The Sequencing primer of LentiCRISPR V2 listed on Addgene are wrong.

[Hui Zhao]

Dear Professor Zhang lab members:

I think the sequencing primers of LentiCrisprV2 listed on Addgene are "wrong." Those primers, hEF1aprom-F, Wpre-R and Puro-F2, WPRE-R are all locate down stream of the cloning site of target sequences and would not sequence the inserted sequence. 

I have used the hU6 promoter sequencing primer from Addgene and have got excellent results (LKO.1 5’: GACTATCATATGCTTACCGT (Weinberg Lab)). 

May you please contact Addgene to input the correct sequencing primers?

Many thanks!

Hui Zhao

[Eric Perkins]

As one of the Addgene scientists responsible for Zhang lab web pages, I just wanted  to make a quick clarification on those primers. Since there is no gRNA in the empty vector, there are no sequencing primers suggestions for that region. The primers you see are for the gene inserts that already exist within the plasmid: Cas9 and Puro. If you click on the "View Sequences" link on the lentiCRISPRV2 page, you'll see that we also sequenced the gRNA insert region with an hU6-F (5'-GAGGGCCTATTTCCCATGATT-3') primer. As you mentioned, LKO.1 will also work.

I cannot remove or change those primer suggestions because, technically, they are correct. The constraints of our data entry form and the nature of this plasmid render the information a little confusing, but it's not actually wrong. I am going to add a note in the comments section of the plasmid explaining what primer to use to sequence the BsmBI region so scientists can check their own gRNA inserts.

Best,

Eric

[lif...@gmail.com]

Dear Eric,

I just have some problem for the sequencing data of the LentiCRISPRv2 constructs with primer hU6-F (5'-GAGGGCCTATTTCCCATGATT-3'). The sequencing results usually include the regions (such as 2640-2853, 12323-13000 in the vectors). My question is why there is a big gap for the sequencing data? Is there any special condition for the sequencing? Thank you very much.

Bests,

Jasen  

在 2014年7月16日星期三 UTC-4下午2:42:52，Eric Perkins写道：

[Neville Sanjana]

Dear Jasen,

The hU6-F primer is designed to sequence the sgRNA cassette after a specific 20bp guide sequence has been cloned in. Please see our oligo cloning protocol here: http://bit.ly/gecko-protocols

You can of course design other primers to sequence other regions of the vectors. The only parts of the vector that are tricky to sequence are the lentiviral LTRs. For these, I recommend asking your sequencing company to see if they have a special protocol for regions with secondary structure. It might be easiest to check the integrity of the vector just by restriction digest.

Good luck!

- Neville

--
You received this message because you are subscribed to the Google Groups "Genome Engineering using CRISPR/Cas Systems" group.
To unsubscribe from this group and stop receiving emails from it, send an email to crispr+un...@googlegroups.com.
For more options, visit https://groups.google.com/d/optout.