Plant Kozaks from a Cloning Perspective

70 views
Skip to first unread message

Sebastian Cocioba

unread,
Feb 21, 2014, 1:50:19 PM2/21/14
to diybio
Here's another question for you guys and gals:

The most optimal consensus sequence for EUKARYOTIC expression in plants is:

AAA AAA AAA ACA

upstream to the ATG and then a G at the +1 position. Making primers amplify this into a CDS seems to be a horrid idea. In theory, the ton of adenines will make for one difficult pcr attempt.

What would you suggest the best method for cloning this particular sequence into a CDS?

One method may be two shorter (adenine wise) primers that overlap and amplify the cds in two steps. That would leave twice the chance for error not to mention increase cost. The other method is synthesis but lets be honest, synthetic biology is great if you have money. I, like most DIY Biologists, have grossly insufficient funds for synthesizing every damn gene with said Kozak or every promoter with a terminal kozak motif.

Biobricks are great but scars and the burden of making nonBB parts into BB is heavy.

Any ideas are welcome. I know I asked this before in a more broader context but this time there is a more specific issue. Thanks in advance!


Sebastian S. Cocioba
CEO & Founder
New York Botanics, LLC
Plant Biotech R&D

Cathal Garvey

unread,
Feb 21, 2014, 6:00:12 PM2/21/14
to diy...@googlegroups.com
Question, first: It may be the consensus, but is it ever seen in nature?
Often, the consensus is never actually used for various reasons.

I recall hearing that consensus sigma-factor binding sites can be too
strong to allow the RNA Polymerase holoenzyme to actually leave the
promoter and start transcribing, for example. {{Citation Needed}}

That many "A"s in a row looks destined for frameshifts during
replication, though because it's not in the actual CDS perhaps that
doesn't matter. Still, I wouldn't be surprised if that poly-A tract is
broken up by one or two nucleotides in all the natural examples?

Could be blather, just a thought. I did once hack a gene in B.subtilis
that used a poly-A tract that long as part of intergenerational gene
regulation; each generation, there was a high chance of frameshift, and
therefore a chance of de-activating or re-activating the gene in the
daughter cell that inherited that mutation. Clever! :)
--
Please help support my crowdfunding campaign, IndieBB: Currently at
26.2% of funding goal, with 20 days left:
http://igg.me/at/yourfirstgmo/x/4252296
T: @onetruecathal, @IndieBBDNA
P: +3538763663185
W: http://indiebiotech.com
0x988B9099.asc
signature.asc

Sebastian Cocioba

unread,
Feb 21, 2014, 9:15:25 PM2/21/14
to Cathal Garvey, diy...@googlegroups.com
Clever indeed!

That sounds like a fun genetic/statistic experiment!

As for the kozak, Im on a promoter/ expression optimization kick and am
almost done making my home brewed binary vector for agro (patent,
copyright, IP issues made me do it) and will launch it open source if
its any good. I made what I believe to be an extremely plant friendly
gfp, expression wise, and am playing with kozaks in-silico. The actual
consensus is never observed in nature, especially since its the running
average of frequency and that's assessed on a base by base basis
(tongue twister) so the likelihood of any one organism having said
sequence is [insert stats equations here] which is quite low. I think.
At least it makes sense in my noggin.

I never looked at it from the perspective of a consensus being too
strong. If you stumble across a reference do post it. I'd love to see
their findings. Anyway I plan, once I have a solid strategy for kozak
incorporation, to mix and match and mutagenize bases and see how
expression changes. Granted it will be in one organism (tobacco) but
still interesting. The last few bits of my vector will be done by next
Sunday, assuming the plasmid gods smile down upon me, and will let
y'all know what I come up with. Would love to sequence T0 and T1 plants
and see if anything took a bite of the poly-a motif and how that change
affected expression.

Side note, pre-adenylated CDS via 3'UTR is used often as a CaMV
termination signal. If the frame shift logic holds true, wouldn't the
terminator break down in a few generations of bacterial streaks? A
simple sequencing project may shed some light on this. Thanks for the
interesting perspective!

