gnumaps bs error

[Jessie Li]

Hi,

I am running gnumaps on bisulfite treated reads, pair-end, with a draft genome that is still at contig stage.

There are two questions I would like to ask.
1. Does the analysis on bisulfite treated reads require gnumap-stl? Because it generates the error
    "/software/gnumaps/0.1/x86_64-linux-ubuntu14.04//dep/gnumap_MPI_opt/bin/gnumap-stl: No such file or directory",
    even if I require one thread by --num_threads 1. Should I compile the MPI version of the program?
2. There is error like following.
Argument "contig::ALPR02003025.1:1:475937:1/dn/2.sam" isn't numeric in addition (+) at /software/gnumaps/0.1/x86_64-linux-ubuntu14.04//scripts/merge_2sam_v4.pl line 50.
Argument "/nfs/data/export/projects/Chiu_J_UCD/151001_A_Stephensi_..." isn't numeric in addition (+) at /software/gnumaps/0.1/x86_64-linux-ubuntu14.04//scripts/merge_2sam_v4.pl line 51.
Argument "dna:contig" isn't numeric in addition (+) at /software/gnumaps/0.1/x86_64-linux-ubuntu14.04//scripts/merge_2sam_v4.pl line 52.
Argument "dna:contig" isn't numeric in addition (+) at /software/gnumaps/0.1/x86_64-linux-ubuntu14.04//scripts/merge_2sam_v4.pl line 70.
specify read type, dna or rna?
Argument "contig::ALPR02003025.1:1:475937:1/up/2.sam" isn't numeric in addition (+) at /software/gnumaps/0.1/x86_64-linux-ubuntu14.04//scripts/merge_2sam_v4.pl line 50.
Argument "/nfs/data/export/projects/Chiu_J_UCD/151001_A_Stephensi_..." isn't numeric in addition (+) at /software/gnumaps/0.1/x86_64-linux-ubuntu14.04//scripts/merge_2sam_v4.pl line 51.
Argument "dna:contig" isn't numeric in addition (+) at /software/gnumaps/0.1/x86_64-linux-ubuntu14.04//scripts/merge_2sam_v4.pl line 52.
Argument "dna:contig" isn't numeric in addition (+) at /software/gnumaps/0.1/x86_64-linux-ubuntu14.04//scripts/merge_2sam_v4.pl line 70.

     But I cannot find the file contig::ALPR02003025.1:1:475937:1/dn/2.sam, or contig::ALPR02003025.1:1:475937:1/up/2.sam. I only find contig::ALPR02003025.1:1:475937:1/pe/.

The command I have used is:
     gnumaps.pl --genome ../References/reference.fasta --pair_1 ./R1_1.txt --pair_2 ./R2_2.txt --phred_offset 33 --read_type dna --nt_conv bs --num_threads 1 --pileup 1 --outdir ./results

Thank you very much for your help in advance!

Best,
Jessie

[Changjin Hong]

Hi, Jessie

Can you send me your first 8 lines of R1_1.txt and R2_2.txt to me? I can help you on this issue. Sorry for the inconvenience.

-CJ

--

---
You received this message because you are subscribed to the Google Groups "gnumap-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to gnumap-users...@googlegroups.com.
For more options, visit https://groups.google.com/d/optout.

[Jessie Li]

Hi, CJ,

I wasn't sure what format _1.txt and _2.txt should be, so I just used the fastq files. Here are the first 8 lines of R1_1.txt and R2_2.txt.

R1_1.txt:
@UNK:1:FCC76F5ACXX:6:2210:16047:11852#0/1
TGGTTTTTAAGCGAAAGGTTAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTGAAAAAAA
+
@CCDFFFFHHHHHGHIIIFHIIIJIIIIHJGHHHIGHHBHIIIJJIGHIIIJJJDEDHGEH?=ECDDDEEDEB?BABDDDDDDDDDCDDBB
@UNK:1:FCC76F5ACXX:6:2312:19040:74169#0/1
GGTGTTTTATGATATGATGTAGTGCGAAACGGTAGATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTGAAA
+
@@@DFFFFHDHHHCHICHIGHG:FHEHIIJII?FHIJJGI?GHIIIIJJJJIJJGGIGIJHGHEEFFFFDFEC@@>;CBDBDCDDDBDDDDDDDDDCBC:


R2_2.txt:
@UNK:1:FCC76F5ACXX:6:2210:16047:11852#0/2
AACCTTTCGCTTAAAAACCAAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAA
+
@@@DBDBDHHHHGIJEHIJIGHGGIJIGGI?G@D?FF7B.=CFD8.6@=C=??EHFHFFFFFC=B;CDDDD=BDBCDD@CCCCB
@UNK:1:FCC76F5ACXX:6:2312:19040:74169#0/2
ACCGTTTCGCACTACATCATATCATAAAACACCAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTAAAAAACAA
+
@@@FFFFFDHDHHIIBHIIIIIIGIIII<FGIIIIIIIIIIIIHFFGFHHGHEEHHEA@DD?C;@@CEECADDDDBDD=CB@?B><BBDEE:@ACAB###


Thank you so much for your help! It would be helpful if you could provide details on the format of the input sequence read files.

Thanks,
Jessie

[cj]

The issue is resolved. The revised gnumaps package is available at jlab.bu.edu.