igvtools index error message

[Nicki]

Hello

I am trying to index a vcf file using igvtools from within IGV and am
getting an error:

"Error: The provided VCF file is malformed at line number 40:
Unparsable vcf record with allele M "

Here is the top of the VCF file, including line 40:

##fileformat=VCFv4.0
##fileDate=2012-01-30
##source=Platypus_Version_0.1.5
##INFO=<ID=func,Number=1,Type=String,Description="Functional category:
exnoic, intergenic etc">
##INFO=<ID=gene,Number=1,Type=String,Description="RefSeq gene name">
##INFO=<ID=exon_func,Number=1,Type=String,Description="Exonic function
of the variant">
##INFO=<ID=AAchange,Number=1,Type=String,Description="Amino Acid
change">
##INFO=<ID=cons46,Number=1,Type=String,Description="UCSC 46 species
conservation score">
##INFO=<ID=segdup,Number=1,Type=Float,Description="UCSC segment
duplication score">
##INFO=<ID=1000g,Number=1,Type=Float,Description="1000 genomes allelic
frequency">
##INFO=<ID=dbsnp,Number=1,Type=String,Description="dbSNP ID">
##INFO=<ID=sift,Number=1,Type=Float,Description="SIFT score">
##INFO=<ID=pp2,Number=1,Type=Float,Description="PolyPhen2 score">
##INFO=<ID=phylop,Number=1,Type=Float,Description="Phylop score">
##INFO=<ID=mutT,Number=1,Type=Float,Description="Mutation Taster
score">
##INFO=<ID=LRT,Number=1,Type=Float,Description="LRT score">
##INFO=<ID=FR,Number=0,Type=Float,Description="Estimated population
frequency">
##INFO=<ID=RPV,Number=0,Type=Float,Description="Median minimum base
quality for bases around variant">
##INFO=<ID=RPV,Number=0,Type=Float,Description="Reverse strand p-
value">
##INFO=<ID=TCR,Number=0,Type=Integer,Description="Total reverse strand
coverage at this locus">
##INFO=<ID=HP,Number=1,Type=Integer,Description="Homopolmer run
length">
##INFO=<ID=ABPV,Number=0,Type=Float,Description="Allele-bias p-value.
Testing for low variant coverage">
##INFO=<ID=TR,Number=0,Type=Integer,Description="Total number of reads
containing this variant">
##INFO=<ID=PP,Number=0,Type=Float,Description="Posterior probability
(phred scaled) that this variant segregates">
##INFO=<ID=NF,Number=0,Type=Integer,Description="Total number of
forward reads containing this variant">
##INFO=<ID=SC,Number=1,Type=String,Description="Genomic sequence 10
bases either side of variant position">
##INFO=<ID=FPV,Number=0,Type=Float,Description="Forward strand p-
value">
##INFO=<ID=TCF,Number=0,Type=Integer,Description="Total forward strand
coverage at this locus">
##INFO=<ID=NR,Number=0,Type=Integer,Description="Total number of
reverse reads containing this variant">
##INFO=<ID=RMP,Number=0,Type=Float,Description="RMS Position in reads
of Variant">
##INFO=<ID=TC,Number=0,Type=Integer,Description="Total coverage at
this locus">
##FILTER=<ID=sb,Description="Variant fails strand-bias filter">
##FILTER=<ID=ab,Description="Variant fails allele-bias filter">
##FILTER=<ID=badReads,Description="Variant supported only by reads
with low quality bases close to variant position, and not present on
both strands.">
##FILTER=<ID=hp10,Description="Flanking sequence contains homopolymer
of length 10 or greater">
##FORMAT=<ID=GL,Number=.,Type=Float,Description="Genotype log-
likelihoods (log10) for AA,AB and BB genotypes, where A = ref and B =
variant. Only applicable for bi-allelic sites">
##FORMAT=<ID=GT,Number=1,Type=String,Description="Unphased genotypes">
##FORMAT=<ID=NR,Number=1,Type=Integer,Description="Number of reads
covering variant in this sample">
##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype quality,
as Phred score">
#CHROM POS ID REF ALT QUAL FILTER INFO
FORMAT AW_SC_4654.bam
1 10146 . AC A 118 PASS
ABPV=4.72e-01;FPV=3.72e-09;FR=0.5003;HP=4;NF=6;NR=2;PP=118;RMP=65.56;RPV=3.43e-01;SC=CCTAACCCTAACCCCTAACCC;TC=31;TCF=25;TCR=6;TR=8;func=intergenic;gene=NONE(dist=NONE)
WASH7P(dist=4215);segdup=0.99 GT:GL:GQ:NR
0/1:-182.49,-146.41,-145.22:32:32
1 12783 . G A 110 PASS ABPV=1.00e
+00;FPV=1.00e
+00;FR=1.0000;HP=1;MMLQ=33;NF=6;NR=0;PP=110;RMP=35.03;RPV=1.00e
+00;SC=CGGGGCCGGCGTCTCCTGTCT;TC=6;TCF=6;TCR=0;TR=6;func=intergenic;gene=NONE(dist=NONE)
WASH7P(dist=1579);segdup=0.99;1000g=0.58;dbsnp=rs62635284
GT:GL:GQ:NR 1/1:-32.34,-4.13,0.0:50:6
1 14464 . A T 154 PASS ABPV=1.00e
+00;FPV=1.00e
+00;FR=1.0000;HP=1;MMLQ=35;NF=10;NR=0;PP=154;RMP=51.55;RPV=1.00e
+00;SC=TTAAGAACACAGTGGCGCAGG;TC=10;TCF=10;TCR=0;TR=10;func=ncRNA_exonic;gene=WASH7P;segdup=0.99;1000g=0.17
GT:GL:GQ:NR 1/1:-52.06,-15.75,-9.98:72:10
1 14930 . A G 64 PASS ABPV=1.00e
+00;FPV=8.59e-01;FR=0.5000;HP=1;MMLQ=33;NF=18;NR=8;PP=64;RMP=63.67;RPV=1.47e-03;SC=ACAGAATTACAAGGTGCTGGC;TC=65;TCF=31;TCR=34;TR=26;func=ncRNA_intronic;gene=WASH7P;segdup=0.99;1000g=0.50;dbsnp=rs6682385
GT:GL:GQ:NR 1/0:-220.74,-198.5,-398.09:99:65
1 15118 . A G 28 PASS ABPV=1.00e
+00;FPV=1.00e
+00;FR=0.5000;HP=2;MMLQ=30;NF=0;NR=7;PP=28;RMP=45.42;RPV=3.15e-01;SC=CCCCCATGACACTCCCCAGCC;TC=17;TCF=0;TCR=17;TR=7;func=ncRNA_intronic;gene=WASH7P;segdup=0.99;1000g=0.35;dbsnp=rs11580262
GT:GL:GQ:NR 0/1:-39.1,-25.04,-63.71:64:17
1 15211 . T G 200 PASS ABPV=1.00e
+00;FPV=1.00e
+00;FR=0.5000;HP=1;MMLQ=32;NF=13;NR=18;PP=200;RMP=56.34;RPV=1.00e
+00;SC=AGACAGCGGCTGTTTGAGGAG;TC=35;TCF=13;TCR=22;TR=31;func=ncRNA_intronic;gene=WASH7P;segdup=0.99;1000g=0.63;dbsnp=rs11586607
GT:GL:GQ:NR 1/0:-209.81,-120.44,-129.85:43:35

How do I fix this?

Thanks, Nicki
MRC Molecular Haematology Unit

[Jim Robinson]

Hi Niki,

Could you try this with the pre-release igvtools 2.0, which you can download from here

http://www.broadinstitute.org/igv/projects/downloads/igvtools_test.zip

or

http://www.broadinstitute.org/igv/projects/downloads/igvtools_nogenomes_test.zip

The second option is much smaller, but you will need to move or copy your "genomes" folder from the previous installation.

Thanks

Jim

[Nicki Gray]

Hi Jim

Thanks for your reply. 

I noticed that in the VCF file I have been given there was whitespace in the INFO field which I have now replaced with an underscore but I am still getting the same error message.

I downloaded igvtools 2.0 as suggested and using this I get the following:

"The provided VCF file is malformed at approximately line number 2412715: Unparsable vcf record with allele M"

Lines 2412714-2412716 are below:

3 60830521 . C T 200 PASS ABPV=1.00e+00;FPV=1.90e-01;FR=1.0000;HP=2;MMLQ=33;NF=20;NR=22;PP=200;RMP=61.25;RPV=1.00e+00;SC=TCTTCATTAGCGCTACATAGC;TC=43;TCF=21;TCR=22;TR=42;func=intronic;gene=FHIT;1000g=0.90;dbsnp=rs1900668 GT:GL:GQ:NR 1/1:-561.04,-478.72,-466.88:99:43

3 60830534 . M C 200 PASS ABPV=1.00e+00;FPV=1.00e+00;FR=1.0000;HP=1;MMLQ=34;NF=21;NR=21;PP=200;RMP=61.16;RPV=1.00e+00;SC=TACATAGCTGMCTTATTATTC;TC=42;TCF=21;TCR=21;TR=42 GT:GL:GQ:NR 1/1:-579.73,-519.38,-507.47:100:42

3 60830545 . G T 116 PASS ABPV=1.00e+00;FPV=1.00e+00;FR=1.0000;HP=1;MMLQ=32;NF=17;NR=17;PP=116;RMP=59.86;RPV=1.00e+00;SC=CTTATTATTCGTGGTCCCCTA;TC=34;TCF=17;TCR=17;TR=34;func=intronic;gene=FHIT;1000g=0.89;dbsnp=rs2594129 GT:GL:GQ:NR 1/1:-469.5,-442.17,-435.84:79:34

Thanks, Nicki

---------------------
Nicki Gray
MRC Molecular Haematology Unit
01865 222434

[Jim Robinson]

Hi, apologies for the delayed response.  I needed to confirm with the "GATK" team who developed this code.  This is their response:

 One of the alleles is "M" which isn't allowed in the spec (it can only be A,C,G,T, or N).

[Nicki Gray]

Hi 

thanks for your email.

In the VCF files I have been given there are IPAUC codes - so the M is A or C

Can IGV tools not handle IPAUC codes?  Is the only way to get IGVtools to work for for me to write a script to convert IUPAC codes to the bases?

Thanks, Nicki

---------------------
Nicki Gray
MRC Molecular Haematology Unit
01865 222434

[James Robinson]

Hi Nicki,

The VCF specification does not allow IPAUC codes.  What tool created this file?  I think the best forum for this is one of the VCF mailing lists, or the GATK forum  (the VCF reader is part of the GATK).

Converting them to a base or "N" is a workaround.

-- Jim

[Nicki Gray]

Hi Jim

This file is was created using  Platypus_Version_0.1.5 (an unpublished program written at WTCHG).

WTCHG do use IGV on files from Platypus and so must have come up against this problem - I'll see if I can contact someone there and find out what they do.

Thanks for your help,

Nicki

[James Robinson]

Nicki,  that's not to say there aren't tools that can use this.  We use a strict VCF reader with respect to the spec.   Again the VCF or GATK forums are the place to go,  I'm not the expert on this.