Cannot introduce silent mutation in PAM site of ssODN HDR template

[Donna]

Hello,

I am planning to use the double nickase system to introduce a point mutation into my gene of interest, as described by Ran et al. (2013). The CRISPR design tool identified 2 pairs of appropriate guide sequences that flank the mutation site, resulting in a 5'overhang and appropriate offset, with the Guide B sequence being the same for both pairs. I have a problem with my ssODN HDR template because I cannot introduce a silent mutation into the guide B PAM site because it lies across a methionine (ATG), and an Ala (GCT) (I must mutate the G to ablate the PAM site and all of the other Ala codons start with a G). If understand correctly, one must introduce silent mutations into the PAM sites to prevent the Cas9n enzyme cleaving the the newly inserted oligo.

My ssODN is listed below (sense strand), with the point mutation highlighted in yellow and the PAM sites highlighted in red. I have already introduced a silent mutation in the 5' PAM site (cct to act) but, as I mentioned, I can't mutate the 3' PAM site without introducing a missense mutation. Does anyone have any suggestions? Go ahead without mutating the PAM site; design other primers by eye and ignore the offset rule? The other guide sequences that the CRISPR design tool suggests do not excise the sequence that encompasses my point mutation.

5'-ctcctggcacaaggaaaaattgtgaagatctgtgactttggactggccagagtcatcatgcatgattcgaactatgtgtcgaaaggcagtacctttctgcccgtgaagtggatggctcctgagagcatctttgacaacctctacaccacac-3' 

Many thanks!

Donna

[Eric Deneault]

Hi Donna,
Given that your ssODN is sens strand, you don't need to introduce a silent mutation in PAM of guideB, as guideB cuts only anti-sens strand. You only need to introduce a silent mutation in PAM of guideA, which cuts only sens strand. It would be the inverse if you were to use an anti-sens ssODN.
Eric

[Donna]

Hi Eric,

Thanks for your reply. I am a little confused. I thought that after the ssODN was incorporated into the target site and repair was complete both the guide A and guide B PAM sites could be targeted by Cas9n, or will the cells have lost expression of the enzyme by this point? Sorry, I'm sure I'm missing something, but it's not entirely obvious to me.

In response to my original post, someone pointed out that I can introduce silent mutations into the guide recognition sequence to prevent Cas9n cleaving the newly inserted oligo. 

This is an interesting read: Masafumi et al 2014 Rapid generation of mouse models with defined point

mutations by the CRISPR/ Cas9 system. Sci Rep. Jun 23;4:5396.

Best,

Donna

[gingras....@gmail.com]

Hi Donna,

To prevent cleavage of the modified sequences there are two option.

1- mutation of PAM sequences

2- introduction of silence mutations in the guide sequence adjacent to the PAM. (4 mismatches should be more then enough to prevent cleavage).

Does not matter if if WT Cas9 or Nickase...

Sebastien

[Donna]

Thanks Sebastien!

[Eric D.]

in your case introduce a silent mutation only in PAM of guideA, then after repair is complete, guideB can be still targeted by Cas9n however this will be considered as a nick only and not as a DSB,

Eric

[Donna]

Thanks Eric--I completely overlooked that a single-stranded nick should be re-ligated without any further alteration to the genome.

[Meribur]

I have a similar problem- cannot mutate neither of my PAM sequences. I introduce silent point mutations in the repair template, where the guides bind, will this do a trick? The problem is that one of the guides binds 62-39 bases away from the desired mutation. Since the homology arms are only 50 nt , I am worried that there is a chance that the genomic DNA recombines in regions between the desired and silent mutations..

[Sebastien Gingras]

3 silent mutations in the target sequence close to PAM will work just fine. I have done it many time. 

For the ssODN use a 200 bp ultramer page-purified from IDT, so you can have longer homology arm. 

You may want to center it midway between your mutation an cut site. 

Sebastien 

Sent from my iPhone.

--
You received this message because you are subscribed to a topic in the Google Groups "Genome Engineering using CRISPR/Cas Systems" group.
To unsubscribe from this topic, visit https://groups.google.com/d/topic/crispr/dEg4FhconOo/unsubscribe.
To unsubscribe from this group and all its topics, send an email to crispr+un...@googlegroups.com.
For more options, visit https://groups.google.com/d/optout.