Issues: How much computing power? And parsing from Bam file question.

[Monica B]

Hi, 

I was wondering how long it would take to run DANPOS on an 8 core, 16GB RAM, SSD, Laptop? Also when I have started to run danpos3 within terminal it shows it parsing through the bam file. Is that normal? Below I have the command I ran and the part of the output it provided: (I have also included the installation process in case something was not installed properly) 

```{bash, python}

##command to call positions in DANPOS where 5872 directory contains Time0h Replicate A and B *.bam files and indexed *.bam.bai files 

python danpos.py dpos ../5892-bam/5872_T0h/                 

##output

danpos 3.0.0  version

command:

python danpos.py dpos ../5892-bam/5872_T0h/

 Namespace(bg=None, clonalcut=0, command='dpos', count=None, distance=100, edge=0, exclude_high_percent=0, exclude_low_percent=0, extend=80, fdr=1, fs=None, gapfill=0, height=5, lmd=300, mafrsz=300, mifrsz=50, name='result', nonzero=0, nor='F', nor_region_file=None, paired=0, path='../5892-bam/5872_T0h/', pheight='0', position_reference=None, ratio=0.9, save=0, separator1=None, smooth_width=20, span=10, testcut='0', width=40)

rd 100 , step 10  fcut, 54.49770637375484

parsing from Bam file ../5892-bam/5872_T0h/5872-MB-1.hg19.F4q10.sorted.bam ...

A00758:146:HTLYVDSXY:4:1630:29161:32863 99 0 10358 15 69M1I81M 0 10379 151 ACCCTAACCCTAACCCTAACCCTAACCCTAAACCCTAAACCCTAACCCTAACCCTAACCCTAACCCTAACCCCTAACCCCTAACCCTAACCCTAACCCTAACCCTAACCCTCGCGGTACCCTCAGCCGGCCCGCCCGCCCGGGTCTGACCT array('B', [37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 11, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 11, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 37, 25, 37, 37, 37, 25, 37, 37, 37, 37, 37, 37, 11, 37, 11, 11, 37, 37, 37, 25, 37, 37, 37, 25, 37, 37, 37, 25, 37, 37, 37, 11, 37, 37, 37, 37, 25, 37, 37, 37, 37, 25]) [('AS', -31), ('XS', -65), ('XN', 0), ('XM', 5), ('XO', 1), ('XG', 1), ('NM', 6), ('MD', '31C6C39T0A1C68'), ('YS', -28), ('YT', 'CP')]

A00758:146:HTLYVDSXY:4:1630:29161:32863 147 0 10379 15 48M1I102M 0 10358 151 CTAACCCTAAACCCTAAACCCTAACCCTAACCCTAACCCTAACCCTA

