HGVS nomenclature of mutations in cis

32 views
Skip to first unread message

Sudhisha Dubey

unread,
Dec 11, 2025, 5:46:30 AM12/11/25
to HGVS Nomenclature
Dear Team
I have found two variants in cis;  intron splice 2 mutation (i2g)  (c. 293-13A/C>G)  AND p.Q319* (c.955C>T) mutation of CYP21A2 gene in one of our CAH patients.

Its nomenclature at cdna level is : c.[293-13A/C>G; c.955C>T]
and at protein level is : p.[i2g;Q319*],   or is it p.[ (?);Q319*].

Would be grateful if you could  let me know the correcet nomenclature of these twomutations in cis at prtein level.

Thanks and Regars
Dr Sudhisha Dubey
Institute of Medical Genetics nad Genomics
Nre Delhi, India


Fokkema, I.F.A.C. (HG)

unread,
Dec 11, 2025, 5:52:04 AM12/11/25
to sudhis...@gmail.com, hgvs-nom...@googlegroups.com
Dear Sudhisha,

Out of curiosity, what does c.293-13A/C>G mean? It's not a valid DNA
description.

FYI: "i2g" is not a valid protein description, but if you provide
information to the email list what you want to describe, I'm sure
you'll get some help. Reference sequences will be needed, though.

Best regards,

Ivo Fokkema
Leiden University Medical Center

Fokkema, Ivo (HG - LUMC)

unread,
Dec 12, 2025, 10:21:09 AM12/12/25
to Sudhisha Dubey, noreply-spamdigest via HGVS Nomenclature
Dear Sudhisha,

Ah, I see... For a variant to be universally recognizable, the HGVS variant nomenclature requires the use of reference sequences. As such, there cannot be two reference bases on one position. The reference sequence either indicates there is an A, or there is a C. So whether you should use c.293-13A>G or c.293-13C>G, depends on the (genomic!) reference sequence that you used for the detection of this variant. As intronic bases are not part of the transcript, NM_000500.9 can only be used for the exonic sequence.

If hg19/GRCh37 was used, the valid DNA description is NC_000006.11(NM_000500.9):c.293-13C>G. If hg38/GRCh38 was used, the valid description is NC_000006.12(NM_000500.9):c.293-13C>G.

Assuming hg38/GRCh38 was used, combined with c.955C>T, the resulting description is NC_000006.12(NM_000500.9):c.[293-13C>G;955C>T] for the combination of the two in cis.

The valid protein description is then, indicating that RNA was not analyzed as the effect of the first variant is unknown, NP_000491.4:p.[?;(Gln319Ter)], or NP_000491.4:p.[?;(Q319*)] in short.

Best regards,

Ivo Fokkema
Leiden University Medical Center



From: Sudhisha Dubey <sudhis...@gmail.com>
Sent: Thursday, December 11, 2025 18:35
To: Fokkema, Ivo (HG - LUMC) <I.F.A.C...@lumc.nl>
Subject: Re: [hgvs-nomenclature] HGVS nomenclature of mutations in cis
 
Dear  Ivo Fokkema 
Thank you for the query.
i2g, is a single nucleotide variant also known as intron splice 2 mutation of CYP21A2 gene [NM_000500.9], also written as c.293-13A/C>G [rs6467]

It is a known pathogenic mutation that is quite prevalent in patients with Congenital adrenal hyperplasia (CAH).
It is present in intron 2, 13 bases before c.293 position in exon 3. Please see below its location in the intron (in red).

At this position i.e. -13, either A or C base is present and both A and C are wild-type. Only when A and C are replaced by G, spicing error takes place. So it can be written as c.293-13A>G or  c.293-13C>G [rs6467] depending on the type of wild-type allele (A or C) present in the patient. But commonly it is written as c.293-13A/C>G when it is collectively written for more patients.
It is predicted to result in a new splice acceptor site thus affecting the function of the protein.

 This mutation has been found in cis with another mutation p.Gln319* of the CYP21A2 gene in some of our CAH patients. I wish to report this mutation in a correct way.

Since  effect of i2g mutation on the protein can not be predicted accurately, I think it should be written as p.[ (?);Gln319*].
I would appreciate your expert opinion on the correct HGVS nomenclature for these two variants that occur in cis, one splice mutation whose protein effect can not be reliably predicted and another with known protein change.

Could you please advise whether the protein-level representation p.[(?);Gln319*] is correct according to current HGVS recommendations.


Location of i2g mutation

Transcript: ENST00000418967.2 CYP21A2-002

Intron 2  

gtaagggccgggggcattttttctttcttaaaaaaatttttttttaagagatgggttctt      
gctatgctgcccaggctggtcttaaattcctagtctcaaatgatcctcccacctcagcct      
caagtgtgagccacctttggggcatccccaatccaggtccctggaagctcttgggggggc      
atatctggtggggagaaagcaggggttggggaggccgaagaaggtcaggccctcagctgc      
cttcatcagttcccaccctccagcccccacctcctcctgcag { it could be A instead of C}

Exon3

293 ACAAGCTGGTGTCTAGGAACTACCCGGACCTGTCCTTGGGAGACTACTCCCTGCTCTGGA    352

   353 AAGCCCACAAGAAGCTCACCCGCTCAGCCCTGCTGCTGGGCATCCGTGACTCCATGGAGC    412

   413 CAGTGGTGGAGCAGCTGACCCAGGAGTTCTGTGAG                             447

 

Regards
Sudhisha  
--
Dr Sudhisha Dubey
Senior Scientist
Institute of Medical Genetics and Genomics
Sir Ganga Ram Hospital
New Delhi
Reply all
Reply to author
Forward
0 new messages