Trying to visualize a series of bedgraph files with respect to a custom reference genome

1,341 views
Skip to first unread message

shah.v...@gmail.com

unread,
Mar 28, 2017, 3:18:47 PM3/28/17
to igv-help
Hi,

I have a series of bedgraph files that I want to visualize using IGV. 

The bedgraph files are named as follows : 

iSLK-0h.kshvminus.bedgraph
iSLK-0h.kshvplus.bedgraph
iSLK-6h.kshvplus.bedgraph
iSLK-6h.kshvminus.bedgraph

The content of the bedgraph files is as follows :

track type=bedGraph name="iSLK-0h.mTD Total Tags = 9.45e+06, normalized to 1.00e+07 - strand" description="iSLK-0h.mTD Total Tags = 9.45e+06, normalized to 1.00e+07 - strand" color=115,38,65 visibility=full neOnOff=on autoScale=on yLineMark="0.0" alwaysZero=on graphType=bar maxHeightPixels=128:75:11 windowingFunction=maximum smoothingWindow=off
chr1 778 840 0.53
chr1 840 978 1.06
chr1 978 1040 0.53
chr1 1082 1277 0.53
chr1 1277 1282 1.06

On reading through IGV docs I found that bedgraph files can be directly visualized by loading them into IGV if I have the reference genome.

I have the reference genome in fasta format named sequence.fasta, which I have loaded into IGV using the add genome option. 

The header of the reference genome looks like this : 
>GQ994935.1 Human herpesvirus 8 strain JSC-1 clone BAC16, complete genome
TACTAATTTTCAAAGGCGGGGTTCTGCCAGGCATAGTCTTTTTTTCTGGCGGCCCTTGTGTAAACCTGTC
TTTCAGACCTTGTTGGACATCCCGTACAATCAAGATGTTCCTGTATGTTGTTTGCAGTCTGGCGGTTTGC
TTTCGAGGACTATTAAGCCTTTCTCTGCAATCGTCTCCAAATTTGTGCCCTGGAGTGATTTCAACGCCTT

However, when I load the data into IGV, I do not get any results. This is the output I am getting.



I'm a complete beginner in using IGV and bioinformatics in general and am looking forward to help.

Please let me know what I am doing wrong.

James Robinson

unread,
Mar 28, 2017, 3:22:16 PM3/28/17
to igv-help
Hi,  the chromosome names in your bedgraph snippet do not match the names in your fasta snippet so there is nothing to display.    I'm not sure what you expect to see here, do you have any bedgraph records in the file with chromosome (sequence) name GQ994935.1?


--

---
You received this message because you are subscribed to the Google Groups "igv-help" group.
To unsubscribe from this group and stop receiving emails from it, send an email to igv-help+unsubscribe@googlegroups.com.
To view this discussion on the web visit https://groups.google.com/d/msgid/igv-help/9adead99-594c-4f0a-8c1e-bc1f8cd7e585%40googlegroups.com.
For more options, visit https://groups.google.com/d/optout.

shah.v...@gmail.com

unread,
Mar 28, 2017, 6:11:27 PM3/28/17
to igv-help
Hi Jim,

Thanks for pointing that out. I changed the chromosome names in my bed graph files and it started working. 

Here's the output I get :



 I just need to do 2 more things. 

1. As you can see I have values from the + and - strand of the virus. I would like to plot the negative strand values below the X axis and reverse the track somehow. I read through other posts on this topic and realized that plotting them onto the same track may not be possible. However, I am okay with plotting them in different tracks,but I just want the negative strand values to appear below the X axis. I see there is an option to change color to represent the negative values, but is there somehow I can achieve what I want ?

2.   When I loaded the reference genBank file in gtf format, the plot displays the IDS by default. However, I want to view the 'products' as labels in the plot. Is there any possible way I could achieve this?

I would really appreciate help on this.

Thanks

James Robinson

unread,
Mar 28, 2017, 6:39:20 PM3/28/17
to igv-help
Hi, you'll need to modify your bed graph files to use negative scores (4th column) for the negative strand values.   Just multiply them by -1.      Sorry there is no built-in method to do that.

--

---
You received this message because you are subscribed to the Google Groups "igv-help" group.
To unsubscribe from this group and stop receiving emails from it, send an email to igv-help+unsubscribe@googlegroups.com.
Reply all
Reply to author
Forward
0 new messages