RNA nomenclature of cryptic exon isertion

[Mila Sleptsova]

Dear HGVS support,

We have encountered the following deep intronic variant in the BBS7 gene:

NM_176824.3:c.1676+1171T>G

Looking at it at RNA level we see that 114 nucleotides are inserted between exon 15 and 16, including the variant itself (from c.1676+1058 to c.1676+1171). My question is regarding the correct description of this variant both at RNA and protein level, more specifically considering the 3' rule, as the first nucleotide from exon 16 is the same as the first nucleotide from the inserted sequence (I have included the sequences below in case that helps).

As we suppose the intronic sequence is inserted right after exon 15, rather than after the first nucleotide of exon 16 we thought the following might be appropriate: r.(1676_1677ins[1676+1058_1676+1171]) p.(Lys560GlnfsTer14). However, that does not take into account that the snv (c.1676+1171T>G) is also included in the insertion.

Thank you very much for your help!

Mila

ACCCATGAATACACTGACCCTAACAGGCCAGTTCAGTTTTGCTGAAGTTCACTCCTGGGTGGTTTTTTGTCTGCCTGAAGTTCCAGAAAAACCTCCAGCAGGAGAATGTGTGACATTTTACTTTCAGAACACCTTTCTAGATACACAACTTGAAAGTACCTACAG exon 15

AAAAGGAGAGGGAGTTTTTAAATCTGACAACATTTCTACTATCTCCATCCTAAAAGATGTGCTTTCTAAAGAAGCTACAAAAAGGAAAATTAACCTCAACATATCATACG exon 16

acagggtttcaccatgttggtcaagctggtctcaaactcctgagctcaagcaatcctcctgcgttggcctcctaaagtgctgggattataggcgtgagccaccacacctggccg c.1676+1058_1676+1171 (inserted sequence with c.1676+1171T>G)

[Johan den Dunnen]

Dear Mila,

following HGVS nomenclature recommendation, the correct description of the variant is NC_000004.12:g.121832060A>C NM_176824.3:c.1676+1171T>G r.1676_1677ins[c.1676+1058_1676+1170;G]

NC_000004.12:g.121832060A>C is used to follow the recommendation to describe all variants reported on genomic level. In addition, NC_000004.12 is required to define the intron sequences which are not in reference sequence NM_176824.3. Since you indicate the consequences at the RNA level has been analysed, the varaint can be described as r.1676_1677ins[c.1676+1058_1676+1170;G]  (i.e. without "( )"  for predicted consequences). Note this description includes the T>G change at the last nucleotide of the inserted sequence.

Best regards,

Johan den Dunnen
HUGO HGVS Variant Nomenclature Committee (HVNC)

Op dinsdag 7 oktober 2025 om 11:57:17 UTC+2 schreef Mila Sleptsova:

[Mila Sleptsova]

Dear Johan,

Thank you very much for your help! 

Additionally - do you consider that the description p.(Lys560GlnfsTer14) would be correct, where this is a predicted effect at protein level, we have not performed any analysis to prove this?

Best regards,

Mila

[Johan den Dunnen]

Dear Mila,

the predicted consequences of the variant can indeed be described as p.(Lys560GlnfsTer14). Note however that according to a recent issue that has been raised (see https://github.com/HGVSnomenclature/hgvs-nomenclature/discussions/240), an alternative description is to describe it as an insertion, i.e. p.(Arg559_Lys560insQGFTMLVKLVSNS*). It seems current HGVS nomenclature recommendations are not absolutely clear about this.

Best regards,

Johan den Dunnen
HUGO HGVS Variant Nomenclature Committee (HVNC)

Op dinsdag 7 oktober 2025 om 14:18:21 UTC+2 schreef Mila Sleptsova:

[Mila Sleptsova]

Dear Johan,

Thank you very much for your help! Your comments are higly appreciated!

Best regards,

Mila