RE: [Non-DoD Source] Re: Edge: running the Qiime analysis: what is the metadata mapping file? (UNCLASSIFIED)

15 views
Skip to first unread message

Anderson, Joseph J (Joe) CIV USARMY 21 SIG BDE (USA)

unread,
Nov 28, 2018, 11:30:54 AM11/28/18
to Greenleaf, Lo, Chien-Chi, edge-users
CLASSIFICATION: UNCLASSIFIED

Hi All,

I just wanted to chime in, that's a pretty good project name you have there. You're definitely our (EDGE) kind of people.

V/r,

Joe Anderson, M.Bin
Brigade Data Scientist
21st Signal Brigade
1435 Porter Street
Ft Detrick, MD 21702
(301)619-6184
joseph.j.an...@mail.mil


-----Original Message-----
From: edge-...@googlegroups.com [mailto:edge-...@googlegroups.com] On Behalf Of Greenleaf
Sent: Tuesday, November 27, 2018 8:44 PM
To: Lo, Chien-Chi <chie...@lanl.gov>; edge-users <edge-...@googlegroups.com>
Cc: greenleafmou...@gmail.com
Subject: [Non-DoD Source] Re: Edge: running the Qiime analysis: what is the metadata mapping file?

All active links contained in this email were disabled. Please verify the identity of the sender, and confirm the authenticity of all links contained within the message prior to copying and pasting the address to a Web browser.


________________________________




1.)

I tried what you suggested, clicking "Unpaired Reads", providing the Single-end FASTQ File,

/home/bee015guest/EdgeInstallDirectory/edge/edge_ui/EDGE_input/BeeGuts/SRR6684160_1.fastq

and the MetadatMappingFile of


/home/bee015guest/EdgeInstallDirectory/edge/edge_ui/EDGE_input/BeeGuts/aManifestFile.csv_1_files


with the contents of that file being:

#SampleID Files SampleType Description
SampleNumber1 SRR6684160_1.fastq BeeGuts testing_metabiome_of_mosquitos



2.)


I get this in file of ./QiimeAnalysis/errorLog.txt:


Traceback (most recent call last):
File"/home/bee015guest/EdgeInstallDirectory/edge_dev/thirdParty/Anaconda2/bin/split_libraries_fastq.py", line 365, in <module>
main()
File"/home/bee015guest/EdgeInstallDirectory/edge_dev/thirdParty/Anaconda2/bin/split_libraries_fastq.py", line 272, in main
has_barcodes=barcode_read_fp is not None)
File"/home/bee015guest/EdgeInstallDirectory/edge_dev/thirdParty/Anaconda2/lib/python2.7/site-packages/qiime/split_libraries.py", line 310, in check_map
'identify problems.')
ValueError: Errors were found with mapping file, please run validate_mapping_file.py to identify problems.
Error, CMD: split_libraries_fastq.py -o/home/bee015guest/EDGE_output/ef0998a0d2546773900a28225ba9c0db/QiimeAnalysis/slout -i/home/bee015guest/EDGE_output/ef0998a0d2546773900a28225ba9c0db/QiimeAnalysis/newFastq/SRR6684160_1.nobarcodes.fastq -b/home/bee015guest/EDGE_output/ef0998a0d2546773900a28225ba9c0db/QiimeAnalysis/newFastq/SRR6684160_1.barcodes.fastq -m/home/bee015guest/EDGE_output/ef0998a0d2546773900a28225ba9c0db/QiimeAnalysis/aManifestFile.txt --barcode_type 6 -q 19 -p 0.5 -n 1 --phred_offset 33 died with ret 256 at/home/bee015guest/EdgeInstallDirectory/edge_dev/scripts/qiime_pipeline/qiime_pipeline.pl line 1189.





3.)


But the validate_mapping_file.py seemed to go fine, per this file: ./process_current.log




###########################################################################
Qiime [2018 Nov 28 01:30:54] Checking Mapping File ###########################################################################
Qiime CMD: validate_mapping_file.py -b -p -m/home/bee015guest/EDGE_output/ef0998a0d2546773900a28225ba9c0db/QiimeAnalysis/combined_mapping.txt -o/home/bee015guest/EDGE_output/ef0998a0d2546773900a28225ba9c0db/QiimeAnalysis/checkMappingFile
No errors or warnings were found in mapping file.

Qiime Running time: 00:00:01





4.) Top 8 lines of my FASTQ file in case something is funny with it:

$ head -8 SRR6684160_1.fastq

@SRR6684160.1 1 length=300
GTGCCAGCAGCCGCGGTAATACGTAGGGTGCAAGCGTTATCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGTTCGTCGCGTCTGGTGTGAAAGTCCATCGCTTAACGGTGGATCGGCGCCGGGTACGGGCGGACTGGAGTGCGGTAGGGGAGACTGGAATTCCCGGTGTAACGGTGGAATGTGTCGATATCGGGACGAACACCGATGGCGAAGGCAGGTCTCTGGGCCTTCCCTGACGCTGTGGTGCGCACTCGTGCGGTGCGAACAGGCTTTGTACCCCCTGTTTTCCCTGTCTCC
+SRR6684160.1 1 length=300
CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGCGGGGGGGDFGGGGGGGGGGGGGGDFGGGGGGGGEGGC@<>C8*1;+<+<+A+2*;*:<8****15*1*;;7):**0)*)**10*)9<C7@+*007*00*046)0.04)))))).()))(.).**1(((-(()-3(((.4(-))*199(-(.)).129.).8AD<
@SRR6684160.2 2 length=300
GTGCCAGCCGCCGCGGTAATACGTAGGGTGCAAGCGTTATCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGTTCGTCGCGTCTGGTGTGAAAGTCCATCGCTTAACGGTGGATCGGCGCCGGGTACGGGCGGACTGGAGTGCGGTAGGGGAGACTGGAATTCCCGGTGTAACGGTGGAATGTGTAGATATCGGGAAGAACACCGATGGCGAAGGCAGGTCTCTGGGCCGTCACTGACGCTGAGGCGCGAAATCGTGGGGAGCGACCAGGATTAGATACCCGAGTAGTCCCTGTCTCC
+SRR6684160.2 2 length=300
CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGDDGF52+<:C?E+97@9CC5****/*3;*;CC3>8*7)*55*9*7)1<CFF<**075>D*>A6*977?))0)))-,)).(.).**)(((-(()-(.(24<)226*9CD0((-,6<?:6<)4>444





5.)Is my installation flawed?


Should Qiime be easy to run, or does everyone fumble with choosing the correct options in conjunction with creating a correct Metadata Mapping file?


gmoore777





On 11/21/18 1:36 PM, Lo, Chien-Chi wrote:


This is fail because of no overlapped from the paired-end reads. The pipeline expected the two paired can be joined by the fastq-join program and use the joined reads for downstream analysis.



You can try just use the forward reads only as input in the metadata file.

#SampleID Files SampleType Description
Sample1 SRR6684160_1.fastq BeeGuts metabiome_of_mosquitos





Chienchi



From: Greenleaf <greenleafmou...@gmail.com> < Caution-mailto:greenleafmou...@gmail.com >
Date: Tuesday, November 20, 2018 at 5:39 PM
To: Chien-Chi Lo <chie...@lanl.gov> < Caution-mailto:chie...@lanl.gov > , edge-users <edge-...@googlegroups.com> < Caution-mailto:edge-...@googlegroups.com > , guy <guy....@comcast.net> < Caution-mailto:guy....@comcast.net >
Subject: Re: Edge: running the Qiime analysis: what is the metadata mapping file?



Thank you, those instructions were helpful

I have clicked "De-multiplexed Reads Dir" instead of "Paired Reads", and provided the directory of the 2 FASTQ files,

and created this as the metadata mapping file:

#SampleID Files SampleType Description
Sample1 SRR6684160_1.fastq,SRR6684160_2.fastq BeeGuts metabiome_of_mosquitos

I think the analysis went further but now get this error:

.../QiimeAnalysis$ cat ./errorLog.txt

Traceback (most recent call last):
File"/home/bee015guest/EdgeInstallDirectory/edge_dev/thirdParty/Anaconda2/bin/pick_open_reference_otus.py", line 453, in <module>
main()
File"/home/bee015guest/EdgeInstallDirectory/edge_dev/thirdParty/Anaconda2/bin/pick_open_reference_otus.py", line 432, in main
minimum_failure_threshold=minimum_failure_threshold)
File"/home/bee015guest/EdgeInstallDirectory/edge_dev/thirdParty/Anaconda2/lib/python2.7/site-packages/qiime/workflow/pick_open_reference_otus.py", line 966, in pick_subsampled_open_reference_otus
close_logger_on_success=False)
File"/home/bee015guest/EdgeInstallDirectory/edge_dev/thirdParty/Anaconda2/lib/python2.7/site-packages/qiime/workflow/util.py", line 122, in call_commands_serially
raise WorkflowError(msg)
qiime.workflow.util.WorkflowError:

