A few changes after deleted nucleotide

[Aneta Molenda]

Dear

Variant was reported as LBX1 c.707delT p.(Val236fs), suggesting that it was just T deleted. In reality there were a few changes after deleted nucleotide. They do not affect final short amino acid nomenclature p.(Val236fs), but there is no common SNPs in these positions. I think all changes should be included in variant description, so NM_006562.5:c.707_717delinsCTTTCCCCCT. 

Could you confirm what is correct:

1.        NM_006562.5:c.707delT p.(Val236fs)

Or

2.       NM_006562.5: c.707_717delinsCTTTCCCCCT p.(Val236fs)

Sequence:

CCGGTCCTCCCCCCAGGCGCCCCGAAG

CCGGCTTTCCCCCTGGCGCCCCGAAGG

 

          Thank you

                       Aneta Molenda

[Johan den Dunnen]

Dear Aneta,

following current HGVS nomenclature the variant you give CCGGTCCTCCCCCCAGGCGCCCCGAAG to CCGGCTTTCCCCCTGGCGCCCCGAAGG) should be described as NM_006562.5:c.[707del;709C>T;711C>T;717A>T] p.(Val236Alafs*59) (see https://hgvs-nomenclature.org/stable/recommendations/DNA/delins/ where it states "two variants separated by one or more nucleotides should be described individually and not as a "delins"."). NM_006562.5: c.707_717delinsCTTTCCCCCT describes the same DNA variants but it does not follow current HGVS nomenclature recommendations.

Best regards,

Johan den Dunnen
HUGO HGVS Variant Nomenclature Committee (HVNC)

Op maandag 28 april 2025 om 13:20:39 UTC+2 schreef Aneta Molenda: