possible bug in TagCleaner

[Kevin Chen]

Hi there,

Thanks for the nice software of TagCleaner and Prinseq.

Here is a possible bug with the "-line_width 0" in TagCleaner

When I use command "tagcleaner -fasta S2.trimBC.fasta -out S2_tagclean_run1 -log -tag5 ACTCCTACGGGAGGCAGCAG -line_width 0"

the log shows
[tagcleaner-standalone-0.13] [08/02/2013 11:33:22] Executing TagCleaner with command: "perl tagcleaner.pl -out S2_tagclean_run1 -fasta S2.trimBC.fasta -tag5 ACTCCTACGGGAGGCAGCAG -log -line_width 1"
[tagcleaner-standalone-0.13] [08/02/2013 11:33:22] Write results to file: "S2_tagclean_run1.fasta"
[tagcleaner-standalone-0.13] [08/02/2013 11:33:22] Parse and process input data: "S2.trimBC.fasta"
[tagcleaner-standalone-0.13] [08/02/2013 11:34:05] Finished processing input data: "S2.trimBC.fasta"

and my output fasta has line_width of 1 instead of 0

Thanks!

[Robert Schmieder]

Thanks Kevin for the bug report!

I released version 0.14 that fixes the issue with the line width parameter.