Hello,
I am doing some small hacks to integrate lucene with Genoogle,
the main idea is to use the description, ref number and other sequences information together with the sequence to be searched, something like it:
"+COW -DOG CATCGATCTGATGCATGCATGCTGCACGATCGCAT"
Some suggestion?
I am in doubt if it is useful or just a funny feature.
Felipe Albrecht