Fwd: Transmitting RuBisCo sequence via Arecibo to 5 stars
11 views
Skip to first unread message
Mackenzie Cowell
Nov 7, 2009, 6:03:14 PM11/7/09
to diy...@googlegroups.com, awesome...@googlegroups.com, joed...@mit.edu
Hey DIYbio peeps,
The awesome foundation (awesomefoundation.org; disclaimer: I'm a microtrustee) collectively awards $1000 micro-grants each month to an interesting, *awesome* project. Recently the group received the following *extra awesome* proposal:
To transmit the 1434 basepairs of the RuBisCo protein towards 5 candidate stars using the Arecibo radio observatory on the anniversary of the Sagan-Drake transmissions of 1974.
Joe Davis ( http://en.wikipedia.org/wiki/Joe_Davis_(artist) ), the MIT artist behind this idea, is asking for feedback on the proposal (see below) and for help in soliciting radio time from the Aricebo director, Dr. Michael C. Nolan.
What do you think of his plan?
Could we collectively write an email (or blogpost) To Dr. Nolan in support?
I think it's a *stellar* idea! SRSLY!
Mac
The point of all this is that I am proposing a new message transmission to
>> coincide with the anniversary of the Sagan-Drake CETI transmission: All>> living
>> things are made of protein and the most abundant protein on Earth is
>> called
>> ?RuBisCo?(ribulose- 1,5-bisphosphate carboxylase oxygenase
==============================================================================
TOPIC: Fwd: arecibo rec
http://groups.google.com/group/awesome-boston/t/2e9c1faab246a2f1?hl=en
==============================================================================
== 1 of 7 ==
Date: Fri, Nov 6 2009 7:37 am
From: Tim Hwang
Also, the update from Joe Davis. He's wondering if he can get a formal
recommedation from the Awesome Foundation from the Arts and Sciences. I'm
inclined to lend a hand -- thoughts? Figure if there's no serious objections
I can draft one up and get it out to him today.
-Tim
---------- Forwarded message ----------
From: Joe Davis <joed...@mit.edu>
Date: Thu, Nov 5, 2009 at 9:12 PM
Subject: arecibo rec
To: Tim Hwang <t...@timhwang.org>
Tim,
I am disappointed of course, but there is still something you can do to help
and
perhaps your "micro-trustees" may feel inclined to help as well. So, please
forgive me if I a few points are reiterated below. Please see attached pix.
As you know, I am in Puerto Rico to deliver a lecture for UPR's Biology
Colloquium (yesterday at Rio Piedras campus, San Juan). I will be meeting
with
Michael C. Nolan <mno...@naic.edu>, interim director at Arecibo Observatory
in
the next day or so. Today's date happens to fall just short of the 16 Nov
35th
anniversary of the famous Sagan-Drake message for extraterrestrial
intelligence
that was transmitted from Arecibo in 1974.
I am sure you also are aware of the fact that profound underlying poetic and
philosophical implications of the search for extraterrestrial intelligence
have
marked much of my work and career as an artist. In the 1980s, technical
problems
associated with radar and spacecraft carriers inspired me to develop
prototype
bacteriological archives for generic information that could survive for very
long periods of time in the harsh environments of space. That is how a
subject
as vast in scope as the search for extraterrestrial intelligence ultimately
brought me to the study of molecular biology. In 1974, molecular biology was
entering its ?golden age?. Part of the Sagan Drake message was encrypted
with a rudimentary likeness of the DNA double helix. The hereditary role of
DNA
was then well known - as were two of the three principal conformations of
its
molecular structure - but the triplet operation of the genetic code had only
recently been unraveled and modern techniques for DNA sequencing were still
a
few years away. The first genes (DNA) were sequenced in 1977 and the first
recombinant organisms were produced in Herbert Boyer?s laboratory (UCSF) in
1978. While messages were being transmitted to extraterrestrial intelligence
in
1974, no one knew that genetically speaking, human beings are 70% identical
to
tomatoes. There was no genomic science at all.
The point of all this is that I am proposing a new message transmission to
coincide with the anniversary of the Sagan-Drake CETI transmission: All
living
things are made of protein and the most abundant protein on Earth is called
?RuBisCo?(ribulose- 1,5-bisphosphate carboxylase oxygenase). It is actually
quite an interesting protein. To quote Wikipedia, it is ?an enzyme that is
used in the Calvin cycle to catalyze the first major step of carbon
fixation, a
process by which the atoms of atmospheric carbon dioxide are made available
to
organisms in the form of energy-rich molecules such as sucrose.? It is also
interesting in that it actively selects against 13C, one of the naturally
ocurring stable isotopes of atmospheric carbon, in favor of 12C. The
difference
of course, is only a single neutron.
The Gene for the large Rubisco subunit is a 1434-mer DNA molecule:
ATGTCACCACAAACAGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAGTACCAAACCAAGGATACTGATATATTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTATGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACCGCATCGAGCGTGTTGTTGGAGAAAAAGATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCCATTGTAGGTAACGTATTTGGGTTCAAAGCCCTGCGCGCTCTACGTCTGGAAGATCTGCGAATCCCTCCTGCTTATGTTAAAACTTTCCAAGGTCCGCCTCATGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCTGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCACAACCATTTATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGCGAAGAAATGATCAAAAGAGCTGTATTTGCTAGAGAATTGGGCGTTCCGATCGTAATGCATGACTACTTAACGGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCGGTTATTGATAGACAGAAGAATCATGGTATCCACTTCCGGGTATTAGCAAAAGCGTTACGTATGTCTGGTGGAGATCATATTCACTCTGGTAC!