```

Here is how I installed danpos3 

```{bash, python}

##installing DANPOS

pip install -r requirements.txt

##OUTPUT after installation

Requirement already satisfied: rpy2==3.3.3 in /Users/monicabomber/opt/anaconda3/lib/python3.7/site-packages (from -r requirements.txt (line 2)) (3.3.3)

Requirement already satisfied: numpy==1.18.5 in /Users/monicabomber/opt/anaconda3/lib/python3.7/site-packages (from -r requirements.txt (line 4)) (1.18.5)

Requirement already satisfied: pysam==0.16.0.1 in /Users/monicabomber/opt/anaconda3/lib/python3.7/site-packages (from -r requirements.txt (line 5)) (0.16.0.1)

Collecting argparse==1.1

  Using cached argparse-1.1-py3-none-any.whl

Requirement already satisfied: pytz in /Users/monicabomber/opt/anaconda3/lib/python3.7/site-packages (from rpy2==3.3.3->-r requirements.txt (line 2)) (2020.5)

Requirement already satisfied: tzlocal in /Users/monicabomber/opt/anaconda3/lib/python3.7/site-packages (from rpy2==3.3.3->-r requirements.txt (line 2)) (2.1)

Requirement already satisfied: pytest in /Users/monicabomber/opt/anaconda3/lib/python3.7/site-packages (from rpy2==3.3.3->-r requirements.txt (line 2)) (0.0.0)

Requirement already satisfied: jinja2 in /Users/monicabomber/opt/anaconda3/lib/python3.7/site-packages (from rpy2==3.3.3->-r requirements.txt (line 2)) (2.11.2)

Requirement already satisfied: cffi>=1.10.0 in /Users/monicabomber/opt/anaconda3/lib/python3.7/site-packages (from rpy2==3.3.3->-r requirements.txt (line 2)) (1.14.4)

Requirement already satisfied: pycparser in /Users/monicabomber/opt/anaconda3/lib/python3.7/site-packages (from cffi>=1.10.0->rpy2==3.3.3->-r requirements.txt (line 2)) (2.20)

Requirement already satisfied: MarkupSafe>=0.23 in /Users/monicabomber/opt/anaconda3/lib/python3.7/site-packages (from jinja2->rpy2==3.3.3->-r requirements.txt (line 2)) (1.1.1)

Requirement already satisfied: attrs>=19.2.0 in /Users/monicabomber/opt/anaconda3/lib/python3.7/site-packages (from pytest->rpy2==3.3.3->-r requirements.txt (line 2)) (20.3.0)

Requirement already satisfied: iniconfig in /Users/monicabomber/opt/anaconda3/lib/python3.7/site-packages (from pytest->rpy2==3.3.3->-r requirements.txt (line 2)) (1.1.1)

Requirement already satisfied: packaging in /Users/monicabomber/opt/anaconda3/lib/python3.7/site-packages (from pytest->rpy2==3.3.3->-r requirements.txt (line 2)) (20.8)

Requirement already satisfied: pluggy<1.0.0a1,>=0.12 in /Users/monicabomber/opt/anaconda3/lib/python3.7/site-packages (from pytest->rpy2==3.3.3->-r requirements.txt (line 2)) (0.13.1)

Requirement already satisfied: py>=1.8.2 in /Users/monicabomber/opt/anaconda3/lib/python3.7/site-packages (from pytest->rpy2==3.3.3->-r requirements.txt (line 2)) (1.10.0)

Requirement already satisfied: toml in /Users/monicabomber/opt/anaconda3/lib/python3.7/site-packages (from pytest->rpy2==3.3.3->-r requirements.txt (line 2)) (0.10.1)

Requirement already satisfied: importlib-metadata>=0.12 in /Users/monicabomber/opt/anaconda3/lib/python3.7/site-packages (from pytest->rpy2==3.3.3->-r requirements.txt (line 2)) (2.0.0)

Requirement already satisfied: zipp>=0.5 in /Users/monicabomber/opt/anaconda3/lib/python3.7/site-packages (from importlib-metadata>=0.12->pytest->rpy2==3.3.3->-r requirements.txt (line 2)) (3.4.0)

Requirement already satisfied: pyparsing>=2.0.2 in /Users/monicabomber/opt/anaconda3/lib/python3.7/site-packages (from packaging->pytest->rpy2==3.3.3->-r requirements.txt (line 2)) (2.4.7)

Installing collected packages: argparse

Successfully installed argparse-1.1

```

[Monica B]

(base) monicabomber@monicas-mbp 5872_DANPOS %  python print_versions.py

Python version

3.7.6 (default, Jan  8 2020, 13:42:34) 

[Clang 4.0.1 (tags/RELEASE_401/final)]

-------------------------------------------------

R version 4.0.3 (2020-10-10) -- "Bunny-Wunnies Freak Out"

Copyright (C) 2020 The R Foundation for Statistical Computing

Platform: x86_64-apple-darwin17.0 (64-bit)

R is free software and comes with ABSOLUTELY NO WARRANTY.

You are welcome to redistribute it under the terms of the

GNU General Public License versions 2 or 3.

For more information about these matters see

https://www.gnu.org/licenses/.

0

-------------------------------------------------

samtools 1.10

Using htslib 1.10

Copyright (C) 2019 Genome Research Ltd.

0

-------------------------------------------------

AVAILABLE python packages:

argparse: 1.1

numpy: 1.18.5

rpy2: 3.3.3

pysam: 0.16.0.1

[David Castillo Rodríguez]

I was getting similar logs as you, regarding this:
parsing from Bam file ...

I then added the --paired 1 tag to the command (as my library is paired-end) and the parsing issue disappeared. I ran into a new problem though: https://groups.google.com/g/danpos/c/dPxLBr_g6Bc  

Let me if this helps you and if you ran into the same problem as I do.

Cheers!