psl viewing in genome view

[sisterdot]

Dear all,

i am using igv and a batch file in visualizing the position of short
sequences on the mouse genome

eg. i am mapping a primer seq such as
----------
>primer
ATGGAGACGCGTGGTCTGAGCAAGCAGTGAGCGCCT
----------

to the mouse genome using blat
----------
psLayout version 3

match mis- rep. N's Q gap Q gap T gap T gap strand Q Q
Q Q T T T T block blockSizes qStarts tStarts
match match count bases count bases name size
start end name size start end count
---------------------------------------------------------------------------------------------------------------------------------------------------------------
36 0 0 0 0 0 0 0 + 1 36 0 36 chr11 121843856 75813464 75813500 1 36,
0, 75813464,
----------

when importing the psl file into igv the global view of all
chromosomes does not yield the feature visible...
only upon zooming into chr11 i can see the feature of the track...

is there a way to make the primer position visible in the whole genome
view...

thanks a lot
Maria

[Jim Robinson]

Hi,  currently there is not a way to see these features in whole-genome view.  you should, however, see a density bar-chart showing where the features are.  Do you see anything at all?

-- Jim
 

[sisterdot]

Hey Jim...

thanks for your reply (was on vacation :-) )

> currently there is not a way to see these features in whole-genome
> view. you should, however, see a density bar-chart showing where the
> features are.

basically i don't see anything at all for the psl track in the genome
view ("All") in case of a single primer..
when i change to the chromosome where the primer maps i suddenly can
see the feature...

this is different if i have a loooot of primers and a manymany-line
psl file- than i also see a density bar chart for the psl file in the
genome view...
i can't say exactly when i will see a density barchart upon psl import
and when not...

maybe its a platform dependent visualization problem- should check it
on another OS...

for now i will live with it i guess :-)

all the best
Maria

[James Robinson]

Hi, by single primer do you mean that the PSL file has a single feature in it?