Sequencing Primers

[bxia...@gmail.com]

Hi, 

I am new to Crispr, and I am having some trouble understanding your sequencing primers published in the nature protocols paper. There are 10 forward primers. For example, the sequence of NGS-Lib-Fwd-1 is: 

5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTACGATCGATGGTCCAGAGCTTTATATATCTTGTGGAAAGGACGAAACACC 3'

If I understand it correctly, the 5' region (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT) is illumina TruSeq adapters and the 3' region maps (GCTTTATATATCTTGTGGAAAGGACGAAACACC) to the vector. The middle region (in this case, TAAGTAGAG) region is a variable region (ranging from a length of 9 base pairs to 19 base pairs) containing a variable region to increase complexity and a barcode, correct? Which is the barcode in each of the forward primers? 

Additionally, in the protocol, it states to use a different reverse primer for each library. Does this mean, we will run 10 PCR reactions with each of the 10 forward primers and NGS-Lib-KO-Rev-1 for gecko library A and 10 PCR reactions for each of the 10 forward primers and NGS-Lib-KO-Rev-2 for gecko library B. That will be 20 reactions total which will then be combined to run on a single lane of an illumina flow cell, right? 

Thanks for your help! 

[Julia Joung]

Hi,

I have attached a spreadsheet that indicates the function of each primer region for the NGS primers in the Nature Protocols paper. Hope this helps clarify how the primers were designed. The forward primers do not contain barcodes.

Yes you will need to run 10 PCR reactions with each of the 10 forward primers and 1 reverse primer to increase the diversity of the NGS library.

Best,

Julia

On Tue, Oct 17, 2017 at 3:16 PM, <bxia...@gmail.com> wrote:

Hi, 

I am new to Crispr, and I am having some trouble understanding your sequencing primers published in the nature protocols paper. There are 10 forward primers. For example, the sequence of NGS-Lib-Fwd-1 is: 

AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTTAAGTAGAGGCTTTATATATCTTGTGGAAAGGACGAAACACC

If I understand it correctly, the red region are illumina TruSeq adapters and the orange region maps to the vector. The black region is a variable region (ranging from a length of 9 base pairs to 19 base pairs) containing a variable region to increase complexity and a barcode, correct? Which is the barcode in each of the forward primers? 

Additionally, in the protocol, it states to use a different reverse primer for each library. Does this mean, we will run 10 PCR reactions with each of the 10 forward primers and NGS-Lib-KO-Rev-1 for gecko library A and 10 PCR reactions for each of the 10 forward primers and NGS-Lib-KO-Rev-2 for gecko library B. That will be 20 reactions total which will then be combined to run on a single lane of an illumina flow cell, right? 

Thanks for your help! 

--
You received this message because you are subscribed to the Google Groups "Genome Engineering using CRISPR/Cas Systems" group.
To unsubscribe from this group and stop receiving emails from it, send an email to crispr+unsubscribe@googlegroups.com.
To post to this group, send email to cri...@googlegroups.com.
For more options, visit https://groups.google.com/d/optout.

[Elkholi]

Hi Julia,

I have a couple of questions about the primers' sequence, please. First, regarding the priming site, I noticed that you added in the recent protocol the following sequence (GCT TTA TAT ATC) to the priming sequence (TTG TGG AAA GGA CGA AAC  ACC) posted in the older protocols, is that for a specific reason? Also, the older protocol's priming site was ending with a "G" which is removed from the recent one..

In a screening-independent experiment, I used the golden gate as you described in the protocol to insert sgRNAs in the backbone of the SAM system. After sequencing those vectors with the U6 Fwd, I found my sequences inserted directly after U6 promoter at the base 242 (starting with the "CACC overhang"), however, the GAA bases (which are supposed to precede the CACC overhang as simulated by SnapGene Restriction Cloning tool) are after the insert not before! This was consistent in five different clonings. So if this is the case with how the library's vectors are, the last 8 bases of the priming site (GAAA CACC) of the designed primers wouldn't match. If not, and the problem is the golden gate experiment, I'm not sure what could have gone wrong with the method. I used the recommended reagents and the empty backbone was verified by Sanger sequencing. 

Many thanks in advance,

Islam 

To unsubscribe from this group and stop receiving emails from it, send an email to crispr+un...@googlegroups.com.

[Julia Joung]

Please see my response to your "Primers for sequencing the SAM and GeCKO libraries" thread!

Julia

To unsubscribe from this group and stop receiving emails from it, send an email to crispr+unsubscribe@googlegroups.com.