Multiplexed crispr genome editing

[Mega [Andreas Stuermer]]

Hi everyone,

Just came across something awesome I wanted to share.
Hammerhead ribozymes were actually successfully tried to produce multiple crispr-guide RNAs (the problem with normal mRNAs is that they are exported from the nucleus into the cytosol, but the crispr/cas9 enzyme and the DNA are in the nucleus).

Here's one paper
"Self‐processing of ribozyme‐flanked RNAs into guide RNAs in vitro and in vivo for  CRISPR‐mediated genome editing", from which I take the graphic.

Here one example how it was done:

Promoter (CMV)
tagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctggtttatgaaccgtcagatcc

UTR/RE
gagctc

homolgy site
cgacta

5' Hammerhead Ribozyme (cuts at it's 3' end)
ctgatgagtccgtgaggacgaaacgagtaagctcgtc

targeting gene sequence
tagtcgcgtgtagcgaagca

gRNA scaffold
gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc

whatever (important spacer?)
tttt

3' HDV ribozyme (cuts at the 5' of the ribozyme)
ggccggcatggtcccagcctcctcgctggcgccggctgggcaacatgcttcggcatggcgaatgggac


UTR (from cloning)
cccgggatgctagctaa

polyA
gcgggactctggggttcgaaatgaccgaccaagcgacgcccaacctgccatcacgagatttcgattccaccgccgccttctatgaaaggttgggcttcggaatcgttttccgggacgccggctggatgatcctccagcgcggggatctcatgctggagttcttcgcccaccctagggggaggctaactgaaacacggaaggagacaataccggaaggaacccgcgctatgacggcaataaaaagacagaataaaacgcacggtgttgggtcgtttgttcataaacgcggggttcggtcccagggctggcactctgtcgataccccaccgagacgccattggggccaatacgcccgcgtttcttccttttccccaccccaccccccaagttcgggtgaaggcccagggctcgcagccaacgtcggggcggcaggccctgccatagcctcag


It will be probably a pain for synthesis companies to synthesize, but can save you a lot of (sub)cloning pain and costs are probably similar to getting PCR reagents and primers and stuff. If PCR doesn't even cost more.

You can thus add multiple gRNAs in one big RNA, from one promoter. Like

Promoter--(HH)-gRNA1-(HDV) --spacer--(HH)-gRNA1-(HDV) --spacer--(HH)-gRNA1-(HDV) --spacer--(HH)-gRNA1-(HDV) --spacer-- polyA

Good spacers would probably be like this
ATACTATCAATACTTATCCATCATA
ATTACTTAACCATAATATCTTAACCAT

High in AT - so no interference with ribozymes. Some Cs in it,synthesis companies have local GC content lower limits

[flight505]

Hi Mega

Have you tried your sugested implementation of spacers between the ribozymes? 

Thanks. 

[Koeng]

This works in yeast, except we use HDV instead of hammerhead. Same idea. I haven't tried it myself, however. 

[flight505]

@ Koeng sounds very interesting can you elaborate a bit? do you mean you trim the RNA transcript on both 5´ and 3´ ends with HDV? how as trans-acting ? and multiplexed HDV-RNA-HDV-spacer-HDV-RNA-HDV ?

Best regerds,

[Mega [Andreas Stuermer]]

Hi, personally haven't used it yet. Too much other stuff to do at the moment. Btw there's a new method published which uses a tRNA which is shorter than two ribozymes and spacer

[Koeng]

Yes, multiplexed spacers work. The bigger reason was to get a good RNA on the 5' end which would fold stably so the sgRNA wouldn't degrade. Then there was also the idea of how you could just plop that onto one another and you get a nicely trimmed RNA transcript. The ribozyme only works on it's 5' end

Original transcript

HDV-sgRNA_1-HDV-sgRNA_2-HDV-sgRNA_3-HDV

Processed transcript

HDV-sgRNA_1

HDV-sgRNA_2

HDV-sgRNA_3

From personal observation, it seems like it's easier to just clone them separately then goldengate them together (separate promoters and stuff). If you want to multiplex it, you'll probably just synthesize that construct^ (poor synthesis company)

-Koeng

[BraveScience]

I'm following the discussion with great interest :)

Are there any applications or reasons to use such strategy in prokaryotes?
Besides saving space by removing extra promoter I contact see the potential in organisms without nucleus.

[Koeng]

There's really no reason to use this in prokaryotes because you can use the native spacer repeat system and have that processed correctly. No ribozymes needed!

However, you do need to use it for cells with nuclei because the CRISPR repeats can't be processed correctly. The most important part is apparently the 3' end, which has to have a clean stop.

-Koeng

[flight505]

*mega unfortunately the tRNA method uses pol III promoters as is applicable for my application. My interrest in the ribozyme construct is expression of unmodified gRNA transcript utilizing Pol II promoters. 

Basically all these methods are from around the year 2000 when there was i huge interest in producing RNA transcript for investigating HIV and later similar methods were used in RNAi. Som interesting  reads are - 

General plasmids for producing RNA in vitro transcripts with homogeneous ends, Expression of siRNA from a single transcript that includes multiple ribozymes in mammalian cells.General Acid-Base Catalysis in the Mechanism of a Hepatitis Delta Virus Ribozyme, etc. 

[Mega [Andreas Stuermer]]

But AFAIK it doesn't matter whether it uses polIII or polII. The tRNA processing site is cut, so it cuts away the 5' cap and the polyA tail. Without these features the RNA is not exported from the nucleus into the cytosol. RNA is RNA, doen't make a difference then?

[flight505]

Well i am not disputing you - but in my case the species i am working with lacks well defined polymerase III promoters. Therefore am more interested in methods which would function with pol II promoters. For obvious reasons i dont expect transcription of tRNA by a pol II would function as intended in a eukaryotic cell. 

But can anyone point to a couple of articles substantiation the use of AT rich spacers between the ribozymes? 

Thanks 

[Cathal (Phone)]

> RNA is RNA

*gasp* Everyone who says that ends up dying under suspicious circumstances!

On 23 November 2015 19:00:51 GMT+00:00, "Mega [Andreas Stuermer]" <masters...@gmail.com> wrote:

But AFAIK it doesn't matter whether it uses polIII or polII. The tRNA processing site is cut, so it cuts away the 5' cap and the polyA tail. Without these features the RNA is not exported from the nucleus into the cytosol. RNA is RNA, doen't make a difference then?

--
Sent from my Android device with K-9 Mail. Please excuse my brevity.

[flight505]

hi Koeng, 

Do you have any articles explaining the mentioned spacers between ribozymes? 

thanks

[Koeng]

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4161972/