@SN1001:449:HGTN3ADXX:1:1101:1046:1930 2:N:0:2
CCGCCATCCCCGAATCCGGAGTGGCGGAGATGGGCGCCGCGAGGCGTCCCG
+
FFFFFFFFIIFFIIFFFFIIII<BBFFFI7BBFB<B'07'0077''
The length of qualities indeed 5 bases less than the sequence...
Thank you!
--
You received this message because you are subscribed to the Google Groups "CTK User Group" group.
To unsubscribe from this group and stop receiving emails from it, send an email to ctk-user-grou...@googlegroups.com.
To view this discussion on the web visit https://groups.google.com/d/msgid/ctk-user-group/d4a532f3-86dc-4b94-80aa-9f398cb89269n%40googlegroups.com.