died with signal 6 (ABRT) (core dumped)
ERROR: Command failed with exit status = 1 : 



Error message when parameter 'scores' set to 64

Running JAFFA version 1.09
Checking for required data files...
/software/jaffa/hg38files/hg38_genCode22.fa
/software/jaffa/hg38files/hg38_genCode22.tab
/software/jaffa/hg38files/known_fusions.txt
/software/jaffa/hg38fastafile/hg38.fa
/software/jaffa/hg38files/Masked_hg38.1.bt2
/software/jaffa/hg38files/hg38_genCode22.1.bt2
All looking good

================================== Stage prepare_reads (combined) ==================================
TrimmomaticSE: Started with arguments: -threads 1 -phred64 ~/jaffa_input/combined_a_b.fastq.gz ~/run_jaffa/combined/combined_trim.fastq LEADING:0 TRAILING:0 MINLEN:35
Input Reads: 324371 Surviving: 0 (0.00%) Dropped: 324371 (100.00%)
TrimmomaticSE: Completed successfully
0 reads
0.00% overall alignment rate
0 reads
0.00% overall alignment rate

================================== Stage get_unmapped (combined) ===================================
0 reads
0.00% overall alignment rate
java -ea -Xmx200m -cp /nv/vol80/hlilab/sandeep/software/jaffa/JAFFA-version-1.09/tools/bbmap/current/ jgi.ReformatReads in=/sfs/lustre/scratch/ss7mh/nanopore_data/DirectRNA/againrun_jaffa/combined/unmapped.fastq out=/sfs/lustre/scratch/ss7mh/nanopore_data/DirectRNA/againrun_jaffa/combined/temp.fasta threads=1
Executing jgi.ReformatReads [in=/sfs/lustre/scratch/ss7mh/nanopore_data/DirectRNA/againrun_jaffa/combined/unmapped.fastq, out=/sfs/lustre/scratch/ss7mh/nanopore_data/DirectRNA/againrun_jaffa/combined/temp.fasta, threads=1]
Set threads to 1
Input is being processed as unpaired
Input:                   0 reads           0 bases
Output:                 0 reads (NaN%) 0 bases (NaN%)
Time:                         1.089 seconds.
Reads Processed:           0 0.00k reads/sec
Bases Processed:           0 0.00m bases/sec
java -Djava.library.path=/nv/vol80/hlilab/sandeep/software/jaffa/JAFFA-version-1.09/tools/bbmap/jni/ -ea -Xmx170273m -Xms170273m -cp /nv/vol80/hlilab/sandeep/software/jaffa/JAFFA-version-1.09/tools/bbmap/current/ jgi.Dedupe sort=d in=/sfs/lustre/scratch/ss7mh/nanopore_data/DirectRNA/againrun_jaffa/combined/temp.fasta out=combined/combined.fasta threads=1 absorbcontainment=f
Executing jgi.Dedupe [sort=d, in=/sfs/lustre/scratch/ss7mh/nanopore_data/DirectRNA/againrun_jaffa/combined/temp.fasta, out=combined/combined.fasta, threads=1, absorbcontainment=f]
Set threads to 1
Initial:
Memory: max=172593m, free=170689m, used=1904m
Found 0 duplicates.
Finished exact matches.    Time: 0.038 seconds.
Memory: max=172593m, free=167832m, used=4761m
Input:                   0 reads 0 bases.
Duplicates:             0 reads (NaN%) 0 bases (NaN%)     0 collisions.
Result:                 0 reads (NaN%) 0 bases (NaN%)
Sorted output.             Time: 0.018 seconds.
Memory: max=172593m, free=167832m, used=4761m
Printed output.            Time: 0.009 seconds.
Memory: max=172593m, free=166880m, used=5713m
Time:   0.071 seconds.
Reads Processed:           0 0.00k reads/sec
Bases Processed:           0 0.00m bases/sec

============================ Stage align_reads_to_annotation (combined) ============================
expr: division by zero
ERROR: Command failed with exit status = 2 : 

SEQ_COUNT=`head -n 1000 combined/combined.fasta | grep "^>" | wc -l` ;                 SUM_READ_LENGTHS=`head -n 1000 combined/combined.fasta | grep -v ">" | tr -d "\n" | wc --chars` ;                 AVERAGE_READ_LENGTH=`expr $SUM_READ_LENGTHS / $SEQ_COUNT` ;                 if [ 0 -eq "0" ] ; then                     if [ $AVERAGE_READ_LENGTH -le 100 ] ; then                         readTile=15 ;                     else readTile=18 ;                     fi ;                 else readTile=0 ;                 fi ;                 echo "Using tileSize of $readTile" ;                 function run_blat {                     time /nv/vol80/hlilab/sandeep/software/jaffa/JAFFA-version-1.09/tools/bin/blat /nv/vol80/hlilab/sandeep/software/jaffa/hg38files/hg38_genCode22.fa combined/combined.fasta -minIdentity=98 -minScore=30 -tileSize=$1                         -maxIntron=0 combined/combined.psl 2>&1 | tee /sfs/lustre/scratch/ss7mh/nanopore_data/DirectRNA/againrun_jaffa/combined/log_blat ;                 } ;                 run_blat $readTile;                 `### test for the Blat tileSize bug (version 35) ###` ;                 if [[ `cat /sfs/lustre/scratch/ss7mh/nanopore_data/DirectRNA/againrun_jaffa/combined/log_blat` == *"Internal error genoFind.c"* ]] ; then                    echo "Blat error with tileSize=$readTile" ;                    echo "Let's try again with tileSize=15" ;                    run_blat 15;                 fi ; 


========================================= Pipeline Failed ==========================================

One or more parallel stages aborted. The following messages were reported: 

Branch combined in stage Unknown reported message:

Command failed with exit status = 2 : 

Reply all
Reply to author
Forward
0 new messages