Here has some descriptions for the Qiime pipeline. EDGE implemented Qiime v1.9.1 into a pipeline. We plan to update it to Qiime2 in the near future.
https://edge.readthedocs.io/en/latest/gui.html#run-qiime
Thanks,
Chienchi
--
You received this message because you are subscribed to the Google Groups "edge-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to
edge-users+...@googlegroups.com.
To post to this group, send email to
edge-...@googlegroups.com.
To view this discussion on the web visit
https://groups.google.com/d/msgid/edge-users/f98fe635-8857-46d6-8115-0cb2a70be36b%40googlegroups.com.
For more options, visit https://groups.google.com/d/optout.
Thank you, those instructions were helpful
I have clicked "De-multiplexed Reads Dir" instead of "Paired
Reads", and provided the directory of the 2 FASTQ files,
and created this as the metadata mapping file:
#SampleID Files SampleType Description
Sample1 SRR6684160_1.fastq,SRR6684160_2.fastq BeeGuts
metabiome_of_mosquitos
I think the analysis went further but now get this error:
.../QiimeAnalysis$ cat ./errorLog.txt
Traceback (most recent call last):
File
"/home/bee015guest/EdgeInstallDirectory/edge_dev/thirdParty/Anaconda2/bin/pick_open_reference_otus.py",
line 453, in <module>
main()
File
"/home/bee015guest/EdgeInstallDirectory/edge_dev/thirdParty/Anaconda2/bin/pick_open_reference_otus.py",
line 432, in main
minimum_failure_threshold=minimum_failure_threshold)
File
"/home/bee015guest/EdgeInstallDirectory/edge_dev/thirdParty/Anaconda2/lib/python2.7/site-packages/qiime/workflow/pick_open_reference_otus.py",
line 966, in pick_subsampled_open_reference_otus
close_logger_on_success=False)
File
"/home/bee015guest/EdgeInstallDirectory/edge_dev/thirdParty/Anaconda2/lib/python2.7/site-packages/qiime/workflow/util.py",
line 122, in call_commands_serially
raise WorkflowError(msg)
qiime.workflow.util.WorkflowError:
*** ERROR RAISED DURING STEP: Make the otu table
Command run was:
make_otu_table.py -i
/home/bee015guest/EDGE_output/12b33adca39b9ff78e7d0583e0dec093/QiimeAnalysis/otus/final_otu_map_mc2.txt
-o
/home/bee015guest/EDGE_output/12b33adca39b9ff78e7d0583e0dec093/QiimeAnalysis/otus/otu_table_mc2.biom
Command returned exit status: 1
Stdout:
Stderr
Traceback (most recent call last):
File
"/home/bee015guest/EdgeInstallDirectory/edge_dev/thirdParty/Anaconda2/bin/make_otu_table.py",
line 119, in <module>
main()
File
"/home/bee015guest/EdgeInstallDirectory/edge_dev/thirdParty/Anaconda2/bin/make_otu_table.py",
line 115, in main
write_biom_table(biom_otu_table, opts.output_biom_fp)
File
"/home/bee015guest/EdgeInstallDirectory/edge_dev/thirdParty/Anaconda2/lib/python2.7/site-packages/qiime/util.py",
line 569, in write_biom_table
"Attempting to write an empty BIOM table to disk. "
qiime.util.EmptyBIOMTableError: Attempting to write an empty BIOM
table to disk. QIIME doesn't support writing empty BIOM output
files.
Error, CMD: pick_open_reference_otus.py -f -i
/home/bee015guest/EDGE_output/12b33adca39b9ff78e7d0583e0dec093/QiimeAnalysis/slout/seqs.fna
-o
/home/bee015guest/EDGE_output/12b33adca39b9ff78e7d0583e0dec093/QiimeAnalysis/otus
-s 0.01 -r
/home/bee015guest/EdgeInstallDirectory/edge_dev/scripts/qiime_pipeline/data/Silva119_release/rep_set/97/Silva_119_rep_set97.fna
-p
/home/bee015guest/EDGE_output/12b33adca39b9ff78e7d0583e0dec093/QiimeAnalysis/parameter.txt
--min_otu_size 2 -aO 2 died with ret 256 at
/home/bee015guest/EdgeInstallDirectory/edge_dev/scripts/qiime_pipeline/qiime_pipeline.pl
line 1189.
