Genome in .fasta format display chromosomes unordered

[Jose Luis Blanco Pastor]

Dear all,

I have uploaded a genome in fasta format:

>Lp_chr1_0

TTTTTGAATTTCCATGTTTGAAACCAAAAACCACTTCTCTTCATGCATGCTTGACTTCAT
AAGACAGAGTTTAGCTAGGGTTAGGGGTAGATACATGATTTTCCTGGTTTGAATATGTCT
AGACCTTGTTTATCAACTTAATTGAATGCTTACTATAGACATAAGAAGACTACGTGCCTT

>Lpchr2_0

TTTTTGAATTTCCATGTTTGAAACCAAAAACCACTTCTCTTCATGCATGCTTGACTTCAT
AAGACAGAGTTTAGCTAGGGTTAGGGGTAGATACATGATTTTCCTGGTTTGAATATGTCT
AGACCTTGTTTATCAACTTAATTGAATGCTTACTATAGACATAAGAAGACTACGTGCCTT

etc.

When I upload this IGV sets the order of chromosomes by chromosome size but not by name or by the way they are ordered in the fasta file or the fasta.fai file.

The chromosome track shows:

Lp_chro4_0, Lp_chr3_0, Lp_chr7_0.1 ... which is the order by size.

I would appreciate if you indicate a way to appropriately fix this.

Regards.

[igv-help]

Hi,

You did not state the version of IGV you are using, but this is a known issue with release 2.17.   It will be fixed in 2.17.5, which will be released by the end of June.  If you need a fix beforehand there are 2 options.

(1) Use the development version of IGV, which you can download from https://igv.org/doc/desktop/#DownloadSnapshot/

(2) Use a ".json" genome definition rather than a fasta, and specify the order of chromosomes explicitly with the "chromosomeOrder" property.  The json file should be in plain text and have file extension ".json".  A minimal example follows.  You can use an absolute file path for the URL strings

{
"id": "hg38",
"name": "Human (GRCh38/hg38)",
"fastaURL": "https://igv-genepattern-org.s3.amazonaws.com/genomes/seq/hg38/hg38.fa",
"indexURL": "https://igv-genepattern-org.s3.amazonaws.com/genomes/seq/hg38/hg38.fa.fai",
"chromosomeOrder": "chr1,chr2,chr3,chr4,chr5,chr6,chr7,chr8,chr9,chr10,chr11,chr12,chr13,chr14,chr15,chr16,chr17,chr18,chr19,chr20,chr21,chr22,chrX,chrY"
}