Hi,
I have a series of bedgraph files that I want to visualize using IGV.
The bedgraph files are named as follows :
iSLK-0h.kshvminus.bedgraph
iSLK-0h.kshvplus.bedgraph
iSLK-6h.kshvplus.bedgraph
iSLK-6h.kshvminus.bedgraph
The content of the bedgraph files is as follows :
track type=bedGraph name="iSLK-0h.mTD Total Tags = 9.45e+06, normalized to 1.00e+07 - strand" description="iSLK-0h.mTD Total Tags = 9.45e+06, normalized to 1.00e+07 - strand" color=115,38,65 visibility=full neOnOff=on autoScale=on yLineMark="0.0" alwaysZero=on graphType=bar maxHeightPixels=128:75:11 windowingFunction=maximum smoothingWindow=off
chr1 778 840 0.53
chr1 840 978 1.06
chr1 978 1040 0.53
chr1 1082 1277 0.53
chr1 1277 1282 1.06
On reading through IGV docs I found that bedgraph files can be directly visualized by loading them into IGV if I have the reference genome.
I have the reference genome in fasta format named sequence.fasta, which I have loaded into IGV using the add genome option.
The header of the reference genome looks like this :
>GQ994935.1 Human herpesvirus 8 strain JSC-1 clone BAC16, complete genome
TACTAATTTTCAAAGGCGGGGTTCTGCCAGGCATAGTCTTTTTTTCTGGCGGCCCTTGTGTAAACCTGTC
TTTCAGACCTTGTTGGACATCCCGTACAATCAAGATGTTCCTGTATGTTGTTTGCAGTCTGGCGGTTTGC
TTTCGAGGACTATTAAGCCTTTCTCTGCAATCGTCTCCAAATTTGTGCCCTGGAGTGATTTCAACGCCTT
However, when I load the data into IGV, I do not get any results. This is the output I am getting.

I'm a complete beginner in using IGV and bioinformatics in general and am looking forward to help.
Please let me know what I am doing wrong.