Translating bacterial DNA into plant DNA

282 views
Skip to first unread message

Mega

unread,
Jun 9, 2012, 12:05:50 PM6/9/12
to diy...@googlegroups.com
Thought it would be best to start a new thread for this.

I had the light producing genes (Lux ABCDE) rewritten by a program to adapt it to Arabidopsis (Codon Bias).


Now I have to add promoter(s), RBS and terminator.

According to this http://bccm.belspo.be/db/lmbp_plasmid_details.php?NM=pJE202 , in the native plasmid there is only one promoter "Vibrio fischeri luxICDABEG operon promoter".
Translating this into plant genes, I just need one promotor for all the genes?? (Virus-Plant promoter, because of strong expression)

When I attach the promoter sequence to the gene segence, does there have to be sapce left or just  add it like ATGTC + AAAA = ATGTCAAAA ??


I think this would be the best promoter available: CLCuMV C1. Does anyone know where to get the sequence from??


thx

Cathal Garvey

unread,
Jun 11, 2012, 7:05:28 AM6/11/12
to diy...@googlegroups.com
Actually, generally Eukaryotes need one-promoter-per-CDS (CDS = "Coding
Sequence). So for each protein coded by the operon, you'll need to
extract the coding sequence, and provide it with its own
promoter/rbs/cds/terminator setup.

Yes, this is unfortunately very costly! It's due to the difference in
how bacteria and eukaryotes start reading mRNA: prokaryotic ribosomes
*assemble* on the RBS, whereas eukaryotic ribosomes first bind the
modified-G at the 5' end of the mRNA, and then travel downstream until
they find an RBS, whereupon they start translating. But, when they hit a
stop codon, they dissociate, so additional CDS's get ignored.

There are so-called "Internal Ribosomal Entry Sites" for Eukaryotes,
usually from viruses. I don't know if there are any for plants, or for
your target species of plant. They are often virus-derived, and may act
as a warning signal to plant innate defence systems. I simply don't
know. If you do find any "IRES" for your plant species in the
literature, it would save you a lot of extra DNA, because you could then
re-design the operon to work as an operon in plants, instead of needing
~8 distinct genes!

Consider however: A lot of the genes in the Lux operon code for proteins
that often work in tight association together. For example, LuxAB form
the actual luciferase, which does the job of digesting mature luciferin
to create light. LuxCDE work to create mature luficerin. I think that
LuxFGH are regulatory genes, LuxI certainly is: You mightn't need these
if you replace them with a plant regulatory signal instead.

If that leaves only LuxAB and LuxCDE, it's possible you can create
"Chimeric Proteins" of these two sets that will still work. Sometimes,
protein chimeras work at a higher efficiency, because the product of one
protein in the chain is ejected in close proximity to the active site of
the next protein in the chain.

To make protein chimeras, simply fuse the CDSs, removing the STOP codon
of the first protein and replacing it with a "spacer stretch" of fairly
boring/neutral, hydrophilic amino acids. Then surround this hybrid CDS
with a Promoter/RBS + Terminator as if it were only one protein.

If all goes well, the two sub-proteins will fold correctly, joined by a
"boring" spacer of inert amino acids, and will work as intended. The
benefit: You've saved a lot of promoter/Terminator DNA. It's even
possible that metabolic chains such as LuxCDE will work even better as
fusions.

On the other hand, the connection of three distinct proteins, each with
their own methods of self-folding, may result in a protein folding
train-wreck which utterly fails to work. In which case, far from saving
money spent on DNA, you've lost all the money spent on your protein
fusion. It's a gamble!

On 09/06/12 17:05, Mega wrote:
> Thought it would be best to start a new thread for this.
>
> I had the light producing genes (Lux ABCDE) rewritten by a program to adapt
> it to *Arabidopsis *(Codon Bias).
>
>
> Now I have to add promoter(s), RBS and terminator.
>
> According to this
> http://bccm.belspo.be/db/lmbp_plasmid_details.php?NM=pJE202 , in the native
> plasmid there is only one promoter "Vibrio fischeri luxICDABEG operon
> promoter".
> Translating this into plant genes, I just need one promotor for all the
> genes?? (Virus-Plant promoter, because of strong expression)
>
> When I attach the promoter sequence to the gene segence, does there have to
> be sapce left or just add it like ATGTC + AAAA = ATGTCAAAA ??
>
>
> I think this would be the best promoter available: CLCuMV C1. Does anyone
> know where to get the sequence from??
>
>
> thx
>

--
www.indiebiotech.com
twitter.com/onetruecathal
joindiaspora.com/u/cathalgarvey
PGP Public Key: http://bit.ly/CathalGKey

Andreas Sturm

unread,
Jun 11, 2012, 2:52:35 PM6/11/12
to diy...@googlegroups.com
I'll be doing it the coward methode.
Promotor-RBS-LuxA-Terminator -- Promotor-RBS-LuxB-Terminator ..... C-D-E

The most expensive it would be that it doesn't work. And one'd have to order it again...



In the database I found all the lux genes. The gene sequnece does not contain promoter nor RBS or terminator if it's just called "LuxA from Vibrio Fischeri strainxxxx"???? Because it does say only "gene" but not "promoter" . So I'm free to just take that seqeunce and attach a good promoter?






 

2012/6/11 Cathal Garvey <cathal...@gmail.com>

--
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To post to this group, send email to diy...@googlegroups.com.
To unsubscribe from this group, send email to diybio+un...@googlegroups.com.
For more options, visit this group at http://groups.google.com/group/diybio?hl=en.


Andreas Sturm

unread,
Jul 2, 2012, 4:28:28 AM7/2/12
to diy...@googlegroups.com
Hey...

>Not sure if you saw but there was a group that already put the lux operon in plant chloroplasts:

Yeah, read about that, some time ago. Even succeded in making contact to Mr. Krichevsky.


Unfortunately I'm not familiar with the 2a peptide sequence.... Have to read about it!!

You mean Promoter --- RBS ---- LuxA ---
2a peptide sequence---- LuxB --- Terminator ??
(Same for Lux C+D+E.)


Sounds good. But, isn't it possible that expression is weakened when using more genes?

How would you translate the Lux genes into plant codon bias? Or would you just leave it as it is (lower expression is sure)?



2012/6/30 kwtaylor3 <kwta...@gmail.com>
Hey Mega,

Nice post!  I've actually been thinking a lot about this as well!

Not sure if you saw but there was a group that already put the lux operon in plant chloroplasts:

Right now, I'm working to get some tools rounded up and protocols for Arabidopsis transformation working.  But one thought I had about cloning out the vibrio lux operon was using the viral 2a peptide sequence (there are several articles about it but here is one:  http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0018556)

While I don't have any experience with the 2a peptide sequence, in theory we could express two (or three!) genes separated by the sequence for the 2a peptide from the same promoter and during translation the 2a peptide sequence would result in two protein products.  So rather than having to transform a plant with the 5 lux genes with 5 promoters etc. we could transform the plant with two or three 'genes'.

If you're interested, I'd be up for collaborating with you!

Thanks,

Kyle
2012/6/11 Cathal Garvey <cathal...@gmail.com>
To unsubscribe from this group, send email to diybio+unsubscribe@googlegroups.com.

For more options, visit this group at http://groups.google.com/group/diybio?hl=en.

--
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To view this discussion on the web visit https://groups.google.com/d/msg/diybio/-/EDpce5Y7YS8J.
Message has been deleted

Mega

unread,
Sep 28, 2012, 5:25:30 AM9/28/12
to diy...@googlegroups.com
Hi, 

I saw that IGEM uses a double terminator sometimes. Does that give you better protein expression?
 

Patrik D'haeseleer

unread,
Sep 28, 2012, 6:45:41 AM9/28/12
to diy...@googlegroups.com
I think it mainly gives you a more reliable termination. Terminators are always "leaky" to some extent. Putting two in a row guarantees you won't get read-through into the next gene downstream, which could cause all sorts of crosstalk in whatever genetic circuit you're designing.

Andreas Sturm

unread,
Sep 28, 2012, 6:49:19 AM9/28/12
to diy...@googlegroups.com
Ok,
Thank you!!  If the termination doesn't work you'll get fusion proteins thus. If you place the other protein in frame, of course. Great.




--
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To post to this group, send email to diy...@googlegroups.com.
To unsubscribe from this group, send email to diybio+un...@googlegroups.com.
To view this discussion on the web visit https://groups.google.com/d/msg/diybio/-/4e9ctWqDRrcJ.

For more options, visit https://groups.google.com/groups/opt_out.
 
 

Patrik D'haeseleer

unread,
Sep 29, 2012, 2:43:07 AM9/29/12
to diy...@googlegroups.com
No, they're *transcriptional* terminators. They're essentially what makes the difference between having an operon with two co-transcribed genes, versus two independently expressed genes in series.

If you made a little genetic circuit with 4-5 genes that all have their own promoter and regulators, last thing you want is for gene B to accidentally get turned on by read-through transcription from gene A because you forgot to put a terminator in between. They essentially insulate one transcriptional unit from another.

It's kinda like when you're deigning a printed circuit board, you have to make sure the copper traces are separated far enough from each other. Because otherwise you might accidentally get some crosstalk between different signals, and the circuit may start to behave in ways you totally hadn't intended.

Andreas Sturm

unread,
Sep 29, 2012, 3:33:05 AM9/29/12
to diy...@googlegroups.com
'Thanks.


Sounds like it's no big deal for the lux genes, when they're all constituvely on.








To view this discussion on the web visit https://groups.google.com/d/msg/diybio/-/9b5SoKAGmpEJ.

Andreas Sturm

unread,
Sep 30, 2012, 4:03:44 AM9/30/12
to diy...@googlegroups.com
That sounds great. But how can you be sure that one plant has gotten all the genes needed?
There are not enough selectable markers, and it's not desireable to have (too much) resistances.




On Sat, Sep 29, 2012 at 11:34 AM, xmort <mor...@ueb.cas.cz> wrote:
re:


Sounds like it's no big deal for the lux genes, when they're all constituvely on.

It is a big deal actually. These so called "aberrant transcripts" are potent elicitors of gene silencing. So the leaky transcription could potentially lead to switching off  both genes. 
From the above suggestions I find the 2A peptide idea the most likely to work. The only drawback is that you will end up with equimolar amount of proteins from each individual transcript, which might or might not be suitable for proper function/regulation. Also the  short 2A peptide will remain attached to C-terminus of the protein , which might affect its function. 
I dont know what is your ultimate goal with the bacterial luc operon  but I would suggest fast and dirty method  which we use in our lab to test expression if mutliple genes in concert  -
1. you make several binary plasmid each expressing one of the genes. that is some cloning, however most of these can be usually done in one step directly from PCR product. 
2. transform  every binary plasmid to agro , so you will end up with six or so individual agro strains.
3. grow all agros in separate tubes
4. measure optical density , mix them all together so that you will have equal (or as desired) amount of each agro in the mix 
5. agroinfitrate the leaves of N. benthamiana, usually we start with suspension of about OD600=2


This way you can easily add / subtract genes t your  mix and to some extent to even modify the ratios of different genes in the mix by simply using more agro. 
Good luck
Tomas

--
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To post to this group, send email to diy...@googlegroups.com.
To unsubscribe from this group, send email to diybio+un...@googlegroups.com.
To view this discussion on the web visit https://groups.google.com/d/msg/diybio/-/YUucJhB6zN8J.

xmort

unread,
Sep 30, 2012, 1:08:48 PM9/30/12
to diy...@googlegroups.com
There is no selection process involved, just statistics. In these transient assays you typically use quite large amounts of agro. With such an overkill pretty much every mesophyl cell which can be transformed really is  transformed. Considerable proportion of these cells get transformed with multiple constructs, quite many with all of them. And you usually dont need the whole leaf or plant to express your genes, several hundred cells per leaf will usually be sufficient. You only need some  suitable assay to detect the positive cells, which in your case should be quite easy due to luminiscence. You might need some sort of microscope though. May be also a digital camera with proper filter set and sufficiently long exposure will do as well.   This is just an quick an dirty method to check, that you have all genes necessary for a particular function and that all of them work in concert in plant environment. Once you are sure about this, you might start putting them all in the plant at once. 
There is one more point to think about - plant cell is quite a lot more complicated than bacterial cell. It might be that some of the metabollites needed for the pathway are in different cell compartments, than you might need to try different sorting signals  on some of your  proteins. Say that gene A might need to be tested in cytoplasm or mitochondria, gene B cytoplasm, ER, golgi or mitochondria and gene C cytoplasm or chloroplast.  It can get to quite a large number of possible combinations relatively easily (16 in above mentioned example).  It is relatively easy to mix different agrobacteria and then choose the best combination as opposed to prepare 16 different megaconstructs. 

xmort

unread,
Sep 30, 2012, 2:07:09 PM9/30/12
to diy...@googlegroups.com


Dne neděle, 30. září 2012 19:08:48 UTC+2 xmort napsal(a):

Mega

unread,
Oct 21, 2012, 8:54:14 AM10/21/12
to diy...@googlegroups.com

I've done some research on this, and now it's for safe: 

So this is the best plant promoter that's known to man (so far). The entire promoter is around 5 to 10 times stronger than 35S, and this fragment is even 5 times stronger than the original (which makes it in total 25 to up to 50 times stronger)!


CLCuMV C1 257 nctd fragment Promoter:

ATTCGTTTAATAGTGGATCCCACATGTTTGAATTTGAAACTTAGTGCGCAAGTACTTATGTGTGCGGGAGCGTTATTTAGCTTTGAGGGAGCAATCTCGTAAATCGGGGGCCCACAAAAAAAAAAGCGCGGCCATCCGGTAATATTATACGGATGGCCGCTTTTTGGAGCGTGAGGATTTTGAAATGATTTCTCAAATTACGATAATGCCATTTGGGGTACACCTATATATTGCACCCCGTTACACCGATTGCCAGA

And attach this as 5' UTR (it includes Kozak I assume)

GAATTAGAGTGTACACCGATTGCCACC


then the gene, of course, and after the gene a terminator like nos terminator (shown to work) or cauliflower mosaic virus 35S terminator. 





Maybe it will be helpful for someone ;) 

At least when gene synthesis gets cheaper. 

shreyans chordia

unread,
Oct 22, 2012, 7:44:37 AM10/22/12
to diy...@googlegroups.com
Hey.
 Initially you posted that you had got the Lux ABCDE rewritten by a program to adapt it to Arabidopsis.  What program did you use to change the codon bias?    
 How can you find out about the quality of this bio-informatics tool you used?

Andreas Sturm

unread,
Oct 22, 2012, 9:27:15 AM10/22/12
to diy...@googlegroups.com

If I remember correctly, wikipedia linked me to a codon bias adapter. It was just a website wwhere you inserted the sequence and it threw out the optimized code. 


If you want, I can look it up how it was called. 

shreyans chordia

unread,
Oct 23, 2012, 4:52:34 PM10/23/12
to diy...@googlegroups.com
Thanks.. found them on wiki.. there are many here.. was wondering which one is accurate out of the lot..

Cathal Garvey

unread,
Oct 24, 2012, 10:45:41 AM10/24/12
to diy...@googlegroups.com
There's codon optimisation, and then there's codon optimisation. I'd advise doing some research into the tools you use before committing to one, when there's money on the line!

For example, most tools out there (which are free to use) are still using the "best pick" method, where they try to use the most common codon as often as possible, while avoiding all the other stuff you've forbidden in the output. This can lead to saturation of the tRNA synthetases that have to recharge the used tRNAs for those codons, which often leads to a bottleneck, delays in translation, and potentially either low or absent gene expression.

In other words, in some (rare) cases, using this codon optimisation method can actually make the gene not express, because your RNA overuses certain codons that get depleted quickly.

Newer methods, which may work better (but your research may dispute this, it's a contentious area), try to "match" codon frequencies instead for the target species, or for subsets of the target species' genes. So if a codon is used 60% of the time in a codon usage table, the resulting gene will be designed to use that codon 60% of the time as well.

That's the format I used when designing PySplicer, but PySplicer is still beta-quality software. For example, it doesn't yet verify that the frequencies in the output match the desired frequency spread within a defined margin, and it doesn't check that local areas of poor frequency codons are absent, stuff like that. It's on my roadmap of desired features.. :)

Just saying: do your research to make sure your codon optimiser isn't using outdated methods!

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diy...@googlegroups.com. To unsubscribe from this group, send email to diybio+un...@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To post to this group, send email to diy...@googlegroups.com.
To unsubscribe from this group, send email to diybio+un...@googlegroups.com.
To view this discussion on the web visit https://groups.google.com/d/msg/diybio/-/Em3pdWKjbjIJ.

For more options, visit https://groups.google.com/groups/opt_out.
 
 

Patrik D'haeseleer

unread,
Oct 24, 2012, 2:42:53 PM10/24/12
to diy...@googlegroups.com
In addition, there are some indications that codon usage may differ between different parts of the plant, e.g. because of differential expression of tRNA synthetases. So you might need to use a different codon profile to get optimal protein expression in seeds versus in the flower.

I've talked to some people who actually do codon optimization for plant engineering, and this wasn't even on their radar yet. We still have a lot to learn about codon optimization in higher eukaryotes, so probably the best advice is to try a couple different encodings and see what works best - if you can afford that, of course...

Patrik

Cathal Garvey

unread,
Oct 25, 2012, 2:14:08 PM10/25/12
to diy...@googlegroups.com
Many companies will do "mutagenesis" for cheap or even free during
synthesis of your DNA: for them, it technically means less work, as the
synthesis process involves a lot of error correction to begin with.

So, provided you don't care about sequence precision (for example,
whether or not your sequence contains restriction sites X, Y or Z), you
could do a project with some mutagenesis baked in, and try a bunch of
mutant variants, or even a heterogenous mix of DNA, and just select the
best variant.
>> On 23 October 2012 21:52, shreyans chordia <shreyans...@gmail.com<javascript:>
>>> wrote:
>>
>>> Thanks.. found them on wiki.. there are many here.. was wondering which
>>> one is accurate out of the lot..
>>>
>>>
>>> On Monday, 22 October 2012 15:27:30 UTC+2, Mega wrote:
>>>>
>>>>
>>>> If I remember correctly, wikipedia linked me to a codon bias adapter. It
>>>> was just a website wwhere you inserted the sequence and it threw out the
>>>> optimized code.
>>>>
>>>>
>>>> If you want, I can look it up how it was called.
>>>>
>>> --
>>> -- You received this message because you are subscribed to the Google
>>> Groups DIYbio group. To post to this group, send email to
>>> diy...@googlegroups.com <javascript:>. To unsubscribe from this group,
>>> send email to diybio+un...@googlegroups.com <javascript:>. For more
>>> options, visit this group at
>>> https://groups.google.com/d/forum/diybio?hl=en
>>> Learn more at www.diybio.org
>>> ---
>>> You received this message because you are subscribed to the Google Groups
>>> "DIYbio" group.
>>> To post to this group, send email to diy...@googlegroups.com<javascript:>
>>> .
>>> To unsubscribe from this group, send email to
>>> diybio+un...@googlegroups.com <javascript:>.
>>> Visit this group at http://groups.google.com/group/diybio?hl=en.
>>> To view this discussion on the web visit
>>> https://groups.google.com/d/msg/diybio/-/Em3pdWKjbjIJ.
>>>
>>> For more options, visit https://groups.google.com/groups/opt_out.
>>>
>>>
>>>
>>
>>
>>
>> --
>> www.indiebiotech.com
>> twitter.com/onetruecathal
>> joindiaspora.com/u/cathalgarvey
>> PGP Public Key: http://bit.ly/CathalGKey<http://letters.cunningprojects.com>

shreyans chordia

unread,
Oct 27, 2012, 12:58:40 PM10/27/12
to diy...@googlegroups.com
Your tips are very helpful.. thank you : )
Actually, right now I'm just researching all the tools used in synbio and hunting for new project ideas. I wish to compete in the iGEM next year.. Could you suggest me some books for researching the tools, or maybe a short list of very important tools useful for gene and protein optimization that i can look-up..  
 
Regards, 
Shreyans   

PS:
all the best with the future versions of PySplicer

Cathal Garvey

unread,
Oct 29, 2012, 1:17:36 PM10/29/12
to diy...@googlegroups.com
Books? I'm not sure. For basic knowledge, Wikipedia is actually quite
good. For methods, openwetware.org is great, but most of the protocols
are written by people with enough resources that they never question
their methods; often, their methods are unnecessarily difficult, or
inefficient, or a waste of resources, so copying them may waste your
time/money/efforts.

For software, I'm not really sure. I'm not yet sure I can endorse
PySplicer (my first PySplicer-designed gene is on its way as we speak, I
hope..), but I'm not sure what else to endorse, either; as I said, many
tools use outdated methods but I haven't checked which one uses which,
or which is reliable. Some companies offer to do gene optimisation for
you for free, and they will probably know more than you about the
process, so perhaps just trust them to do it right?

Are you academically affiliated? If not, iGEM want nothing to do with
you. So if you want to take part, find an academic lab to work with
soon, and start raising the pretty big fee you'll be required to pay...

...or take part in goodiybio.org for free! :)
Reply all
Reply to author
Forward
0 new messages