HGVS Nomenclature

Dear HGVS Team, I'm looking for clarification regarding closely spaced variants in the following

Dear Irina, you are right, the predicted consequence of the variant you give (NC_000008.11:g.

Dear Johan, Thank you very much for your help! Your comments are higly appreciated! Best regards,

Dear Shalini, as Reece indicated, HGVS nomenclature covers the standardized description of variants,

Dear Aneta, when I check I get to the following descriptions: NC_000006.12:g.156927983_qterdelins[

Dear Ivo Fokkema, Thank you for your email. We will check with editorial and make necessary

Dear Ivo, Here is the GitHub discussion I just started: https://github.com/HGVSnomenclature/hgvs-

Dear Valentine, a variant description following HGVS nomenclature has a format like: NC_000023.11:g.

Dear Ivo, you are right, I missed that two different reference sequences were used. Since the

Dear Laura, regarding your question, it seems the format you use to describe the variant is that of

Dear Rachel, indeed, following HGVS nomenclature the variant can be described as NM_000527.5:c.[

Dear Debbie, regarding your questions; > KMT2A PTD (exon 2-10) > c.(?_5' [first] nucleotide

Dear Asier, an interesting case. I do not think this case, ie multiple exact copies of an inserted

Dear Johan, I hope this message finds you well. I would like to follow up on the question I raised in

Dear José Maria, a correct description of the variant you mention is NC_000016.10:g.

Dear Motahahreh, Your first email had been answered on the Google Group. I see you didn't get a

Dear Scott, Sorry for the late reply, we overlooked your email. Indeed, "Xaa" is preferred.

Dear Maida, indeed, proposal SVD-WG010 has been rejected which means that the recommendations stay

Dear Aneta, following current HGVS nomenclature the variant you give CCGGTCCTCCCCCCAGGCGCCCCGAAG to

Dear hafizaasi19, You can check whether variant descriptions follow HGVS nomenclature using freely

Dear Raina, please note, you do not mention the reference sequence used. I guess it may be NM_000088.

Dear Scott, thanks for the info. However, as said, HGVS nomenclature does not use the term "stop

Dear Claudio, regarding your question, "About deletion Exon30-36 of DMD gene, is correct the

Dear Aftab, I am not sure what you mean with "please send me HGVS nomenclature".

Excellent. Thanks for confirming, Krysta. -Reece On Monday, March 24, 2025 at 4:00:00 AM UTC-7

Dear James, the HGVS nomenclature Home page has a link ("Join the HGVS Nomenclature

Dear Aneta, regarding your question reporting the variant as NC_000015.10:g.37228213_37357632delins[

Dear Steven, at the moment I am writing this reply, I could not access the NG_009378.1 reference

Dear Claudia, yes, following current recommendations, you should also indicate you detected 4 copies.

Dear Ligia, a difficult case which shows the limitations of HGVS nomenclature, ie for complex