Dear ETE3 group,
I’m trying to build a phylogenetic tree using a standard_phyml command. I have to root/outgroup the tree on a sequence present in a fasta file which is called ‘germline’.
Example fasta:
>CL4197840
CAGGTCCAACTGCAGCAGTCTGGGGCTGAGCTTGTGAAGCCTGGGACTTCAGTGAAGATGTCCTGCAAGTCTTCTGGCTACACCTT
>germline
CAGGTCCAACTGCAGCAGCCTGGGGCTGAGCTTGTGAAGCCTGGGGCTTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTT
I’m using the command below:
ete3 build -w standard_phyml -n cluster1.fasta --first-split-outgroup germline -o cluster1_PHYML
But always getting an error: “TaskError: Unknown seqs cannot be used to set first split rooting:”
I also tried to insert the germline nucleotide sequence directly into the command line after
--first-split-outgroup, but it gave me the same error and I could not find any solution online.
Would be really grateful for your help!! Thanks!
Best regards,
Margarita