*** ERROR RAISED DURING STEP: Make the otu table
Command run was:
make_otu_table.py -i/home/bee015guest/EDGE_output/12b33adca39b9ff78e7d0583e0dec093/QiimeAnalysis/otus/final_otu_map_mc2.txt -o/home/bee015guest/EDGE_output/12b33adca39b9ff78e7d0583e0dec093/QiimeAnalysis/otus/otu_table_mc2.biom
Command returned exit status: 1
Stdout:

Stderr
Traceback (most recent call last):
File"/home/bee015guest/EdgeInstallDirectory/edge_dev/thirdParty/Anaconda2/bin/make_otu_table.py", line 119, in <module>
main()
File"/home/bee015guest/EdgeInstallDirectory/edge_dev/thirdParty/Anaconda2/bin/make_otu_table.py", line 115, in main
write_biom_table(biom_otu_table, opts.output_biom_fp)
File"/home/bee015guest/EdgeInstallDirectory/edge_dev/thirdParty/Anaconda2/lib/python2.7/site-packages/qiime/util.py", line 569, in write_biom_table
"Attempting to write an empty BIOM table to disk. "
qiime.util.EmptyBIOMTableError: Attempting to write an empty BIOM table to disk. QIIME doesn't support writing empty BIOM output files.


Error, CMD: pick_open_reference_otus.py -f -i/home/bee015guest/EDGE_output/12b33adca39b9ff78e7d0583e0dec093/QiimeAnalysis/slout/seqs.fna -o/home/bee015guest/EDGE_output/12b33adca39b9ff78e7d0583e0dec093/QiimeAnalysis/otus -s 0.01 -r/home/bee015guest/EdgeInstallDirectory/edge_dev/scripts/qiime_pipeline/data/Silva119_release/rep_set/97/Silva_119_rep_set97.fna -p/home/bee015guest/EDGE_output/12b33adca39b9ff78e7d0583e0dec093/QiimeAnalysis/parameter.txt --min_otu_size 2 -aO 2 died with ret 256 at/home/bee015guest/EdgeInstallDirectory/edge_dev/scripts/qiime_pipeline/qiime_pipeline.pl line 1189.

These are the sizes of the files in the .../QiimeAnalysis directory:

$ find . -type f | xargs ls -al
-rw-r--r-- 1 bee015guest bee015guest 155 Nov 21 00:29 ./aManifestFile.txt
-rw-r--r-- 1 bee015guest bee015guest 155 Nov 21 00:29 ./checkMappingFile/combined_mapping_corrected.txt
-rw-r--r-- 1 bee015guest bee015guest 1719 Nov 21 00:29 ./checkMappingFile/combined_mapping.html
-rw-r--r-- 1 bee015guest bee015guest 44 Nov 21 00:29 ./checkMappingFile/combined_mapping.log
-rw-r--r-- 1 bee015guest bee015guest 50732 Nov 21 00:29 ./checkMappingFile/overlib.js
-rw-r--r-- 1 bee015guest bee015guest 155 Nov 21 00:29 ./combined_mapping.txt
-rw-r--r-- 1 bee015guest bee015guest 2470 Nov 21 00:31 ./errorLog.txt
-rw-r--r-- 1 bee015guest bee015guest 253 Nov 21 00:30 ./fastq-join_joined/join.finished
-rw-r--r-- 1 bee015guest bee015guest 4138 Nov 21 00:30 ./fastq-join_joined/pair0/fastqjoin.join.fastq
-rw-r--r-- 1 bee015guest bee015guest 26959228 Nov 21 00:30 ./fastq-join_joined/pair0/fastqjoin.un1.fastq
-rw-r--r-- 1 bee015guest bee015guest 26959228 Nov 21 00:30 ./fastq-join_joined/pair0/fastqjoin.un2.fastq
-rw-r--r-- 1 bee015guest bee015guest 102 Nov 21 00:30 ./fastq-join_joined/pair0/file.txt
-rw-r--r-- 1 bee015guest bee015guest 0 Nov 21 00:31 ./otus/final_otu_map_mc2.txt
-rw-r--r-- 1 bee015guest bee015guest 72 Nov 21 00:31 ./otus/final_otu_map.txt
-rw-r--r-- 1 bee015guest bee015guest 7108 Nov 21 00:31 ./otus/log_20181121003006.txt
-rw-r--r-- 1 bee015guest bee015guest 251131321 Nov 21 00:31 ./otus/new_refseqs.fna
-rw-r--r-- 1 bee015guest bee015guest 0 Nov 21 00:31 ./otus/rep_set.fna
-rw-r--r-- 1 bee015guest bee015guest 935 Nov 21 00:31 ./otus/step1_otus/failures.fasta
-rw-r--r-- 1 bee015guest bee015guest 963 Nov 21 00:31 ./otus/step1_otus/POTU_SmRu_.0_clusters.uc
-rw-r--r-- 1 bee015guest bee015guest 963 Nov 21 00:31 ./otus/step1_otus/POTU_SmRu_.1_clusters.uc
-rw-r--r-- 1 bee015guest bee015guest 20 Nov 21 00:31 ./otus/step1_otus/seqs_failures.txt
-rw-r--r-- 1 bee015guest bee015guest 1662 Nov 21 00:31 ./otus/step1_otus/seqs_otus.log
-rw-r--r-- 1 bee015guest bee015guest 0 Nov 21 00:31 ./otus/step1_otus/seqs_otus.txt
-rw-r--r-- 1 bee015guest bee015guest 0 Nov 21 00:31 ./otus/step1_otus/step1_rep_set.fna
-rw-r--r-- 1 bee015guest bee015guest 938 Nov 21 00:31 ./otus/step4_otus/failures_clusters.uc
-rw-r--r-- 1 bee015guest bee015guest 579 Nov 21 00:31 ./otus/step4_otus/failures_otus.log
-rw-r--r-- 1 bee015guest bee015guest 72 Nov 21 00:31 ./otus/step4_otus/failures_otus.txt
-rw-r--r-- 1 bee015guest bee015guest 815 Nov 21 00:31 ./otus/step4_otus/step4_rep_set.fna
-rw-r--r-- 1 bee015guest bee015guest 715 Nov 21 00:29 ./parameter.txt
-rw-r--r-- 1 bee015guest bee015guest 3540 Nov 21 00:31 ./processLog.txt
-rw-r--r-- 1 bee015guest bee015guest 105 Nov 21 00:30 ./slout/histograms.txt
-rw-r--r-- 1 bee015guest bee015guest 935 Nov 21 00:30 ./slout/seqs.fna
-rw-r--r-- 1 bee015guest bee015guest 0 Nov 21 00:30 ./slout/split.finished
-rw-r--r-- 1 bee015guest bee015guest 550 Nov 21 00:30 ./slout/split_library_log.txt

Sorry for all this information...

On 11/20/18 6:53 PM, Lo, Chien-Chi wrote:

Here has some descriptions for the Qiime pipeline. EDGE implemented Qiime v1.9.1 into a pipeline. We plan to update it to Qiime2 in the near future.



Caution-https://edge.readthedocs.io/en/latest/gui.html#run-qiime < Caution-https://edge.readthedocs.io/en/latest/gui.html#run-qiime >







--
You received this message because you are subscribed to the Google Groups "edge-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to edge-users+...@googlegroups.com < Caution-mailto:edge-users+...@googlegroups.com > .
To post to this group, send email to edge-...@googlegroups.com < Caution-mailto:edge-...@googlegroups.com > .
To view this discussion on the web visit Caution-https://groups.google.com/d/msgid/edge-users/bf082fa5-c4e8-4775-8572-94976e62e187%40gmail.com < Caution-https://groups.google.com/d/msgid/edge-users/bf082fa5-c4e8-4775-8572-94976e62e187%40gmail.com?utm_medium=email&utm_source=footer > .
For more options, visit Caution-https://groups.google.com/d/optout < Caution-https://groups.google.com/d/optout > .



CLASSIFICATION: UNCLASSIFIED
Reply all
Reply to author
Forward
0 new messages