tags not being predicted tagcleaner

[ale.azu...@gmail.com]

Hi,
I have a fastq file that I know it has still adaptors since they were reported by FastQC but they are not being predicted by tagcleaner. I made a file with sequences that have the adaptor and tried again tagcleaner and still it is not being predicted even though the adaptor is present in all of the reads.
I have tried both running it with the -64 parameter and without it.
The adaptor in question is
#Sequence Count Percentage Possible Source
GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGC 709987 0.6270620894865074 TruSeq Adapter, Index 6 (100% over 50bp)
I can provide the example fastq file if needed.
Thanks,
Alejandra

[Robert Schmieder]

Hi Alejandra,

Did you try to predict the adapter sequence or to remove the adapter? The 0.6% is most likely too low to be predicted by TagCleaner as it does not check for already known adapters like FastQC does. If you provide the command used and a few example sequences, then I can take a look at it.

Thanks,
Rob