Warnings while using Tagcleaner

3 views
Skip to first unread message

stefanie....@gmail.com

unread,
Jun 11, 2013, 5:13:02 AM6/11/13
to Edwards...@googlegroups.com
Hello,
I am testing Tagcleaner to remove an adaptor sequence from my RNA-seq files.

While using it, it gives me lots of warnings :

$ perl /Volumes/BioSan/opt/tagcleaner-0.12/tagcleaner.pl -verbose -64 -fastq ADE06-end1.fq -out_format 3 -out trimtest -log -nomatch 4 -tag5 GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTAT -tag3 GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTAT -mm5 2 -cont
Estimate size of input data for status report (this might take a while for large files)
done
Parse and process input data
status: 0 %Use of uninitialized value in integer eq (==) at /Volumes/BioSan/opt/tagcleaner-0.12/tagcleaner.pl line 2001, <FILE> line 53665.
Use of uninitialized value in integer addition (+) at /Volumes/BioSan/opt/tagcleaner-0.12/tagcleaner.pl line 2001, <FILE> line 53665.
Use of uninitialized value in integer addition (+) at /Volumes/BioSan/opt/tagcleaner-0.12/tagcleaner.pl line 2001, <FILE> line 53665.
Use of uninitialized value in substr at /Volumes/BioSan/opt/tagcleaner-0.12/tagcleaner.pl line 2033, <FILE> line 53665.
Use of uninitialized value in substr at /Volumes/BioSan/opt/tagcleaner-0.12/tagcleaner.pl line 2033, <FILE> line 53665.
Use of uninitialized value in substr at /Volumes/BioSan/opt/tagcleaner-0.12/tagcleaner.pl line 2034, <FILE> line 53665.
Use of uninitialized value in substr at /Volumes/BioSan/opt/tagcleaner-0.12/tagcleaner.pl line 2034, <FILE> line 53665.
Use of uninitialized value in integer eq (==) at /Volumes/BioSan/opt/tagcleaner-0.12/tagcleaner.pl line 2001, <FILE> line 93873.
Use of uninitialized value in integer addition (+) at /Volumes/BioSan/opt/tagcleaner-0.12/tagcleaner.pl line 2001, <FILE> line 93873.

And so on ...

Is there an error in my input file ? What are the consequences of these warnings on the trimming process ?

Thanks

Regards

S. Graindorge

Robert Schmieder

unread,
Jun 12, 2013, 3:53:52 PM6/12/13
to Edwards...@googlegroups.com
Thanks for the issue report. Seeing warnings like this is usually not a good sign. Would you be able to provide a test dataset for me to reproduce the error (you can attach files to the post)?

sed -n '
53661,53668p; 53669q' ADE06-end1.fq > test.fq

Please check if the test.fq dataset produces the same warnings (and if I calculated the start and stop lines correctly to get two sequence entries).

Thanks,
Rob

stefanie....@gmail.com

unread,
Jun 13, 2013, 5:11:46 AM6/13/13
to Edwards...@googlegroups.com
Hi,

I checked the test file and I have the same warnings :

perl /Volumes/BioSan/opt/tagcleaner-0.12/tagcleaner.pl -verbose -64 -fastq test.fq -out_format 3 -out trimtest -log -nomatch 4 -tag5 GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTAT -tag3 GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTGAAACGATCTCGTAT -mm5 2 -cont

Estimate size of input data for status report (this might take a while for large files)
done
Parse and process input data

status: 4 %Use of uninitialized value in integer eq (==) at /Volumes/BioSan/opt/tagcleaner-0.12/tagcleaner.pl line 2001, <FILE> line 5.
Use of uninitialized value in integer addition (+) at /Volumes/BioSan/opt/tagcleaner-0.12/tagcleaner.pl line 2001, <FILE> line 5.
Use of uninitialized value in integer addition (+) at /Volumes/BioSan/opt/tagcleaner-0.12/tagcleaner.pl line 2001, <FILE> line 5.
Use of uninitialized value in substr at /Volumes/BioSan/opt/tagcleaner-0.12/tagcleaner.pl line 2033, <FILE> line 5.
Use of uninitialized value in substr at /Volumes/BioSan/opt/tagcleaner-0.12/tagcleaner.pl line 2033, <FILE> line 5.
Use of uninitialized value in substr at /Volumes/BioSan/opt/tagcleaner-0.12/tagcleaner.pl line 2034, <FILE> line 5.
Use of uninitialized value in substr at /Volumes/BioSan/opt/tagcleaner-0.12/tagcleaner.pl line 2034, <FILE> line 5.
done
Input/Output stats:
Input sequences: 2
Input bases: 200
Input mean length: 100.00
Output sequences: 1
Output bases: 0
Output mean length: 0.00

I hope it helps.

Stefanie

Robert Schmieder

unread,
Jun 13, 2013, 10:51:53 AM6/13/13
to Edwards...@googlegroups.com
Thanks for providing the test dataset. I was able to reproduce the error and will have a solution for you by the end of the week.

Robert Schmieder

unread,
Jun 15, 2013, 11:17:02 PM6/15/13
to Edwards...@googlegroups.com
I released a new version 0.13 that fixes the issue. Thanks again for the bug report.
Reply all
Reply to author
Forward
0 new messages