These are the sizes of the files in the .../QiimeAnalysis directory:
$ find . -type f | xargs ls -al
-rw-r--r-- 1 bee015guest bee015guest 155 Nov 21 00:29
./aManifestFile.txt
-rw-r--r-- 1 bee015guest bee015guest 155 Nov 21 00:29
./checkMappingFile/combined_mapping_corrected.txt
-rw-r--r-- 1 bee015guest bee015guest 1719 Nov 21 00:29
./checkMappingFile/combined_mapping.html
-rw-r--r-- 1 bee015guest bee015guest 44 Nov 21 00:29
./checkMappingFile/combined_mapping.log
-rw-r--r-- 1 bee015guest bee015guest 50732 Nov 21 00:29
./checkMappingFile/overlib.js
-rw-r--r-- 1 bee015guest bee015guest 155 Nov 21 00:29
./combined_mapping.txt
-rw-r--r-- 1 bee015guest bee015guest 2470 Nov 21 00:31
./errorLog.txt
-rw-r--r-- 1 bee015guest bee015guest 253 Nov 21 00:30
./fastq-join_joined/join.finished
-rw-r--r-- 1 bee015guest bee015guest 4138 Nov 21 00:30
./fastq-join_joined/pair0/fastqjoin.join.fastq
-rw-r--r-- 1 bee015guest bee015guest 26959228 Nov 21 00:30
./fastq-join_joined/pair0/fastqjoin.un1.fastq
-rw-r--r-- 1 bee015guest bee015guest 26959228 Nov 21 00:30
./fastq-join_joined/pair0/fastqjoin.un2.fastq
-rw-r--r-- 1 bee015guest bee015guest 102 Nov 21 00:30
./fastq-join_joined/pair0/file.txt
-rw-r--r-- 1 bee015guest bee015guest 0 Nov 21 00:31
./otus/final_otu_map_mc2.txt
-rw-r--r-- 1 bee015guest bee015guest 72 Nov 21 00:31
./otus/final_otu_map.txt
-rw-r--r-- 1 bee015guest bee015guest 7108 Nov 21 00:31
./otus/log_20181121003006.txt
-rw-r--r-- 1 bee015guest bee015guest 251131321 Nov 21 00:31
./otus/new_refseqs.fna
-rw-r--r-- 1 bee015guest bee015guest 0 Nov 21 00:31
./otus/rep_set.fna
-rw-r--r-- 1 bee015guest bee015guest 935 Nov 21 00:31
./otus/step1_otus/failures.fasta
-rw-r--r-- 1 bee015guest bee015guest 963 Nov 21 00:31
./otus/step1_otus/POTU_SmRu_.0_clusters.uc
-rw-r--r-- 1 bee015guest bee015guest 963 Nov 21 00:31
./otus/step1_otus/POTU_SmRu_.1_clusters.uc
-rw-r--r-- 1 bee015guest bee015guest 20 Nov 21 00:31
./otus/step1_otus/seqs_failures.txt
-rw-r--r-- 1 bee015guest bee015guest 1662 Nov 21 00:31
./otus/step1_otus/seqs_otus.log
-rw-r--r-- 1 bee015guest bee015guest 0 Nov 21 00:31
./otus/step1_otus/seqs_otus.txt
-rw-r--r-- 1 bee015guest bee015guest 0 Nov 21 00:31
./otus/step1_otus/step1_rep_set.fna
-rw-r--r-- 1 bee015guest bee015guest 938 Nov 21 00:31
./otus/step4_otus/failures_clusters.uc
-rw-r--r-- 1 bee015guest bee015guest 579 Nov 21 00:31
./otus/step4_otus/failures_otus.log
-rw-r--r-- 1 bee015guest bee015guest 72 Nov 21 00:31
./otus/step4_otus/failures_otus.txt
-rw-r--r-- 1 bee015guest bee015guest 815 Nov 21 00:31
./otus/step4_otus/step4_rep_set.fna
-rw-r--r-- 1 bee015guest bee015guest 715 Nov 21 00:29
./parameter.txt
-rw-r--r-- 1 bee015guest bee015guest 3540 Nov 21 00:31
./processLog.txt
-rw-r--r-- 1 bee015guest bee015guest 105 Nov 21 00:30
./slout/histograms.txt
-rw-r--r-- 1 bee015guest bee015guest 935 Nov 21 00:30
./slout/seqs.fna
-rw-r--r-- 1 bee015guest bee015guest 0 Nov 21 00:30
./slout/split.finished
-rw-r--r-- 1 bee015guest bee015guest 550 Nov 21 00:30
./slout/split_library_log.txt
Sorry for all this information...
This is fail because of no overlapped from the paired-end reads. The pipeline expected the two paired can be joined by the fastq-join program and use the joined reads for downstream analysis.
You can try just use the forward reads only as input in the metadata file.
#SampleID Files SampleType Description
Sample1 SRR6684160_1.fastq BeeGuts metabiome_of_mosquitos
Chienchi
In Excel, make a 4 column chart with the following column headers (see below)
I put in the sample number and use the same number for the description, leave the middle columns blank. Then save as a test file Tab delimited.
|
#SampleID |
BarcodeSequence |
LinkerPrimerSequence |
Description |
||
|
|||||
1.)
I tried what you suggested, clicking "Unpaired Reads", providing the Single-end FASTQ File,
/home/bee015guest/EdgeInstallDirectory/edge/edge_ui/EDGE_input/BeeGuts/SRR6684160_1.fastq
and the MetadatMappingFile of
/home/bee015guest/EdgeInstallDirectory/edge/edge_ui/EDGE_input/BeeGuts/aManifestFile.csv_1_files
with the contents of that file being:
#SampleID Files SampleType Description
SampleNumber1 SRR6684160_1.fastq BeeGuts
testing_metabiome_of_mosquitos
2.)
I get this in file of ./QiimeAnalysis/errorLog.txt:
3.)
But the validate_mapping_file.py seemed to go fine, per this file: ./process_current.log
###########################################################################
Qiime [2018 Nov 28 01:30:54] Checking Mapping File
###########################################################################
Qiime CMD: validate_mapping_file.py -b -p -m
/home/bee015guest/EDGE_output/ef0998a0d2546773900a28225ba9c0db/QiimeAnalysis/combined_mapping.txt
-o
/home/bee015guest/EDGE_output/ef0998a0d2546773900a28225ba9c0db/QiimeAnalysis/checkMappingFile
No errors or warnings were found in mapping file.
Qiime Running time: 00:00:01
4.) Top 8 lines of my FASTQ file in case something is funny with it:
$ head -8 SRR6684160_1.fastq
@SRR6684160.1 1 length=300
GTGCCAGCAGCCGCGGTAATACGTAGGGTGCAAGCGTTATCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGTTCGTCGCGTCTGGTGTGAAAGTCCATCGCTTAACGGTGGATCGGCGCCGGGTACGGGCGGACTGGAGTGCGGTAGGGGAGACTGGAATTCCCGGTGTAACGGTGGAATGTGTCGATATCGGGACGAACACCGATGGCGAAGGCAGGTCTCTGGGCCTTCCCTGACGCTGTGGTGCGCACTCGTGCGGTGCGAACAGGCTTTGTACCCCCTGTTTTCCCTGTCTCC
+SRR6684160.1 1 length=300
CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGCGGGGGGGDFGGGGGGGGGGGGGGDFGGGGGGGGEGGC@<>C8*1;+<+<+A+2*;*:<8****15*1*;;7):**0)*)**10*)9<C7@+*007*00*046)0.04)))))).()))(.).**1(((-(()-3(((.4(-))*199(-(.)).129.).8AD<
@SRR6684160.2 2 length=300
GTGCCAGCCGCCGCGGTAATACGTAGGGTGCAAGCGTTATCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGTTCGTCGCGTCTGGTGTGAAAGTCCATCGCTTAACGGTGGATCGGCGCCGGGTACGGGCGGACTGGAGTGCGGTAGGGGAGACTGGAATTCCCGGTGTAACGGTGGAATGTGTAGATATCGGGAAGAACACCGATGGCGAAGGCAGGTCTCTGGGCCGTCACTGACGCTGAGGCGCGAAATCGTGGGGAGCGACCAGGATTAGATACCCGAGTAGTCCCTGTCTCC
+SRR6684160.2 2 length=300
CCCCCGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGGGGGGGGGGGDDGF52+<:C?E+97@9CC5****/*3;*;CC3>8*7)*55*9*7)1<CFF<**075>D*>A6*977?))0)))-,)).(.).**)(((-(()-(.(24<)226*9CD0((-,6<?:6<)4>444
5.)Is my installation flawed?
Should Qiime be easy to run, or does everyone fumble with
choosing the correct options in conjunction with creating a
correct Metadata Mapping file?
gmoore777
My suggestion is to modify the metadata file only. I didn’t suggest to change the read type to ‘Unpaired Reads’. You should still click "De-multiplexed Reads Dir" since your data is already demultiplexed. The “Paired Reads” and “Unpaired Reads” are FASTQ files with barcode in reads or user provides separate barcode fastq files in the parameters section.
If you read the qiime tutorial, you will find out how many different types input scenarios. http://qiime.org/tutorials/processing_illumina_data.html
EDGE tried to make it easy but looks like it still a bit complex for new users. Please re-read https://edge.readthedocs.io/en/latest/gui.html#run-qiime documentations and we will appreciate any feedback on making it more clear for users.
Thanks,
Chienchi
On 11/21/18 1:36 PM, Lo, Chien-Chi wrote:
This is fail because of no overlapped from the paired-end reads. The pipeline expected the two paired can be joined by the fastq-join program and use the joined reads for downstream analysis.
You can try just use the forward reads only as input in the metadata file.
#SampleID Files SampleType Description
Sample1 SRR6684160_1.fastq BeeGuts metabiome_of_mosquitos
Thank you