Paramignya Trimera
Consuelo Dular
The site is secure.
The ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.
Background: Cancer is one of the leading causes of death in the world. A great deal of effort has been made to discover new agents for cancer treatment. Xao tam phan (Paramignya trimera) is a traditional medicine of Vietnam used in cancer treatment for a long time, yet there is not much scientific evidence proving its anticancer potency. The study aimed to evaluate the toxicity of Paramignya trimera extract (PTE) on multicellular tumor spheres (MCTS) of MCF-7 cells using hanging drop technique.
Methods: Firstly, MCF-7 cells were seeded on hanging drop plates, spheroid size was tracked, and growth curve was measured by MTT assay and AlamarBlue assay. The necrotic core of MCTS was evaluated by propidium iodide (PI) staining. Toxicity of doxorubicin (DOX) and tirapazamine (TPZ) was then tested on 3D model compared to 2D culture condition.
Results: The results showed that the IC50 of DOX on 3D MCF-7 cells was nearly 50 times greater than monolayer MCF-7 cells. In contrast, TPZ (an agent which is specifically toxic under hypoxic conditions) had significantly lower IC50 in 3D condition than in 2D. The toxicity tests for PTE showed that PTE strongly inhibited MCF-7 cells in both 2D and 3D conditions. Interestingly, the IC50 of PTE in 3D model was remarkably lower than in 2D (IC50 value was 168.9 11.65 μg/ml compared to 260.8 16.54 μg/ml, respectively). The invasion assay showed that PTE completely inhibited invasion of MCF-7 cells at 250 μg/mL concentration. Also, flow cytometry results indicated that PTE effectively induced apoptosis in MCF-7 spheroids in 3D condition at 250 μg/mL concentration.
Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.
Until now, reports on the genus Paramignya have predominantly focused on the investigation and the characterization of the physicochemical and the biopharmaceutical properties of the extracts4,20,21,22,23. A broad range of the value secondary compounds such as coumarin, tirucallane, acridone alkaloids, phenols, flavonoids, limonoid, sterols and derived glycosides was characterized as valuable resources for natural novel drug developments4,20,21,22,23,24,25,26,27,28,29,30. In recent years, the physicochemical properties, antioxidant, anti-proliferative and anti-inflammatory capacities of the leaf, stem, and root extracts of P. trimera were reported24,25,26,27. An abundant source of the natural compounds such as phenols, saponins, flavonoids, proanthocyanidins, and antioxidant agents was found in P. trimera20,28,29. The in vitro anticancer activity of the extracts of P. trimera against human pancreas and breast cancer cell lines MCF-7 via apoptosis induction was also investigated25,30. Although the phytochemical and biopharmaceutical properties of P. trimera were characterized, the morphology and the phylogenetic relationship of P. trimera with relatives were clearly undescribed. The high genetic diversity of the natural populations of P. trimera and the existence of the numerous local names make it difficult to identify and distinguish P. trimera from its relatives. Therefore, a well systematic analysis to identify and distinguish P. trimera from relatives in the family Rutaceae is necessary for the protection and the conservation of this plant.
In the present study, the morphological and DNA sequence data of the accessions of P. trimera and relatives distributing in Khanh Hoa and Lam Dong provinces were used to clarify the phylogenetic relation among these species. In particular, the morphological similarity between accessions of P. trimera and A. buxifolia was investigated to support for the hypothesis about the intergeneric hybrids of P. trimera with relatives. Additionally, the intraspecific and interspecific distances between accessions were also analyzed based on ITS, matK and rbcL sequences to discover a candidate DNA barcode for the identification and the discrimination of P. trimera from other species in the genus and in the related genera.
The morphological variation of leaves among accessions of P. trimera (Oliv.) Burkill. Leaves of P. trimera showing oblong, elongate, obovate, ovate, oval, elip, roundish forms with rounded or obtuse apexes. Different forms of leaves were sometimes found in a single individual plant.
