Gecko Library Sequencing Primer for 1st round PCR

[Sung]

Hello

I'm using 1 vector lentiCRISPR gecko human library.

I'm now trying to amplify genomic DNA for Miseq.

I found the primer sequences from 2014 Science paper (Genome-scale CRISPR-Cas9 knockout screening in human cells).

 

According to the paper

F1 is AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG and this primer binds to U6 promoter region.

R1 is CTTTAGTTTGTATGTCTGTTGCTATTATGTCTACTATTCTTTCC and this primer binds to upstream of U6 promoter.

Based on this primer information, R1 is upstream of F1 and PCR product would not be synthesized.

Maybe I misunderstood the information, please let me know the primer sequences that I need to use for 1st and 2nd PCR to amplify for the Miseq.

Have a great day!

[Neville Sanjana]

Hello.... are you using the original GeCKO library (Science paper) or the v2 library (Nature Methods paper)? The original library (Science) is cloned into lentiCRISPRv1 and the v2 library (Nature Methods) is cloned into lentiCRISPRv2 (one vector) and lentiGuide-Puro (two vector).

--
You received this message because you are subscribed to the Google Groups "Genome Engineering using CRISPR/Cas Systems" group.
To unsubscribe from this group and stop receiving emails from it, send an email to crispr+un...@googlegroups.com.
For more options, visit https://groups.google.com/d/optout.

[Sung]

Hello Neville

I really appreciate your quick response.

I used the v2 library(one vector).

Have a great day!

Sung

2015년 4월 21일 화요일 오전 6시 6분 2초 UTC+9, Neville Sanjana 님의 말:

[Neville Sanjana]

Hi Sung,

For PCR#1, please use the following primer pair for libraries in the lentiCRISPRv2 (one vector) system:

v2Adaptor_F	AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG
v2Adaptor_R	TCTACTATTCTTTCCCCTGCACTGTtgtgggcgatgtgcgctctg

The reverse primer adds a priming site so that you can use the same PCR#2 primers as published with the Science paper and found on our website (see item 3): http://genome-engineering.org/gecko/?page_id=15

Hope that helps,

Neville 

[Sung]

Hello Neville

Thank you so much detailed information.

Have a great day!

Sung

2015년 4월 21일 화요일 오후 11시 30분 3초 UTC+9, Neville Sanjana 님의 말:

[Fuming Li]

Hi Neville,

I tried PCR#1 with the primers above using Phusion HIGH-FIDELITY PCR MASTER MIX WITH HF BUFFER (M0531S, NEB) at 60, 63, 63 and 68 0C, but always failed with a specific 260bp band even from normal genomic DNA template. Could you please tell me the specific amplification condition using the PCR#1 primer pair for libraries in the lentiCRISPRv2 (one vector) system, thanks!  

在 2015年4月21日星期二 UTC-4下午12:51:14，Sung写道：

[Neville Sanjana]

Hi Fuming,

Sorry to hear about your difficulties with the PCR. I haven't used that exact polymerase but I recommend optimizing the amount of genomic DNA put into the reaction. 

We find typically that an annealing temperature of 60C works well (using both Herculase2 and PhusionFlash). In general, the Phusion enzymes seem to be more biased than other enzymes, such as Herc2, Q5/NEBNext, Kapa HiFi, or even standard Taq. I recommend using one of those enzymes.... In addition, with Herc2 and with Taq, we've found that we can use quite a lot more gDNA in our PCR reaction.

Best,

Neville

[Gauri]

Hi Fuming,

Try PCR 1 and 2 using GC buffer. I had the same issues with HF buffer but using GC buffer solved the problem.

hope it works in your case as well

Best

Gauri

[Fuming Li]

Hi Gauri,

Sorry to bother again. I followed your protocol to try amplification using GC buffer. When I amplified for 35 cycles, I could still detect a sharp band of similar size from negative control human or mouse genomic DNA. When I lowered to 24 cycles, the band was undetectable. This issue has been bothering me for a month. I have changed all the reagent to exclude potential contamination. Did you see such band at 24> cycles  in negative controls? 

Many thanks!

Best

Fuming

在 2015年9月25日星期五 UTC-4上午11:41:13，Gauri写道：

[taram....@gmail.com]

Did you ever figure out why you had a similar size band in your negative control?

[Ifrah Shahi]

Hi Fuming,

I'm having the same problem, I run PCR1 for 16 cycles and then PCR2 for 24 cycles, and see a band of similar size in mouse genomic DNA control sample. My water control lane however is always completely clear, so I'm not sure if this is even contamination. I'm wondering if you ever figured out why you were getting the band in your genomic DNA control?

Best,

Ifrah

On Thursday, October 8, 2015 at 1:10:45 PM UTC-4, Fuming Li wrote: