error while running the gnumap-bs on paired end reads

[saaura...@gmail.com]

HI

I downloaded the latest version of the tool and got some error. I will be glad if you help me figure out the errors.

command used

 /usr/bin/time -f "%M %U" perl `pwd`/tools/gnumaps/scripts/gnumaps.pl --genome `pwd`/ref/allchr.fa --pair_1 `pwd`/simulated_data/sim_end1.fastq --pair_2 `pwd`/simulated_data/sim_end2.fastq --adaptor AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG --adaptor2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT --read_type dna --phred_offset 64 --nt_conv bs --skip_blat 1 --debug 1 --pileup 1 -outdir `pwd`/runs/simulated_data/gnumap/


===========================================
GNUMAP_PIPELINE(v0.1)
-http://jlab.bu.edu
-cjh...@bu.edu
-running at /data2/bsi/staff_analysis/m078940/TRACE-RRBS/tools/gnumaps
Tue Jan  7 14:30:20 CST 2014
-elapsed time: 0.0
===========================================
In progress ...
sh: line 2: /data2/bsi/staff_analysis/m078940/TRACE-RRBS/tools/gnumaps/dep/gnumap_MPI_opt/bin/gnumap-stl: No such file or directory
sh: line 2: /data2/bsi/staff_analysis/m078940/TRACE-RRBS/tools/gnumaps/dep/gnumap_MPI_opt/bin/gnumap-stl: No such file or directory
Can't exec "/data2/bsi/staff_analysis/m078940/TRACE-RRBS/tools/gnumaps/dep/blat/faToTwoBit": No such file or directory at /data2/bsi/staff_analysis/m078940/TRACE-RRBS/tools/gnumaps/scripts/gnumaps.pl line 434.
sh: line 2: /data2/bsi/staff_analysis/m078940/TRACE-RRBS/tools/gnumaps/dep/gnumap_MPI_opt/bin/gnumap-stl: No such file or directory
sh: line 2: /data2/bsi/staff_analysis/m078940/TRACE-RRBS/tools/gnumaps/dep/gnumap_MPI_opt/bin/gnumap-stl: No such file or directory
sh: line 2: /data2/bsi/staff_analysis/m078940/TRACE-RRBS/tools/gnumaps/dep/gnumap_MPI_opt/bin/gnumap-stl: No such file or directory
sh: line 2: /data2/bsi/staff_analysis/m078940/TRACE-RRBS/tools/gnumaps/dep/gnumap_MPI_opt/bin/gnumap-stl: No such file or directory



it is looking for gnumap-stl command which is not available, is there something wrong with my installation.


Thanks

Saurabh

[bped...@gmail.com]

I see a similar error running version 3.0.2 with command:

    gnumaps.pl --genome /mm10/ref/mm10.fa --lib_type wt1 --nt_conv bs --outdir results/ --pair_1 5308.r1.tmp.fastq --pair_2 5308.r2.tmp.fastq 

the exact output is pasted below. And there are no sam files in any subdirectory of results. Any ideas?

===========================================

GNUMAP_PIPELINE(v0.1)

-http://jlab.bu.edu

-cjh...@bu.edu

-running at /home/brentp/src/gnumap/gnumaps

Tue Feb 11 13:01:13 MST 2014

-elapsed time: 0.0

===========================================

In progress ...

sh: line 2: /home/brentp/src/gnumap/gnumaps/dep/gnumap_MPI_opt/bin/gnumap-stl: No such file or directory

sh: line 2: /home/brentp/src/gnumap/gnumaps/dep/gnumap_MPI_opt/bin/gnumap-stl: No such file or directory

sh: line 2: /home/brentp/src/gnumap/gnumaps/dep/gnumap_MPI_opt/bin/gnumap-stl: No such file or directory

sh: line 2: /home/brentp/src/gnumap/gnumaps/dep/gnumap_MPI_opt/bin/gnumap-stl: No such file or directory

sh: line 2: /home/brentp/src/gnumap/gnumaps/dep/gnumap_MPI_opt/bin/gnumap-stl: No such file or directory

sh: line 2: /home/brentp/src/gnumap/gnumaps/dep/gnumap_MPI_opt/bin/gnumap-stl: No such file or directory

demuxing sam...

done

forming PE mappings...

done.

muxing all chr-level mappings...

cat: /home/brentp/src/bwa-meth/compare/results/gnumapbs-sim/5308.r1.tmp/aligned/gnu/gen/*/*/pe/*/pe.sam: No such file or directory

done

Use of uninitialized value in rename at /home/brentp/src/gnumap/gnumaps/scripts/gnumaps.pl line 278.

[changjin]

Hi, Sorry for my late response!

Check out the latest version (Keeping updated...)

It seems that gnumap binary was not compiled successfully. Please, check the installation requirement from README file.

Make sure that $GNUMAPS/dep/gnumap_MPI_opt/bin/gnumap-stl exists before you use this package.

If it doesn't work, post your setup log file.

-CJ

[bped...@gmail.com]

So the MPI version is required to use the gnumaps.pl script? I get no error on running: ./install_gnumaps.sh qc blat > inst.log

but there is no gnumap-stl. I also get no error with ./install_gnumaps.sh mpi and still no gnumap-stl.

thanks,

-Brent