Based on the obtained results we suggested the use of DNA barcodes was helpful to identify and distinguish of Paramignya species. In addition, the combination with other data there would allow to minimize the probability of misidentification. Therefore, the further systematic study and species identification of Paramignya are still needed to provide reference data for the screening of DNA barcode and the species discrimination that could provide theory basis for the identification and conservation of valuable medicinal plants.
It was the first time the morphology and the phylogenetic relation of P. trimera and some relatives of the family Rutaceae collected from Khanh Hoa and Lam Dong provinces of Vietnam were analyzed. A combination of morphological data, BOLD platforms and DNA barcode sequences was efficiently support for the identification and the discrimination of P. trimera from its relatives. In addition, the presence of the intermediate forms of P. trimera was likely the interspecific hybrid lines as the results of the outcross between P. trimera with closely related species, notably A. buxifolia. It also suggested that the wide sexual compatibility could lead to the difficulty in taxonomic identification of P. trimera and Paramignya species. The study supported for the accurate identification for exploitation and of P. trimera in Vietnam as a valuable indigenous source of medicinal plant.
Similar PCR conditions were applied for the amplification of matK and rbcL sequences. The matK sequences of all accessions were amplified by using the universal primers matK-390F TAATTTACRATCAATTCATTCAATATTTCC and matK-1326R GARGAYCCRCTRTRATAATGAGAAAGATTT according to Kyndt, T. et al. 2005 with 52 C annealing temperature36. The rbcL sequences of all accessions were amplified by using the universal primers rbcL-F ATGTCACCACAAACAGAGACTAA and rbcL-R TTCGGCACAAAATACGAAACGATCTCTC with 56 C annealing temperature37.
The nucleotide divergence was estimated based on the multiple sequence alignment of ITS, matK, rbcL and the concatenated sequences by MEGA X (Ver.10.1.7) using the Kimura-2-parameter (K2P) model38. A uniform distribution was set as rate variation among sites. The Maximum likelihood (ML) trees were generated for each DNA sequence separately and combined as concatenated sequences by using MEGA X software with 1000 bootstrap replications39,40. The tree with the highest log likelihood is shown and the percentage of trees in which the associated taxa clustered together is shown next to the branches. Due to the significant small value of the branch lengths that may affect the display of trees, all trees in this study were plotted as cladograms. The cut-off value for condensed trees were set at 50% to better represent hypothetical phylogenetic systematics relationship among accessions. Gaps and missing data treatment were selected as partial deletion with 95% site coverage cutoff (including alignment gaps, missing data, and ambiguous bases were allowed at any position).
The overall genetic distances estimated for the ITS, matK, rbcL and concatenated sequences were estimated by MEGA X software. To determine the barcoding gap between pairwise genetic distances among and within species, the intraspecific and interspecific distance were calculated by ExcaliBAR program based on the original distance matrices computed by MEGA-X software. The barcoding gap was calculated by the difference between the maximum intraspecific distance and the minimum interspecific distance33,41. The automatic barcode gap discovery (ABGD) ( ) was used to generate distance histograms and distance ranks with two X values of relative gap width (1.0 and 1.5) and distance metric (K2P)42. Default values were employed for all other parameters, P (prior intraspecific divergence) ranged from 0.001 to 0.1 while Steps was set to 10, and Nb bins (for distance distribution) was set to 2042.
The map of sampling sites was created by ArcGIS 10.3 using the color rendering and grouping tools built-in. The collection sites and names were placed on the map based on actual coordinates by using Paintbrush version 2.5 (20190914) on mac OS Catalina.
The authors declare that they have contributed equally for this work and no conflict of interest. Dr. T.C.M.P. collected plant specimens, prepared taxonomic treatment and conducted experiments. Dr. H.H.C. provided laboratory facility and revised the manuscript. Dr. L.N.T. did the field survey and provided data for map drawing. Dr. B.D.N. analyzed the data, wrote the main manuscript text and revised the manuscript. All authors reviewed the manuscript.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit
c80f0f1006