Dosage imputation to VCF conversion

507 views
Skip to first unread message

Karsten Sieber

unread,
Dec 16, 2016, 3:25:43 PM12/16/16
to EPACTS
Does anybody have a tool (or suggestions) how to convert minimac/minimac2 .dose and .info files into .vcf? I am trying to use EPACTS for a study contributing to a consortium and their suggested tool (dose2vcf, http://www.sph.umich.edu/csg/cfuchsb/dose2vcf_v0.5.gz) is not available. 

Thanks for any suggestions and help,
Karsten

Gregory Zajac

unread,
Dec 18, 2016, 12:56:20 PM12/18/16
to EPACTS
This tool can convert dosages and vcfs: https://github.com/Santy-8128/DosageConvertor

Karsten Sieber

unread,
Dec 18, 2016, 2:40:52 PM12/18/16
to epa...@googlegroups.com
​Thanks for the response Gregory. My understanding is that the DosageConverter tool converts vcf (with dosage info) into .dose & .info files. I need to convert the dosage files (.dose & .info) -> .vcf format. 

--
You received this message because you are subscribed to a topic in the Google Groups "EPACTS" group.
To unsubscribe from this topic, visit https://groups.google.com/d/topic/epacts/lxJ5zMQUYzc/unsubscribe.
To unsubscribe from this group and all its topics, send an email to epacts+unsubscribe@googlegroups.com.
To post to this group, send email to epa...@googlegroups.com.
To view this discussion on the web visit https://groups.google.com/d/msgid/epacts/8399f296-ff5a-404c-85e7-492645b6d7f2%40googlegroups.com.
For more options, visit https://groups.google.com/d/optout.

Gregory Zajac

unread,
Dec 18, 2016, 3:24:22 PM12/18/16
to EPACTS
Are you able to rerun your imputation in minimac3? That would be much faster than minimac2 and does output vcf files by default. If you don't want to run it on your own machine you can use our imputation server. https://imputationserver.sph.umich.edu/index.html

Yun Li http://www.unc.edu/~yunmli/software.html#utilities might also have a tool that converts the dosage files. I do see one on her web page that converts dose2geno, which should be able to be converted to VCF.

You can also contact Chrisitan Fuchsberger if he still has his dose2vcf tool on the web somewhere since that particular link is broken.


On Sunday, December 18, 2016 at 2:40:52 PM UTC-5, Karsten Sieber wrote:
​Thanks for the response Gregory. My understanding is that the DosageConverter tool converts vcf (with dosage info) into .dose & .info files. I need to convert the dosage files (.dose & .info) -> .vcf format. 
On Sun, Dec 18, 2016 at 12:56 PM, Gregory Zajac <gza...@umich.edu> wrote:
This tool can convert dosages and vcfs: https://github.com/Santy-8128/DosageConvertor

On Friday, December 16, 2016 at 3:25:43 PM UTC-5, Karsten Sieber wrote:
Does anybody have a tool (or suggestions) how to convert minimac/minimac2 .dose and .info files into .vcf? I am trying to use EPACTS for a study contributing to a consortium and their suggested tool (dose2vcf, http://www.sph.umich.edu/csg/cfuchsb/dose2vcf_v0.5.gz) is not available. 

Thanks for any suggestions and help,
Karsten

--
You received this message because you are subscribed to a topic in the Google Groups "EPACTS" group.
To unsubscribe from this topic, visit https://groups.google.com/d/topic/epacts/lxJ5zMQUYzc/unsubscribe.
To unsubscribe from this group and all its topics, send an email to epacts+un...@googlegroups.com.

Jongyun Jung

unread,
Jul 17, 2019, 3:10:02 PM7/17/19
to EPACTS
Hi,

I kind of having a same issue with converting dosage files (.dose & .info) to .vcf format. 

Anybody found the solution for this one?

Thank you.

maomao

unread,
Apr 8, 2020, 2:49:54 PM4/8/20
to EPACTS
Hi Jongyun,

Did you figure out how to converting dosage file (.dose&.info) to .vcf format?

Thanks

Jongyun Jung

unread,
Apr 8, 2020, 5:52:02 PM4/8/20
to EPACTS
Hi Maomao,

Yes, I figured out the way of converting dosage file to vcf format.

I used the program of dose2vcf (link is below).

maomao

unread,
Apr 10, 2020, 3:28:57 PM4/10/20
to EPACTS
Hi Jongyun,

I install EPACTS-3.2.6 and put the dose2vcf_v0.5.gz file under the same path. And then when I was using dose2vcf/dose2vcf --dose [dose.file] --info [info.file] --out  

I was told that can not find command dose2vcf/dose2vcf.  Any suggestion?
I notice that dose2vcf_v0.5.gz file is with unrecognize symbols.

Not sure how to use it.

Thanks,
MAOMAO 

Jongyun Jung

unread,
Apr 10, 2020, 6:12:18 PM4/10/20
to EPACTS
Hi Maomao,

I don't think you need to install EPACTS-3.2.6 to extract vcf format from dosage. 

