Synthetic promoters

[Tom Randall]

Just posting this because it was a surprise that the company could not synthesize this sequence. The sequence in question is below, it is a promoter, 1 kb upstream of the histone H1 gene of the ascomycete fungus Neurospora crassa, which I wanted to modify in vivo after re-introducing it back into crassa upstream of a GFP reporter. I sent it to Operon and they could not synthesize it due to some repetitive/simple sequence regions (these regions they noted are also pasted below). they tried for a month. This surprised me because I would think that one DNA element a lot of people would want synthesized are promoters that they can then hook up to a gene of interest, and there are going to be a lot of people working with simple microbes (E cole, yeast, fungi) doing this since they are easier to genetically manipulate and have relatively compact promoters, and all promoters, by their nature, are going to have some structure. I will likey send it to somebody else to try, Epoch has been mentioned in this group, to see if they can do it. Anybody with experience at getting promoters synthesized? It did not really occur to me that this would be an issue, maybe the company just sucks at this. Anybody doing larger synthetic projects has to have run into this issue and overcome it. Part of the problem may be that they thought I was getting a gene synthesized; didnt think to mention it was a promoter but that should not matter as I was not asking them to optimize it in any way.

Sequence:
>UPSTREAM1000_histone H1
TGAAGAAGAGAGATAAATAGATAAATAGAAGATGATGGGATGGGCGAGATACCGACTGAA
TCTGAGAGATGGGATGCGGGATGGATGGATTGATGCCCTGCGGCTTCGATTGTGCCAACC
CAGCCAGCCAGCCAGCCATGCCGACCGACCGACCGATATGCGACATGCCATGCCACCTCA
CACACACAGGCACACTGATAACCTGCGAGTCGACGAGGAGAGGTGACGGGCGGCAGAACA
TGCTTCTTTTGGGGCCAGTGAATGATGCCGTGTCCCACCTTGGATCATCCAATCTGTCCG
GACCAGACTCCATCTGGAATGGACATCCATCGGCATCCGCACTCCCCTGGACCCCAATCG
GTTTCTAAAAAGAGGAGAAACGGAAGAGGAAAAGGGAAAGGGAAAAAAAAAAAGAAGAAC
AAGTGGGATCGATGGGACATGGGACAGCACCACTGCATCTCCAGCCGAGTCCATGGAAAC
GGGAAGACAAGGGGAGGGGGGGGGAGAGGGAGAGGGAGGAGGGGGAAGGGGAAGGAGAAG
GGGATGGGGATGGCGACCGAGAGGATAGGTACCTACTGTAGGGACGGGAAATCTCATCGA
CAACCACACAACGAAGCATCGATGCTCTCGAGGTCTCTTCCCCTTCCTTCATGAGACAAG
CGAAAAGGAAAAGGTCCGGAGCCCCAGCTTCCACATCGTGTTGACATGGAACGAGGGAAC
AGGAATCGGGGCCACTGGCCGGCTTCTTTCGTTCTTTCAGCGTGTGTTAGTGGGGTGCAC
GGGCCACATATCCCCGGGAAATGGGCTGGGGGTAGCGGCTTCCAGGAGGTCACAGAGGCC
CCCCCCCCCAGGTCGCAGGGGGAGACGGGAGGTCCGTCGGGGCAGGGGCAGGGAAGAATC
AGCGAAATCACTCGGTCGCGCCAGGAGACCCCGCCTCCGTATATAAACACCCAATCTTCC
CCCCTCGAGCGCGACTGAGCCCACCCATCCTCCTCTCGTC

Dear Thomas  Randall,

 

Your gene sequence exhibited the following properties:

 

1.     A codon adaptation index (CAI) of 0.75 (typically should be between 1.0–0.8)

2.     GC content of approximately 58.61% (typically should be between 30–70%)

3.     Number of CpG = 59

4.     Percentage of low frequency codons based on an E.coli host organism is 21% (this is decent)

5.     Direct repeats = 8

6.     Negative cis-acting elements = 1

 

All genes submitted to Eurofins MWG Operon for sequencing usually undergo optimization prior to synthesis, so I think your problem is more inherent in the design of your gene. I have asked for a more in depth explanation from the lab on your order failure. Once I get that information I will be better equipped to provide alternative options for your design.

 

 

Pertaining to good bioinformatics gene optimization and design tools, here are a few links:

 

https://www.dna20.com/genedesigner2/    (DNA 2.0 Gene Design Software Beta version – requires an account)

http://www.geneinfinity.org/sp/sp_motif.html#patterns  (Repository of free online servers for performing various sequence screens and comparisons)

http://www.bitgene.com/index.shtml (open source basic gene analysis and synthesis tool)

http://www.geneius.de/GENEius/Security_login.action (Eurofins MWG Operon gene optimization free online tool)

A few days later:

Dear Thomas Randall,

 

Our lab technicians were able to pull up more information pertaining to your gene (please see below). From the query, the gene sequence didn’t seem to have that many regions of complexity to cause the failure observed, so it’s difficult to pinpoint exactly how to improve upon the sequence. It is possible the presence of folding motifs or the GC rich portion interfered with the correct assembly of the gene (we were unable to obtain a clone with the correct gene sequence). Also, there were two ORFs for this gene sequence, so that could have factored in to the ambiguity of the clones.

 

I hope this helps.

 

 

Result

 

Sequence Length
	GC-Content

1014 bps

 

57.99%

 

Direct Repeats

 

Direct Repeat 1

1. Position: 128

2. Position: 132

Length: 15

Mismatches: 0

 

ccagccagccagcca ccagccagccagcca

 

Direct Repeat 2

1. Position: 149

2. Position: 153

Length: 12

Mismatches: 0

 

ccgaccgaccga ccgaccgaccga

 

Inverted Repeats

 

Inverted Repeat 1

1. Position: 623

2. Position: 623

Length: 12

Mismatches: 0

 

agcatcgatgct agcatcgatgct

 

GC-Rich Subsequences

 

Sequence 1

Position: 800

GC-Content: 75%

 

ccccgggaaatgggctgggggtagcggcttccaggaggtcacagaggcccccccccccaggtcgcagggggagacgggaggtccgtcggggcaggggcag

 

Homopolymers

 

Homopolymer 1

Position: 411

Length: 11

 

aaaaaaaaaaa

 

Homopolymer 2

Position: 504

Length: 9

 

ggggggggg

 

Homopolymer 3

Position: 847

Length: 11

 

ccccccccccc

[Nathan McCorkle]

I bet all of these companies are going to tell you similar things, but I would try Sigma Aldrich (they need a commercial address, but Mailboxes Etc gives you this ability at a reasonable monthly price, commercial means a truck can unload on the street basically)... they gave me a great price on some funky 40mers, and we've got a connection here on the list (Ashley...@sial.com I think). Otherwise if you want less corporate there's IDT (they're still a huge company though). I think Epoch sends out their DNA services, I thought they mainly developed the silica and extraction kits. I figure for this, the bigger the company the better, because they're running lots of equipment and have the capacity to try lots of clones without losing too much.

--
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To post to this group, send email to diy...@googlegroups.com.
To unsubscribe from this group, send email to diybio+un...@googlegroups.com.
To view this discussion on the web visit https://groups.google.com/d/msg/diybio/-/z6TXqhV2Ld8J.
For more options, visit https://groups.google.com/groups/opt_out.
 
 

--
Nathan McCorkle
Rochester Institute of Technology
College of Science, Biotechnology/Bioinformatics

[Dakota]

This is pretty neat, if I remember you are the one that payed to get the Neurospora genome sequenced for your own data?

How did you go about chosing these 1014 bps for your synthetic promoter?  I imagine there are multiple promoter sequences, what about an entirely new one?

http://www.broadinstitute.org/annotation/genome/neurospora/GeneDetails.html?sp=S7000006085103696

http://www.broadinstitute.org/annotation/genome/neurospora/GeneNeighborhoodPage.html?sp=kGene%2F7000006085103696

I was just messing around looking at the H1 gene, but I get so lost in genome software and usually quit from frustration.  I just want to see the ssDNA sequence upstream and downstream of that gene but can't figure out how.

Out of curiosity, why are those repeat homopolymers needed?  The cytosine run of 11 bp's in the already rich GC area seems to be something they had trouble with.

Unfortunately I do not have experience with this to offer any help, but it is a pretty sweet project! 

[Tom Randall]

I just picked that sequence since somebody else had used it in a construct as a promoter and it was sufficient to drive expression, cant remember the reference offhand. I dont know why those repeats are needed, or if any detailed promoter bashing of this sequence has been done, likely not. Why they are there? Either they are needed or an evolutionary accident I suppose.

The Broad display of this genome is a bit clunky, but I find it easier to use that the version at Ensembl Genomes, and the UCSC Browser people do not do much support of micro-organisms.

Funny you should ask about the genome, I just put up the current status of that project in a different post, the link is below.

http://www.roningenetics.org/Sequencing.html

[Jeswin]

I don't know much about how companies synthesize oligos so what was
the reason for the failure? Too high GC content and other stability
issues?

I know we did some custom synthesis by PCR for a client since they had
trouble getting the synthesis companies to create it. Maybe you have
to go down that road?

By the way, how much did it cost you for this promoter at Operon?

> --
> You received this message because you are subscribed to the Google Groups
> "DIYbio" group.
> To post to this group, send email to diy...@googlegroups.com.
> To unsubscribe from this group, send email to
> diybio+un...@googlegroups.com.
> To view this discussion on the web visit

> https://groups.google.com/d/msg/diybio/-/gs6iwlRubi0J.

[Tom Randall]

It cost nothing since they could not synthesize it. If I want it I may just PCR it up and clone it the old fashioned way.

[Mackenzie Cowell]

Super Duper interesting.

On their blog about a year ago, Ginkgo Bioworks posted a comparison of Gene Synthesis houses based on the speed they could turn around a synthesis order.  It seemed like some suppliers were fast and cheap, but sensitive to the sequence (i.e. couldn't synthesize some sequences), and others were more expensive and took longer but were more robust with what they could synthesize.

Check out their post and perhaps use it to inform your next choice for your synthesis vendor.  http://blog.ginkgobioworks.com/2012/01/14/commercial-gene-synthesis/.

Keep us informed :)

Mac

To view this discussion on the web visit https://groups.google.com/d/msg/diybio/-/hPTlGKOQwO8J.

For more options, visit https://groups.google.com/groups/opt_out.
 
 

--
+1.231.313.9062 / m...@diybio.org / @100ideas