CGTAGTAGGTAAACTTGAAGGTGAAAGAGACATAACTTTGGGCTTTGTTGATTTACTGCGTGATGATTTTGTTGAACAAGATCGAAGTCGCGGTATTTATTTCACTCAAGATTGGGTCTCTTTACCAGGTGTTCTACCCGTGGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACATCCTTGGGGTAATGCGCCAGGTGCCGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTAAAAGCTCGTAATGAAGGACGTGATCTTGCTCAGGAAGGTAATGAAATTATTCGCGAGGCTTGCAAATGGAGCCCGGAACTAGCTGCTGCTTGTGAAGTATGGAAAGAGATCGTATTTAATTTTGCAGCAGTGGACGTTTTGGATAAGTAA
A binary map of the above can be obtained by assigning numerical values to
DNA
nucleotides based on molecular weight where C=00 T=01 A=10 and G=11. The
result
is a 2868-bit binary sequence that is less than twice as large as the
1679-bit
Sagan-Drake CETI message.
10011101001000001000101010001011101110000110101011001010110111010111111001010010101011000111110111010110101011101101100010101001011110000101100101100110000100000111101101100000101010000010101111100110000111100110011001011111001011001001010000111011011010000100000100101000000111111011010100001000000111101011101011001011111111000011001111011011000111000011101001000101000110000111110110001001111110001010000111011001111110000011100111111000010110000010110000010111100100110101100010101011111100111001110001100000110010010011101100110111010111010111111011101010101011100100101001100110010111000101100111011011000101100000000101011011100000010101010111101011101011110101000111010110000010100010011101010110000101000010010111011011110110100011011001010111111101010010101011000000011100110011000100011000110100011111101011100100011100111010010000000100000111000101100111010110101010000101010000101011110100001100000100100111111110010000101011010111101010111011100110101001011110100010101101100!
1111101001101000000000111010111111110011101100001100101101010000001101010010111111111010110010001110001101010101000011000111101101110110001110101011001111010011101000101001100111101111110000101111001010101100000101010111001111001111011101000110111101000010010001010000010010101100111001101011111101110111001001101010100010110010101011101110000111010110010000101011001101010110010001011110001111010100010111101111010100100101010111111001001011000010111101001110001100001110010111101100010011100111010111010100111100100101010101110110001110110010101110001101110111010010111111100110101000011100100110110100111001001111000011000010110100011111111111110010100100000110010101001100001101100010111110001001001011001011100001110111001101001111101000110000101000101001000100100001000001101110010100111001001110011110101100101111001101110001011101011101001001001111101100100001000010100001111110110010110110010101010110011010110001101100111010001111101111110111001001001100101001000010001111101100!
00011011011011011110110101000010111101011110111101010111011100!
01001101
00001010111111100010101110101111001010110000111001101111001111001010101110101111010001010111001001110101101001100111101100101011001010100100001001010111001011111110100010001010110000010111101110101000110000000110111110001010010111110111101100101001000110101011111001001100111000001110001000111100000111011100100010101111111111001111001010000110110000110001011010100111101111110111110100001010110111110001001000001011111111101101001110011000010111101110000110110110001101001001110110110110001000110111010110010011101110110101010110001001101101001111010111110001101111001000101110001001011111010111101101001111010100101100101001100111011110001011100101010011111101100000011111010000110110001110001110001011101111010110110011111101010111011100100110110010101101001010101110010110010110111111000110101010111111001101011011010
Certain flaws that hampered the 1974 Sagan-Drake transmission can be avoided
with a followup transmission. I have found 5 candidate stars currently in
the
Arecibo "window" (AX Micro, GJ 832, LP 816-060, GJ 752A, and GJ 338 gleaned
from Jill Tarter?s and Margaret Trunbull?s list of candidate ?nearby
habitable stellar systems?)
see: http://www.iop.org/EJ/abstract/0067-0049/149/2/423/
I have not yet factored galactic rotation into targeting positions for
selected
stars, but I assume that the nearer they are, the smaller any adjustments
will
be that have to be made. My friends at Cornell have also suggested that
since
our best bet at finding ETI would be ones that are already quite
sophisticated,
targeting infrared sources in our galaxy that have no corresponding optical
object should also be considered. Although I personally remain rather
skeptical
on this point, these objects could be Dyson Shells or other similar ETI
astroengineering projects.
The online data set of the IRAS could be used to identify such sources:
http://irsa.ipac.caltech.edu/IRASdocs/toc.html
I hope that a short message containing the RuBisCo sequence could be
transmitted
during some brief interval between scheduled ongoing use of Arecibo Radar or
that it may coincide with periods set aside for checks and maintenance. I
have
been advised that no special ceremony or event has been planned to mark the
November 16 anniversary.
I am writing you to ask for your recommendation to AO director, Dr. Michael
C.
Nolan, that he seriously consider my request to carry out the proposed
transmission. A transmission of phase-modulated 30hz center-frequency radar
pulses carrying the 2868-bit RuBisCo sequence would take just 4.7 minutes if
the transmitted sequence were to be repeated 3 times to a single star. Given
a
few minutes to reposition the radar between consecutive transmissions, all 5
stars might be targeted in about 40 minutes.