Once you download the dose2vcf_v0.5 and extract it, then you have dose2vcf program. 

To run this program, you can just move this dose2vcf file where you want to run from dosage files. 

So, if you move your dose2vcf file to the directory of dosage file, then you can run something like this:

dose2vcf --dose [ .dose file ]  --info [ .info file ] --out [ output file prefix ]

You don't need to specify the folder name as dose2vcf/dose2vcf before the program.

Let me know if you have further question. 

maomao

unread,
Apr 11, 2020, 10:48:06 PM4/11/20
to EPACTS

Hi Jongyun,

Thanks for your details, but it still not working for me. I attached my code and the error output I ran (attached name is dose2vcf), would you mind helping me check which step is wrong? The dose2vcf_v0.5 is a .gz file, when I decompressed it, it only a file. It different from other program. (I also attached it as dose2vcf_v0.5)

Any suggestion would be appreciated..

Maomao
dose2vcf_v0.5.gz
dose2vcf.txt

Jongyun Jung

unread,
Apr 13, 2020, 3:10:17 AM4/13/20
to EPACTS
Hi Maomao,

When you do ls in your command after decompress, can you see dose2vcf file?

If you can see, I think you should run with ./dose2vcf with parameter. 

Or you can try with ./dose2vcf_v0.5 

maomao

unread,
Apr 13, 2020, 12:55:29 PM4/13/20
to EPACTS
Hi Yongyun,

The program starts running, however it aborted. Give the error below. Do you have ideal what's wrong with that?

$ ./dose2vcf_v0.5 --dose AFR.ATCG_chr13.phased_imputation.dose.gz --info AFR_combined_imputed.info.gz --out out/fusion.gwas.1kg.imp.chr13

dose2vcf 0.5
(c) 2012 Christian Fuchsberger


WARNING - 
Problems encountered parsing command line:

Command line parameter --out is undefined
Command line parameter out/fusion.gwas.1kg.imp.chr13 (#6) ignored


The following parameters are available.  Ones with "[]" are in effect:

Available Options
   Minimac input options : --dose [AFR.ATCG_chr13.phased_imputation.dose.gz],
                           --info [AFR_combined_imputed.info.gz]
   Impute2 input options : --impute_dose [], --impute_sample [], --chr []
        RS mapping table : --rs []
          Output Options : --prefix [dose2vcf]

Minimac mode
Load Dosages...
   52
 Output VCF...Header...Data...dose2vcf_v0.5: ../libStatGen/include/MathVector.h:113: double& Vector::operator[](int): 

Assertion `n < dim' failed.
Aborted


Maomao

maomao

unread,
Apr 14, 2020, 12:29:47 PM4/14/20
to EPACTS
Hi Jongyun,

I posted partial my imputed.dose.gz file and imputed.info.gz file here. Would you help me take a look whether they both look good? For the info.gz, the ref. Allele and alternative alleles has some 1+ alleles.

imputed.dose.gz

1014_ID0000115BD0 DOSE 0.050 0.012 0.008 0.000 0.009 0.000 0.246 0.000 0.003 0.001 0.001 0.003 0.008 0.000 0.317 0.009 0.035 0.002 0.011 0.009 0.000 0.009 0.000 0.017 0.010 0.000 0.0010.000 0.000 0.003 0.000 0.000 0.003 0.004 0.008 0.007 0.001 0.000 0.002 0.007 0.007 0.014 0.000 0.634 0.003 0.000 0.005 0.003 0.000 0.000 0.000 0.000 0.328 0.000 0.189 0.000 0.037 0.0000

imputed.info.gz
SNP Al1 Al2 Freq1 MAF nIndiv r2_hat1:10177 A AC 0.446 0.446 52 0.0431:10235 T TA 0.001 0.001 52 0.0001:10352 T TA 0.419 0.419 52 0.0261:10539 C A 0.001 0.001 52 0.0001:10616 CCGCCGTTGCAAAGGCGCGCCG C 0.994 0.006 52 0.0021:10642 G A 0.003 0.003 52 0.000

Jongyun Jung

unread,
Apr 15, 2020, 12:29:50 AM4/15/20
to EPACTS
Hi Maomao,

It seems that when you are running the dose2vcf program, it looks like running correctly.

I think the error is that when you give a command like above,

./dose2vcf_v0.5 --dose AFR.ATCG_chr13.phased_imputation.dose.gz --info AFR_combined_imputed.info.gz --out out/fusion.gwas.1kg.imp.chr13

Where do you want to locate your output? I think the error is with out/fusion.gwas.1kg.imp.chr13

The program cannot recognize out/fusion.gwas.1kg.imp.chr13. You need to specify the location like this ./out/fusion.gwas.1kg.imp.chr13 or full directory of your output.

maomao

unread,
Apr 17, 2020, 3:42:01 PM4/17/20
to EPACTS
Thanks for all your help Jongyun.

It still not working. I guess it is due to my own data.
Reply all
Reply to author
Forward
0 new messages