Sebastian S. Cocioba
CEO & Founder
New York Botanics, LLC
Plant Biotech R&D From: Cathal Garvey
Sent: 2/21/2014 6:00 PM
To: diy...@googlegroups.com
Subject: Re: [DIYbio] Plant Kozaks from a Cloning Perspective

Yuriy

unread,
Nov 21, 2015, 12:37:11 AM11/21/15
to DIYbio
Yeah they won't synthesize it either. Too many A's, they say. I had too much of it in enhancer, Kozak and terminator  

Also they don't like to synthesize anything with a restriction site like BsaI. I guess they use it in their synthesis process or end processing.

I thought I optimized all there is to optimize all 4 kb and then this. Next step, working with the company and its advisers. 

Cathal (Phone)

unread,
Nov 21, 2015, 3:08:05 AM11/21/15
to diy...@googlegroups.com
Has anyone tried that consensus to see if it actually works? IIRC the consensus RBS for E.coli actually doesn't work, theory is that it's too strong and won't release the sigma-factor!
--
Sent from my Android device with K-9 Mail. Please excuse my brevity.

Koeng

unread,
Nov 21, 2015, 10:49:13 AM11/21/15
to DIYbio
If this is still a problem, I know someone who synthesized a ~125 polyA tract and cloned it. Other than being hard to PCR, it worked quite well. He used restriction enzymes. 

IDT ultramers work well for this. Of course, if you just need a few As, just use normal primers.

-Koeng

Yuriy

unread,
Nov 21, 2015, 10:49:58 AM11/21/15
to DIYbio, cathal...@cathalgarvey.me
My promoter actually exists in plant(s) by nature, at least in one sequenced plant. When BLASTed it has 0 gaps and 100% identity with its natural counterpart. That's why I selected it. It just has too many A's the closer it gets to the ATG.

Here's the minimal form of it >> AAGACTTTCTCTCTCTACACATACACCTACACCAGAAAAAAGAAAAAAATA derived from Madagascar periwinkle

Depending on what species you look at in the softberry promoter database you will get a good amount of uninterrupted poly-A binders/unzip in the promoter region.
for extreme example look at this
> PLPR0232 ..AC:X57171 ..OS:Dianthus caryophyllus ..GENE:CARSR12 ..PROD:CARSR12 ..[ -200: +51] ..CDS:+145 ..TSS:201 (+1) |Taxon: Dicot |Promoter: TATA-less
aatctaaaacaaaaaaagaaaacttttaagtgtcagattatatttaatattttcaaaatgactatagcaaattaaaaaaagaaaaaaaaaaaaaaaaaaaaacggggggccccacaaaaacatgtataaattcagcttcacaccctccaaattctctgcaacatccttcattctttccattaatatttttaatattttttCCTCTCTTAAAATAAGGGAGAAAATAAATAGATTAATCCACCAATTTTAGC

Sebastian S Cocioba

unread,
Nov 21, 2015, 1:06:02 PM11/21/15
to diy...@googlegroups.com
I finally got some synthesis going and will be building a gus cassette using the cotton leaf curl multan virus promoter and a custom kozak. Will let you all know as soon as its done and expressing in protoplasts. Gonna test a whole heap of native and viral promoters in the coming months too. Ill upload findings to my blog atinygreencell.com too. Its been too long to not have updated it. Will also be covering an attempt to make a define model organism for chloroplast integration. Everything from tissue culture, to sequencing, to growth requirements...the works! Its gonna be a fun ride...


Sebastian S. Cocioba
CEO & Founder
New York Botanics, LLC

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diy...@googlegroups.com. To unsubscribe from this group, send email to diybio+un...@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+un...@googlegroups.com.
To post to this group, send email to diy...@googlegroups.com.
Visit this group at http://groups.google.com/group/diybio.
To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/a11557cf-6483-495a-b90e-962fea0c44b2%40googlegroups.com.
For more options, visit https://groups.google.com/d/optout.
Reply all
Reply to author
Forward
0 new messages