Description of multiple variants in the same haplotype in a patient sample

[Dr. Meshach Paul]

Dear All, 

I have multiple successive variants in a patient as seen in the attached screenshot of IgV. The Bioinformatics pipeline called this as three different variants 

1. ARID1A(NM_006015.6):c.136_140delinsTCCTGCC p.(Glu46SerfsTer6) chr1:27023030

2. ARID1A(NM_006015.6):c.144_152delinsC p.(Glu49GlyfsTer59) at locus chr1:27023037

3. ARID1A(NM_006015.6):c.156_172delinsTGCCTTCATTTCCCC p.(Ala54PhefsTer56) at locus chr1:27023050. 

However, when considering the amino acids involved, I had to verify the same. I later used variant validator giving the genomic alterations as input which combined the complete sequence from Chr1:27023030-27023068 (Chr1:27023030GAGCGCGGGGAAATGAAGGCAGCCGCCGGGCAGGAAAGC>TCCTGCCCGGCGGCTGCCTTCATTTCCCGC). The output was ARID1A(

NM_006015.6): Glu46_Ser58delinsSerCysProAlaAlaAlaPheIleSerArg. 

Note: There was one unaffected amino acid in-between which is marked with a red box in the screenshot attached. 

I have attached the screenshot for the IGV for reference. Kindly let me know if I can go with the output given by variant validator, ie., Glu46_Ser58delinsSerCysProAlaAlaAlaPheIleSerArg. 

Screenshot: 

Regards, 

Meshach Paul

[m.a.sa...@lumc.nl]

Dear Meshach,

Interesting variants, many aspects to consider here!

Do you also have the actual genomic variant calls from your pipeline?

And how did you construct the larger delins? It seems the three initial variants you report lead to a different single delins than you report.

The corresponding description probably needs to be NM_006015.6:c.136_172delinsTCCTGCCCGGCGGCTGCCTTCATTTCCCC (which inserts one extra trailing C than yours) [1].

The protein prediction then becomes NC_000001.10(NP_006006.3):p.(Glu46Serfs*62), which might be more aligned with your expectations.

What might also be of interest to you is that the allele can alternatively be described as:

NM_006015.6:c.[136_141del;142_170inv;171_172del]

Regards,

Mark

ps. all of this can be discovered using the Mutalyzer tool suite

---

From: hgvs-nom...@googlegroups.com <hgvs-nom...@googlegroups.com> on behalf of Dr. Meshach Paul <meshb...@gmail.com>
Sent: Wednesday, December 11, 2024 6:34 AM
To: HGVS Nomenclature <hgvs-nom...@googlegroups.com>
Subject: [hgvs-nomenclature] Description of multiple variants in the same haplotype in a patient sample

 

--
You received this message because you are subscribed to the Google Groups "HGVS Nomenclature" group.
To unsubscribe from this group and stop receiving emails from it, send an email to hgvs-nomenclat...@googlegroups.com.
To view this discussion visit https://groups.google.com/d/msgid/hgvs-nomenclature/00eaceb8-895f-4ae7-b0a4-ee7e8014c8fbn%40googlegroups.com.

[Johan den Dunnen]

Dear Meshach,

assuming the variant descriptions on DNA level you give are correct (checking the alignment goes too far), I have to point out that the predicted consequences on the protein level for variants 2 and 3 are not correct, they will be influenced by the predicted consequences of variant 1 (a frame shift).

For variants like this, it is better to merge the predicted consequences on the protein level, preventing incorrect predictions are given. As pointed out by Mark, the best solution is probably to also merge the variant description on the DNA level, making sure you get one correct description of the predicted consequences on the protein level.

Best regards,

Johan den Dunnen
HUGO HGVS Variant Nomenclature Committee (HVNC)

Op donderdag 12 december 2024 om 19:58:00 UTC+1 schreef m.a.sa...@lumc.nl: