Designing primers for PCR

[Mega]

Hi everyone,

I'm trying to design primers on my own. but now there are a few questions that Google couldn't answer me. 

a) are primers single stranded DNA or double stranded?

All results from Google don't say anyhing about that. It's just like, everyone who writes thos pages knows, but it is too obvious to be mentioned. 

I would strongly assume they are double stranded? 

b) 

I got Gene 

ATG-AAA-NNNNNNNNNNNNNNNNNN-TTT-TAG

If double stranded Iwould just have to write down the sequence: 

forward primer:

NNNrestriction - ATG - AAA    

reverse primer:

TTT-TAG-NNNrestriction.site 

Correct? (Not considering melting temps yet!)

[Nathan McCorkle]

On Fri, Feb 8, 2013 at 12:47 AM, Mega <masters...@gmail.com> wrote:
> Hi everyone,
>
>
> I'm trying to design primers on my own. but now there are a few questions
> that Google couldn't answer me.
>
>
> a) are primers single stranded DNA or double stranded?
> All results from Google don't say anyhing about that. It's just like,
> everyone who writes thos pages knows, but it is too obvious to be mentioned.

It's explicit when you understand the history (the etymology, where
the name comes from), what comes to my mind is primase and okazaki
fragments...
http://en.wikipedia.org/wiki/Primase
http://en.wikipedia.org/wiki/Okazaki_fragments

" the coding strand is the DNA strand which has the same base sequence
as the RNA transcript produced (although with thymine replaced by
uracil)"

> ATG-AAA-NNNNNNNNNNNNNNNNNN-TTT-TAG

Since mRNA is read from 5' to 3' (5' OH is the terminus of the
'beginning' of the mRNA where the first codon is), then you know they
coding sequence will have 5' before the ATG and 3' after it

>
> If double stranded Iwould just have to write down the sequence:
>

primers are single stranded

> forward primer:
> NNNrestriction - ATG - AAA
>

this would be 5 'NNNrestriction - ATG - AAA 3' (this will prime the
template strand, and polymerase will add nucleotides to the 3' end)


> reverse primer:
> TTT-TAG-NNNrestriction.site

no, you need to change the bases to their pair

5' etis.noitcirtserNNN-CTA-AAA 3'

or

3' AAA-ATC-NNNrestriction.site 5'

--
-Nathan

[Andreas Sturm]

Ok thanks. 

I have thought though that the primers were synthesized double stranded, and at ~ 60 °C they get denatured, so they also divide into two ssDNA. And then do the priming work. 

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diy...@googlegroups.com. To unsubscribe from this group, send email to diybio+un...@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+un...@googlegroups.com.
To post to this group, send email to diy...@googlegroups.com.
Visit this group at http://groups.google.com/group/diybio?hl=en.

For more options, visit https://groups.google.com/groups/opt_out.

[Nathan McCorkle]

On Fri, Feb 8, 2013 at 2:22 AM, Andreas Sturm <masters...@gmail.com> wrote:
> Ok thanks.
>
>
> I have thought though that the primers were synthesized double stranded, and
> at ~ 60 °C they get denatured, so they also divide into two ssDNA. And then
> do the priming work.

Nope, oligos get synthesized one strand at a time. Primer dimers can
form if the forward and reverse primers have enough complementary
sections.

--
-Nathan

[Andreas Sturm]

Ok thank you!!


I tried it with the primer calculator from ncbi, but I want to include a promoter and RBS in the primer (it's gonna get a quite long primer ;) )

What I saw the online program is not capable of doing this. Is there better software?

So the melting point would not really matter right? It's just that the other primer should have similar melting point?

[Dakota Hamill]

Is this going to be used for the glowing plant project?

You could try putting in the Kozak sequence associated with plants, with the start codon, followed by the primer.  

NEB has a good program for primer Tm's

https://www.neb.com/tools-and-resources/interactive-tools/tm-calculator

AACAATGGC was listed on wiki as terrestrial plant consensus sequence.  

This paper also came up on a quick google search but I have no time to read it and the abstract confuses me.  

http://www.ias.ac.in/jgenet/Vol78No2/jg440.pdf

It'll be interesting to see if it works if you ever get it synthesized.  I've never designed my own primers, just taken them out of papers or databases, so it's a lacking skill that would be fun to learn.

Are you hoping to use the primers to help get your insert into your pGreen?

[Koeng]

I like to use SnapGene. Go on their website and get the free trial. It is my all time favorite software for almost anything! It would automatically make the primers from a highlighted sequence, and then you can modify the primer. I highly recommend from primers! Also, a question :). What makes pGreen so special, and so easy to use? 

[Nathan McCorkle]

On Fri, Feb 8, 2013 at 12:47 AM, Mega <masters...@gmail.com> wrote:

> Hi everyone,
>
>
> I'm trying to design primers on my own. but now there are a few questions
> that Google couldn't answer me.
>

Do you know how to use Python? You should probably start messing with
bioPython.... You can spin your own primer design code that way

Here's a good quick overview of the things you need to watch for
during primer design
http://instructional1.calstatela.edu/jmomand2/2004/programming/ppt/chan_ronny.ppt
it says:
Primer length
Melting Temperature
GC content
Hair-pin loop
Self-dimerization
Cross-dimerization

The main thing you need to look at is melting temp calculations:
http://biopython.org/DIST/docs/api/Bio.SeqUtils.MeltingTemp-module.html#Tm_staluc

and this code extends the nearest neighbor Tm calculation with
monovalent ion, Mg2+, dNTP, DNA, and DMSO corrections (references in
the code)
http://pastebin.com/PijkvZr5

here are some primer tools that may or may not be good, I haven't
looked through the code to see, and I haven't tested it:
http://sourceforge.net/projects/pythia/

This bioPython introduction has tutorials on how to use it with
Primer3 (starting around 2/3rd the way through the PDF), all right out
of the box:
http://www.biopython.org/DIST/docs/presentations/biopython.pdf

--
-Nathan

[Iván Esteban Araya]

For me the Gendesigner from DNA 2.0 is the best tool to handle sequences and constructs. With the NCBI databases and tools is enough to get the primers

[Nathan McCorkle]

Whoops, forgot this iGEM code:
https://github.com/russelldurrett/NYC_iGEM/tree/master/Hannah's%20Primer%20Designer/biopython

it looks really bloated (it needs SQL), but maybe you can pull some
stuff from it

--
-Nathan

[Andreas Sturm]

Hi, well for the glowing plant project we get the designs synthesized. 

But in case we need to attach another promoter it would be great to do this like that. Anyways I need to learn how to write primers ;) 

 What makes pGreen so special, and so easy to use? 

Well you heard about agrobacterium transforming plants? You cut your genes of intereset into pGreen, insert pGreen into agrobgacterium. And agrobacterium then transfers the genes of interest into a plant (also in fungus and chloroplasts under special conditions)

[Andreas Sturm]

e.g. here

https://www.neb.com/tools-and-resources/interactive-tools/tm-calculator

GCTCCCCCGCCGCGTTCAATGAGAATGGATAAGAGGCTCGTGGGATTGACGTGAGGGGGCAGGGATGGCTATATTTCTGGGAGCGAACTCCGGGCGAATATGAAGCGCATCGATACAAGTGAGTTGTAGGGAGGGAA-ATGNNN

(Prrn promoter + rbs) 

Results   

Anneal Temp: 72 °C

Primer 1 Tm:  90 °C  Prrn-RBS-ATG

Primer 2 Tm:  90 °C  only Prrn-RBS

Note:

Annealing temperature for experiments with this enzyme should typically not exceed 72°C.

-> So the annealing temperature would still be OK, but the temperature for the primer is too high? IIRC, that one should be in the range of 60°C? 

[Mega]

Hi guys, 

I'm gonna get Primers for bacterial Kanamycin resistance very soon. My long primers are on ice for a few weeks...  

Just wanted to post my design, in case anyone would also need Kanamycin primers one day: 

Foward (RBS included):

5‘ ATAtctagaGaattcggGAggGAGGCatgATTGAACAAgAT 3‘  yellow marked is SalI restriction site, red another as kind of a backup. The blue code is the unchanged 5' ladder, behind that (around -8)  I changed the code into a SD-sequence.

Backward:

3‘ AGAACTGCTCAAGAAGACTCCTAGGATATATAT 5‘ yellow = BamHI

The Kanamycin resistance I'll get from pGreenII  (changed the RBS of plant selection gene nptII that has no introns because of bacterial origin): 

http://www.ncbi.nlm.nih.gov/nuccore/EU048864.1