I would also appreciate your referral to anyone else in the
academic/scientific/research community you feel may also be inclined to
recommend this project to Dr. Nolan. I can be reached in Puerto Rico via my
cell phone if you have any questions or suggestions that you think I should
be
aware of.
Thank you for the taking time to consider this request.
Kind Regards,
Joe Davis
---------------------
Joe Davis
MIT 68-233
Cambridge, MA 02139
(617) 258-9299 (lab)
(617) 492-3298 (home)
(617) 852-6658 (cell)
--
Tim Hwang
Twitter: @timhwang
Phone: 973-960-4955
ROFLCon -- roflcon.org
--
Mac Cowell
DIYbio.org
p: 231.313.9062
w: has100ideas.com
tw: @100ideas
TOPIC: Fwd: arecibo rec
http://groups.google.com/group/awesome-boston/t/2e9c1faab246a2f1?hl=en
==============================================================================
== 1 of 7 ==
Date: Fri, Nov 6 2009 7:37 am
From: Tim Hwang
Also, the update from Joe Davis. He's wondering if he can get a formal
recommedation from the Awesome Foundation from the Arts and Sciences. I'm
inclined to lend a hand -- thoughts? Figure if there's no serious objections
I can draft one up and get it out to him today.
-Tim
---------- Forwarded message ----------
From: Joe Davis <joed...@mit.edu>
Date: Thu, Nov 5, 2009 at 9:12 PM
Subject: arecibo rec
To: Tim Hwang <t...@timhwang.org>
Tim,
I am disappointed of course, but there is still something you can do to help
and
perhaps your "micro-trustees" may feel inclined to help as well. So, please
forgive me if I a few points are reiterated below. Please see attached pix.
As you know, I am in Puerto Rico to deliver a lecture for UPR's Biology
Colloquium (yesterday at Rio Piedras campus, San Juan). I will be meeting
with
Michael C. Nolan <mno...@naic.edu>, interim director at Arecibo Observatory
in
the next day or so. Today's date happens to fall just short of the 16 Nov
35th
anniversary of the famous Sagan-Drake message for extraterrestrial
intelligence
that was transmitted from Arecibo in 1974.
I am sure you also are aware of the fact that profound underlying poetic and
philosophical implications of the search for extraterrestrial intelligence
have
marked much of my work and career as an artist. In the 1980s, technical
problems
associated with radar and spacecraft carriers inspired me to develop
prototype
bacteriological archives for generic information that could survive for very
long periods of time in the harsh environments of space. That is how a
subject
as vast in scope as the search for extraterrestrial intelligence ultimately
brought me to the study of molecular biology. In 1974, molecular biology was
entering its ?golden age?. Part of the Sagan Drake message was encrypted
with a rudimentary likeness of the DNA double helix. The hereditary role of
DNA
was then well known - as were two of the three principal conformations of
its
molecular structure - but the triplet operation of the genetic code had only
recently been unraveled and modern techniques for DNA sequencing were still
a
few years away. The first genes (DNA) were sequenced in 1977 and the first
recombinant organisms were produced in Herbert Boyer?s laboratory (UCSF) in
1978. While messages were being transmitted to extraterrestrial intelligence
in
1974, no one knew that genetically speaking, human beings are 70% identical
to
tomatoes. There was no genomic science at all.
The point of all this is that I am proposing a new message transmission to
coincide with the anniversary of the Sagan-Drake CETI transmission: All
living
things are made of protein and the most abundant protein on Earth is called
?RuBisCo?(ribulose- 1,5-bisphosphate carboxylase oxygenase). It is actually
quite an interesting protein. To quote Wikipedia, it is ?an enzyme that is
used in the Calvin cycle to catalyze the first major step of carbon
fixation, a
process by which the atoms of atmospheric carbon dioxide are made available
to
organisms in the form of energy-rich molecules such as sucrose.? It is also
interesting in that it actively selects against 13C, one of the naturally
ocurring stable isotopes of atmospheric carbon, in favor of 12C. The
difference
of course, is only a single neutron.
The Gene for the large Rubisco subunit is a 1434-mer DNA molecule:
ATGTCACCACAAACAGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAGTACCAAACCAAGGATACTGATATATTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTATGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACCGCATCGAGCGTGTTGTTGGAGAAAAAGATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCCATTGTAGGTAACGTATTTGGGTTCAAAGCCCTGCGCGCTCTACGTCTGGAAGATCTGCGAATCCCTCCTGCTTATGTTAAAACTTTCCAAGGTCCGCCTCATGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCTGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCACAACCATTTATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGCGAAGAAATGATCAAAAGAGCTGTATTTGCTAGAGAATTGGGCGTTCCGATCGTAATGCATGACTACTTAACGGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCGGTTATTGATAGACAGAAGAATCATGGTATCCACTTCCGGGTATTAGCAAAAGCGTTACGTATGTCTGGTGGAGATCATATTCACTCTGGTAC!
CGTAGTAGGTAAACTTGAAGGTGAAAGAGACATAACTTTGGGCTTTGTTGATTTACTGCGTGATGATTTTGTTGAACAAGATCGAAGTCGCGGTATTTATTTCACTCAAGATTGGGTCTCTTTACCAGGTGTTCTACCCGTGGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACATCCTTGGGGTAATGCGCCAGGTGCCGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTAAAAGCTCGTAATGAAGGACGTGATCTTGCTCAGGAAGGTAATGAAATTATTCGCGAGGCTTGCAAATGGAGCCCGGAACTAGCTGCTGCTTGTGAAGTATGGAAAGAGATCGTATTTAATTTTGCAGCAGTGGACGTTTTGGATAAGTAA
A binary map of the above can be obtained by assigning numerical values to
DNA
nucleotides based on molecular weight where C=00 T=01 A=10 and G=11. The
result
is a 2868-bit binary sequence that is less than twice as large as the
1679-bit
Sagan-Drake CETI message.
10011101001000001000101010001011101110000110101011001010110111010111111001010010101011000111110111010110101011101101100010101001011110000101100101100110000100000111101101100000101010000010101111100110000111100110011001011111001011001001010000111011011010000100000100101000000111111011010100001000000111101011101011001011111111000011001111011011000111000011101001000101000110000111110110001001111110001010000111011001111110000011100111111000010110000010110000010111100100110101100010101011111100111001110001100000110010010011101100110111010111010111111011101010101011100100101001100110010111000101100111011011000101100000000101011011100000010101010111101011101011110101000111010110000010100010011101010110000101000010010111011011110110100011011001010111111101010010101011000000011100110011000100011000110100011111101011100100011100111010010000000100000111000101100111010110101010000101010000101011110100001100000100100111111110010000101011010111101010111011100110101001011110100010101101100!
1111101001101000000000111010111111110011101100001100101101010000001101010010111111111010110010001110001101010101000011000111101101110110001110101011001111010011101000101001100111101111110000101111001010101100000101010111001111001111011101000110111101000010010001010000010010101100111001101011111101110111001001101010100010110010101011101110000111010110010000101011001101010110010001011110001111010100010111101111010100100101010111111001001011000010111101001110001100001110010111101100010011100111010111010100111100100101010101110110001110110010101110001101110111010010111111100110101000011100100110110100111001001111000011000010110100011111111111110010100100000110010101001100001101100010111110001001001011001011100001110111001101001111101000110000101000101001000100100001000001101110010100111001001110011110101100101111001101110001011101011101001001001111101100100001000010100001111110110010110110010101010110011010110001101100111010001111101111110111001001001100101001000010001111101100!
00011011011011011110110101000010111101011110111101010111011100!
01001101
00001010111111100010101110101111001010110000111001101111001111001010101110101111010001010111001001110101101001100111101100101011001010100100001001010111001011111110100010001010110000010111101110101000110000000110111110001010010111110111101100101001000110101011111001001100111000001110001000111100000111011100100010101111111111001111001010000110110000110001011010100111101111110111110100001010110111110001001000001011111111101101001110011000010111101110000110110110001101001001110110110110001000110111010110010011101110110101010110001001101101001111010111110001101111001000101110001001011111010111101101001111010100101100101001100111011110001011100101010011111101100000011111010000110110001110001110001011101111010110110011111101010111011100100110110010101101001010101110010110010110111111000110101010111111001101011011010
Certain flaws that hampered the 1974 Sagan-Drake transmission can be avoided
with a followup transmission. I have found 5 candidate stars currently in
the
Arecibo "window" (AX Micro, GJ 832, LP 816-060, GJ 752A, and GJ 338 gleaned
from Jill Tarter?s and Margaret Trunbull?s list of candidate ?nearby
habitable stellar systems?)
see: http://www.iop.org/EJ/abstract/0067-0049/149/2/423/
I have not yet factored galactic rotation into targeting positions for
selected
stars, but I assume that the nearer they are, the smaller any adjustments
will
be that have to be made. My friends at Cornell have also suggested that
since
our best bet at finding ETI would be ones that are already quite
sophisticated,
targeting infrared sources in our galaxy that have no corresponding optical
object should also be considered. Although I personally remain rather
skeptical
on this point, these objects could be Dyson Shells or other similar ETI
astroengineering projects.
The online data set of the IRAS could be used to identify such sources:
http://irsa.ipac.caltech.edu/IRASdocs/toc.html
I hope that a short message containing the RuBisCo sequence could be
transmitted
during some brief interval between scheduled ongoing use of Arecibo Radar or
that it may coincide with periods set aside for checks and maintenance. I
have
been advised that no special ceremony or event has been planned to mark the
November 16 anniversary.
I am writing you to ask for your recommendation to AO director, Dr. Michael
C.
Nolan, that he seriously consider my request to carry out the proposed
transmission. A transmission of phase-modulated 30hz center-frequency radar
pulses carrying the 2868-bit RuBisCo sequence would take just 4.7 minutes if
the transmitted sequence were to be repeated 3 times to a single star. Given
a
few minutes to reposition the radar between consecutive transmissions, all 5
stars might be targeted in about 40 minutes.
I would also appreciate your referral to anyone else in the
academic/scientific/research community you feel may also be inclined to
recommend this project to Dr. Nolan. I can be reached in Puerto Rico via my
cell phone if you have any questions or suggestions that you think I should
be
aware of.
Thank you for the taking time to consider this request.
Kind Regards,
Joe Davis
---------------------
Joe Davis
MIT 68-233
Cambridge, MA 02139
(617) 258-9299 (lab)
(617) 492-3298 (home)
(617) 852-6658 (cell)
--
Tim Hwang
Twitter: @timhwang
Phone: 973-960-4955
ROFLCon -- roflcon.org
---------- Forwarded message ----------
From: awesome-boston group <nor...@googlegroups.com>
Date: Sat, Nov 7, 2009 at 12:34 PM
Subject: awesome-boston - 10 new messages in 4 topics - digest
To: awesome-boston digest subscribers <awesome...@googlegroups.com>
==============================================================================
TOPIC: Fwd: arecibo rec
http://groups.google.com/group/awesome-boston/t/2e9c1faab246a2f1?hl=en
==============================================================================
== 1 of 7 ==
Date: Fri, Nov 6 2009 7:37 am
From: Tim Hwang
Also, the update from Joe Davis. He's wondering if he can get a formal
recommedation from the Awesome Foundation from the Arts and Sciences. I'm
inclined to lend a hand -- thoughts? Figure if there's no serious objections
I can draft one up and get it out to him today.
-Tim
---------- Forwarded message ----------
From: Joe Davis <joed...@mit.edu>
Date: Thu, Nov 5, 2009 at 9:12 PM
Subject: arecibo rec
To: Tim Hwang <t...@timhwang.org>
Tim,
I am disappointed of course, but there is still something you can do to help
and
perhaps your "micro-trustees" may feel inclined to help as well. So, please
forgive me if I a few points are reiterated below. Please see attached pix.
As you know, I am in Puerto Rico to deliver a lecture for UPR's Biology
Colloquium (yesterday at Rio Piedras campus, San Juan). I will be meeting
with
Michael C. Nolan <mno...@naic.edu>, interim director at Arecibo Observatory
in
the next day or so. Today's date happens to fall just short of the 16 Nov
35th
anniversary of the famous Sagan-Drake message for extraterrestrial
intelligence
that was transmitted from Arecibo in 1974.
I am sure you also are aware of the fact that profound underlying poetic and
philosophical implications of the search for extraterrestrial intelligence
have
marked much of my work and career as an artist. In the 1980s, technical
problems
associated with radar and spacecraft carriers inspired me to develop
prototype
bacteriological archives for generic information that could survive for very
long periods of time in the harsh environments of space. That is how a
subject
as vast in scope as the search for extraterrestrial intelligence ultimately
brought me to the study of molecular biology. In 1974, molecular biology was
entering its ?golden age?. Part of the Sagan Drake message was encrypted
with a rudimentary likeness of the DNA double helix. The hereditary role of
DNA
was then well known - as were two of the three principal conformations of
its
molecular structure - but the triplet operation of the genetic code had only
recently been unraveled and modern techniques for DNA sequencing were still
a
few years away. The first genes (DNA) were sequenced in 1977 and the first
recombinant organisms were produced in Herbert Boyer?s laboratory (UCSF) in
1978. While messages were being transmitted to extraterrestrial intelligence
in
1974, no one knew that genetically speaking, human beings are 70% identical
to
tomatoes. There was no genomic science at all.
The point of all this is that I am proposing a new message transmission to
coincide with the anniversary of the Sagan-Drake CETI transmission: All
living
things are made of protein and the most abundant protein on Earth is called
?RuBisCo?(ribulose- 1,5-bisphosphate carboxylase oxygenase). It is actually
quite an interesting protein. To quote Wikipedia, it is ?an enzyme that is
used in the Calvin cycle to catalyze the first major step of carbon
fixation, a
process by which the atoms of atmospheric carbon dioxide are made available
to
organisms in the form of energy-rich molecules such as sucrose.? It is also
interesting in that it actively selects against 13C, one of the naturally
ocurring stable isotopes of atmospheric carbon, in favor of 12C. The
difference
of course, is only a single neutron.
The Gene for the large Rubisco subunit is a 1434-mer DNA molecule:
ATGTCACCACAAACAGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAGTACCAAACCAAGGATACTGATATATTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTATGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACCGCATCGAGCGTGTTGTTGGAGAAAAAGATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCCATTGTAGGTAACGTATTTGGGTTCAAAGCCCTGCGCGCTCTACGTCTGGAAGATCTGCGAATCCCTCCTGCTTATGTTAAAACTTTCCAAGGTCCGCCTCATGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCTGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCACAACCATTTATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGCGAAGAAATGATCAAAAGAGCTGTATTTGCTAGAGAATTGGGCGTTCCGATCGTAATGCATGACTACTTAACGGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCGGTTATTGATAGACAGAAGAATCATGGTATCCACTTCCGGGTATTAGCAAAAGCGTTACGTATGTCTGGTGGAGATCATATTCACTCTGGTAC!
CGTAGTAGGTAAACTTGAAGGTGAAAGAGACATAACTTTGGGCTTTGTTGATTTACTGCGTGATGATTTTGTTGAACAAGATCGAAGTCGCGGTATTTATTTCACTCAAGATTGGGTCTCTTTACCAGGTGTTCTACCCGTGGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACATCCTTGGGGTAATGCGCCAGGTGCCGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTAAAAGCTCGTAATGAAGGACGTGATCTTGCTCAGGAAGGTAATGAAATTATTCGCGAGGCTTGCAAATGGAGCCCGGAACTAGCTGCTGCTTGTGAAGTATGGAAAGAGATCGTATTTAATTTTGCAGCAGTGGACGTTTTGGATAAGTAA
A binary map of the above can be obtained by assigning numerical values to
DNA
nucleotides based on molecular weight where C=00 T=01 A=10 and G=11. The
result
is a 2868-bit binary sequence that is less than twice as large as the
1679-bit
Sagan-Drake CETI message.
10011101001000001000101010001011101110000110101011001010110111010111111001010010101011000111110111010110101011101101100010101001011110000101100101100110000100000111101101100000101010000010101111100110000111100110011001011111001011001001010000111011011010000100000100101000000111111011010100001000000111101011101011001011111111000011001111011011000111000011101001000101000110000111110110001001111110001010000111011001111110000011100111111000010110000010110000010111100100110101100010101011111100111001110001100000110010010011101100110111010111010111111011101010101011100100101001100110010111000101100111011011000101100000000101011011100000010101010111101011101011110101000111010110000010100010011101010110000101000010010111011011110110100011011001010111111101010010101011000000011100110011000100011000110100011111101011100100011100111010010000000100000111000101100111010110101010000101010000101011110100001100000100100111111110010000101011010111101010111011100110101001011110100010101101100!
1111101001101000000000111010111111110011101100001100101101010000001101010010111111111010110010001110001101010101000011000111101101110110001110101011001111010011101000101001100111101111110000101111001010101100000101010111001111001111011101000110111101000010010001010000010010101100111001101011111101110111001001101010100010110010101011101110000111010110010000101011001101010110010001011110001111010100010111101111010100100101010111111001001011000010111101001110001100001110010111101100010011100111010111010100111100100101010101110110001110110010101110001101110111010010111111100110101000011100100110110100111001001111000011000010110100011111111111110010100100000110010101001100001101100010111110001001001011001011100001110111001101001111101000110000101000101001000100100001000001101110010100111001001110011110101100101111001101110001011101011101001001001111101100100001000010100001111110110010110110010101010110011010110001101100111010001111101111110111001001001100101001000010001111101100!
00011011011011011110110101000010111101011110111101010111011100!
01001101
00001010111111100010101110101111001010110000111001101111001111001010101110101111010001010111001001110101101001100111101100101011001010100100001001010111001011111110100010001010110000010111101110101000110000000110111110001010010111110111101100101001000110101011111001001100111000001110001000111100000111011100100010101111111111001111001010000110110000110001011010100111101111110111110100001010110111110001001000001011111111101101001110011000010111101110000110110110001101001001110110110110001000110111010110010011101110110101010110001001101101001111010111110001101111001000101110001001011111010111101101001111010100101100101001100111011110001011100101010011111101100000011111010000110110001110001110001011101111010110110011111101010111011100100110110010101101001010101110010110010110111111000110101010111111001101011011010
Certain flaws that hampered the 1974 Sagan-Drake transmission can be avoided
with a followup transmission. I have found 5 candidate stars currently in
the
Arecibo "window" (AX Micro, GJ 832, LP 816-060, GJ 752A, and GJ 338 gleaned
from Jill Tarter?s and Margaret Trunbull?s list of candidate ?nearby
habitable stellar systems?)
see: http://www.iop.org/EJ/abstract/0067-0049/149/2/423/
I have not yet factored galactic rotation into targeting positions for
selected
stars, but I assume that the nearer they are, the smaller any adjustments
will
be that have to be made. My friends at Cornell have also suggested that
since
our best bet at finding ETI would be ones that are already quite
sophisticated,
targeting infrared sources in our galaxy that have no corresponding optical
object should also be considered. Although I personally remain rather
skeptical
on this point, these objects could be Dyson Shells or other similar ETI
astroengineering projects.
The online data set of the IRAS could be used to identify such sources:
http://irsa.ipac.caltech.edu/IRASdocs/toc.html
I hope that a short message containing the RuBisCo sequence could be
transmitted
during some brief interval between scheduled ongoing use of Arecibo Radar or
that it may coincide with periods set aside for checks and maintenance. I
have
been advised that no special ceremony or event has been planned to mark the
November 16 anniversary.
I am writing you to ask for your recommendation to AO director, Dr. Michael
C.
Nolan, that he seriously consider my request to carry out the proposed
transmission. A transmission of phase-modulated 30hz center-frequency radar
pulses carrying the 2868-bit RuBisCo sequence would take just 4.7 minutes if
the transmitted sequence were to be repeated 3 times to a single star. Given
a
few minutes to reposition the radar between consecutive transmissions, all 5
stars might be targeted in about 40 minutes.
I would also appreciate your referral to anyone else in the
academic/scientific/research community you feel may also be inclined to
recommend this project to Dr. Nolan. I can be reached in Puerto Rico via my
cell phone if you have any questions or suggestions that you think I should
be
aware of.
Thank you for the taking time to consider this request.
Kind Regards,
Joe Davis
---------------------
Joe Davis
MIT 68-233
Cambridge, MA 02139
(617) 258-9299 (lab)
(617) 492-3298 (home)
(617) 852-6658 (cell)
--
Tim Hwang
Twitter: @timhwang
Phone: 973-960-4955
ROFLCon -- roflcon.org
From: awesome-boston group <nor...@googlegroups.com>
Date: Sat, Nov 7, 2009 at 12:34 PM
Subject: awesome-boston - 10 new messages in 4 topics - digest
To: awesome-boston digest subscribers <awesome...@googlegroups.com>
==============================================================================
TOPIC: Fwd: arecibo rec
http://groups.google.com/group/awesome-boston/t/2e9c1faab246a2f1?hl=en
==============================================================================
== 1 of 7 ==
Date: Fri, Nov 6 2009 7:37 am
From: Tim Hwang
Also, the update from Joe Davis. He's wondering if he can get a formal
recommedation from the Awesome Foundation from the Arts and Sciences. I'm
inclined to lend a hand -- thoughts? Figure if there's no serious objections
I can draft one up and get it out to him today.
-Tim
---------- Forwarded message ----------
From: Joe Davis <joed...@mit.edu>
Date: Thu, Nov 5, 2009 at 9:12 PM
Subject: arecibo rec
To: Tim Hwang <t...@timhwang.org>
Tim,
I am disappointed of course, but there is still something you can do to help
and
perhaps your "micro-trustees" may feel inclined to help as well. So, please
forgive me if I a few points are reiterated below. Please see attached pix.
As you know, I am in Puerto Rico to deliver a lecture for UPR's Biology
Colloquium (yesterday at Rio Piedras campus, San Juan). I will be meeting
with
Michael C. Nolan <mno...@naic.edu>, interim director at Arecibo Observatory
in
the next day or so. Today's date happens to fall just short of the 16 Nov
35th
anniversary of the famous Sagan-Drake message for extraterrestrial
intelligence
that was transmitted from Arecibo in 1974.
I am sure you also are aware of the fact that profound underlying poetic and
philosophical implications of the search for extraterrestrial intelligence
have
marked much of my work and career as an artist. In the 1980s, technical
problems
associated with radar and spacecraft carriers inspired me to develop
prototype
bacteriological archives for generic information that could survive for very
long periods of time in the harsh environments of space. That is how a
subject
as vast in scope as the search for extraterrestrial intelligence ultimately
brought me to the study of molecular biology. In 1974, molecular biology was
entering its ?golden age?. Part of the Sagan Drake message was encrypted
with a rudimentary likeness of the DNA double helix. The hereditary role of
DNA
was then well known - as were two of the three principal conformations of
its
molecular structure - but the triplet operation of the genetic code had only
recently been unraveled and modern techniques for DNA sequencing were still
a
few years away. The first genes (DNA) were sequenced in 1977 and the first
recombinant organisms were produced in Herbert Boyer?s laboratory (UCSF) in
1978. While messages were being transmitted to extraterrestrial intelligence
in
1974, no one knew that genetically speaking, human beings are 70% identical
to
tomatoes. There was no genomic science at all.
The point of all this is that I am proposing a new message transmission to
coincide with the anniversary of the Sagan-Drake CETI transmission: All
living
things are made of protein and the most abundant protein on Earth is called
?RuBisCo?(ribulose- 1,5-bisphosphate carboxylase oxygenase). It is actually
quite an interesting protein. To quote Wikipedia, it is ?an enzyme that is
used in the Calvin cycle to catalyze the first major step of carbon
fixation, a
process by which the atoms of atmospheric carbon dioxide are made available
to
organisms in the form of energy-rich molecules such as sucrose.? It is also
interesting in that it actively selects against 13C, one of the naturally
ocurring stable isotopes of atmospheric carbon, in favor of 12C. The
difference
of course, is only a single neutron.
The Gene for the large Rubisco subunit is a 1434-mer DNA molecule:
ATGTCACCACAAACAGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGTGTTAAAGAGTACAAATTGACTTATTATACTCCTGAGTACCAAACCAAGGATACTGATATATTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTATGGACCGATGGACTTACCAGCCTTGATCGTTACAAAGGGCGATGCTACCGCATCGAGCGTGTTGTTGGAGAAAAAGATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACCAACATGTTTACTTCCATTGTAGGTAACGTATTTGGGTTCAAAGCCCTGCGCGCTCTACGTCTGGAAGATCTGCGAATCCCTCCTGCTTATGTTAAAACTTTCCAAGGTCCGCCTCATGGGATCCAAGTTGAAAGAGATAAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCTGTTTATGAATGTCTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCACAACCATTTATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGCGAAGAAATGATCAAAAGAGCTGTATTTGCTAGAGAATTGGGCGTTCCGATCGTAATGCATGACTACTTAACGGGGGGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGTCTACTTCTTCACATCCACCGTGCAATGCATGCGGTTATTGATAGACAGAAGAATCATGGTATCCACTTCCGGGTATTAGCAAAAGCGTTACGTATGTCTGGTGGAGATCATATTCACTCTGGTAC!
CGTAGTAGGTAAACTTGAAGGTGAAAGAGACATAACTTTGGGCTTTGTTGATTTACTGCGTGATGATTTTGTTGAACAAGATCGAAGTCGCGGTATTTATTTCACTCAAGATTGGGTCTCTTTACCAGGTGTTCTACCCGTGGCTTCAGGAGGTATTCACGTTTGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTACTACAGTTCGGTGGAGGAACTTTAGGACATCCTTGGGGTAATGCGCCAGGTGCCGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTAAAAGCTCGTAATGAAGGACGTGATCTTGCTCAGGAAGGTAATGAAATTATTCGCGAGGCTTGCAAATGGAGCCCGGAACTAGCTGCTGCTTGTGAAGTATGGAAAGAGATCGTATTTAATTTTGCAGCAGTGGACGTTTTGGATAAGTAA
A binary map of the above can be obtained by assigning numerical values to
DNA
nucleotides based on molecular weight where C=00 T=01 A=10 and G=11. The
result
is a 2868-bit binary sequence that is less than twice as large as the
1679-bit
Sagan-Drake CETI message.
10011101001000001000101010001011101110000110101011001010110111010111111001010010101011000111110111010110101011101101100010101001011110000101100101100110000100000111101101100000101010000010101111100110000111100110011001011111001011001001010000111011011010000100000100101000000111111011010100001000000111101011101011001011111111000011001111011011000111000011101001000101000110000111110110001001111110001010000111011001111110000011100111111000010110000010110000010111100100110101100010101011111100111001110001100000110010010011101100110111010111010111111011101010101011100100101001100110010111000101100111011011000101100000000101011011100000010101010111101011101011110101000111010110000010100010011101010110000101000010010111011011110110100011011001010111111101010010101011000000011100110011000100011000110100011111101011100100011100111010010000000100000111000101100111010110101010000101010000101011110100001100000100100111111110010000101011010111101010111011100110101001011110100010101101100!
1111101001101000000000111010111111110011101100001100101101010000001101010010111111111010110010001110001101010101000011000111101101110110001110101011001111010011101000101001100111101111110000101111001010101100000101010111001111001111011101000110111101000010010001010000010010101100111001101011111101110111001001101010100010110010101011101110000111010110010000101011001101010110010001011110001111010100010111101111010100100101010111111001001011000010111101001110001100001110010111101100010011100111010111010100111100100101010101110110001110110010101110001101110111010010111111100110101000011100100110110100111001001111000011000010110100011111111111110010100100000110010101001100001101100010111110001001001011001011100001110111001101001111101000110000101000101001000100100001000001101110010100111001001110011110101100101111001101110001011101011101001001001111101100100001000010100001111110110010110110010101010110011010110001101100111010001111101111110111001001001100101001000010001111101100!
00011011011011011110110101000010111101011110111101010111011100!
01001101
00001010111111100010101110101111001010110000111001101111001111001010101110101111010001010111001001110101101001100111101100101011001010100100001001010111001011111110100010001010110000010111101110101000110000000110111110001010010111110111101100101001000110101011111001001100111000001110001000111100000111011100100010101111111111001111001010000110110000110001011010100111101111110111110100001010110111110001001000001011111111101101001110011000010111101110000110110110001101001001110110110110001000110111010110010011101110110101010110001001101101001111010111110001101111001000101110001001011111010111101101001111010100101100101001100111011110001011100101010011111101100000011111010000110110001110001110001011101111010110110011111101010111011100100110110010101101001010101110010110010110111111000110101010111111001101011011010
Certain flaws that hampered the 1974 Sagan-Drake transmission can be avoided
with a followup transmission. I have found 5 candidate stars currently in
the
Arecibo "window" (AX Micro, GJ 832, LP 816-060, GJ 752A, and GJ 338 gleaned
from Jill Tarter?s and Margaret Trunbull?s list of candidate ?nearby
habitable stellar systems?)
see: http://www.iop.org/EJ/abstract/0067-0049/149/2/423/
I have not yet factored galactic rotation into targeting positions for
selected
stars, but I assume that the nearer they are, the smaller any adjustments
will
be that have to be made. My friends at Cornell have also suggested that
since
our best bet at finding ETI would be ones that are already quite
sophisticated,
targeting infrared sources in our galaxy that have no corresponding optical
object should also be considered. Although I personally remain rather
skeptical
on this point, these objects could be Dyson Shells or other similar ETI
astroengineering projects.
The online data set of the IRAS could be used to identify such sources:
http://irsa.ipac.caltech.edu/IRASdocs/toc.html
I hope that a short message containing the RuBisCo sequence could be
transmitted
during some brief interval between scheduled ongoing use of Arecibo Radar or
that it may coincide with periods set aside for checks and maintenance. I
have
been advised that no special ceremony or event has been planned to mark the
November 16 anniversary.
I am writing you to ask for your recommendation to AO director, Dr. Michael
C.
Nolan, that he seriously consider my request to carry out the proposed
transmission. A transmission of phase-modulated 30hz center-frequency radar
pulses carrying the 2868-bit RuBisCo sequence would take just 4.7 minutes if
the transmitted sequence were to be repeated 3 times to a single star. Given
a
few minutes to reposition the radar between consecutive transmissions, all 5
stars might be targeted in about 40 minutes.
I would also appreciate your referral to anyone else in the
academic/scientific/research community you feel may also be inclined to
recommend this project to Dr. Nolan. I can be reached in Puerto Rico via my
cell phone if you have any questions or suggestions that you think I should
be
aware of.
Thank you for the taking time to consider this request.
Kind Regards,
Joe Davis
---------------------
Joe Davis
MIT 68-233
Cambridge, MA 02139
(617) 258-9299 (lab)
(617) 492-3298 (home)
(617) 852-6658 (cell)
--
Tim Hwang
Twitter: @timhwang
Phone: 973-960-4955
ROFLCon -- roflcon.org
--
Mac Cowell
DIYbio.org
p: 231.313.9062
w: has100ideas.com
tw: @100ideas
Reply all
Reply to author
Forward
0 new messages