good sequencing primer for pX330 and pX335

[Lance Lian]

Hello everyone,

Do you guys have a good sequencing primer for pX330 (pX335)? Thanks a lot.

Lance

[Lance Lian]

the sequencing primer is used to detect whether the target sequence has been cloned in to pX330.

[Le Cong]

Hi Lance,

Please use the U6 promoter primer as listed below (the same one I used for sequencing my construct):

Human U6 Seq F_Insert: ACTATCATATGCTTACCGTAAC

We will update this sequence in our website shortly. Also there are easier restriction digestion checking method that is on our website: crispr.genome-engineering.org.

Best,

Le

-

Le CONG 丛乐

Harvard University/Harvard Medical School
HHMI International Fellow

Tel: (+1) 617-823-6132
E-Mail: congl...@gmail.com / co...@fas.harvard.edu

--
You received this message because you are subscribed to the Google Groups "Genome Engineering using CRISPR/Cas Systems" group.
To unsubscribe from this group and stop receiving emails from it, send an email to crispr+un...@googlegroups.com.
For more options, visit https://groups.google.com/groups/opt_out.
 
 

[xam...@gmail.com]

Hello Le,

If this has been addressed in the past I appologize, but I was wondering why you chose this specific primer for sequencing. It has a very low G\C content and Tm.

Thank you in advance for your input.

Yonatan

[Le Cong]

Hi Yonatan,

There was no specific region for choosing this primer, we usually just go upstream of the target insert region 20-50bp and pick a 20-24nt sequence. The GC content was essentially a result from the low GC of U6 promoter, if you check it's around 30%.

I personally also likes to use primers that has 3' GC, but this is not even necessary I think, given the tolerance and robustness of current sequencing technology with typical sequencer or any of the major sequencing service provider. 

-

Le CONG 丛乐

Harvard University/Harvard Medical School
HHMI International Fellow

Tel: (+1) 617-823-6132
E-Mail: congl...@gmail.com / co...@fas.harvard.edu

[agnas]

Dear Dr. Cong,

        Does the restriction digestion you are referring to (NdeI I suppose) work with pX330. When I checked I found a difference of 2 nucleotides with and without insert, unlike pX260 where the difference is ~ 16nt

Thank you.

[dosu74]

Me too I had problem using Nde I to check the cloning in pX330.

Instead, I found practical doing a colony-PCR using the U6 promoter primer (AAACGCCATTCGGAGGAGCCCGCC) as forward and the reverse complement oligo of the target region to clone as reverse primer (the product should be a 101bp amplimer). Empty pX330 can be used as negative control.

Andrea

[Parwez Alam]

Hi Lian,

I designed my own primers across the BbsI (gRNA cloning site) from px330 sequence.  These primers were not so far, like U6 primer, and gave very good results for sequencing. Since the gRNA insert is only 20bp its not easy to distinguish positive clones from the negative clones (without insert) by doing colony PCR across cloning site. Therefore i used one ologo from the target sequence in combination with one flanking primer for colony PCR. You will get a product only from positive clones. It has worked for me.

Hope this is helpful.

Parwez

On Wednesday, April 24, 2013 5:45:27 PM UTC-4, Lance Lian wrote:

[Tang Fulei]

Thanks Andrea, but I can not find the "U6 promoter primer (AAACGCCATTCGGAGGAGCCCGCC)" in the backbone of PX330.

在 2013年8月28日星期三UTC-4上午4时37分14秒，dosu74写道：

[Le Cong]

Hi Fulei,

I think the U6 promoter primer Andrea provided is indeed not in the vector, I think he probably pasted his reverse primer that is specific for his guide spacer. I think you could just use any forward primer within the U6 promoter that gives you a reasonable PCR product for colony screening, like this one here. U6-forward: TTCCCATGATTCCTTCATATTTGC.

Also I think the NdeI method works for me as I was using a 2% EX E-gel that could resolve between the band size difference between cloned and empty vectors. But it is not as sharp as other method provided by people, like colony PCR, or other larger-difference digestion 

Best,

Le

-

Le CONG 丛乐

Harvard University/Harvard Medical School
HHMI International Fellow

Tel: (+1) 617-823-6132
E-Mail: congl...@gmail.com / co...@fas.harvard.edu

[Xiaozhi Ren]

Hi Parwez,

Thanks for your suggestion, do you have the sequence for flanking primer?  I also want use your method to do colony screening.

Thanks

Xiaozhi