Universal negative control for CRISPR/Cas systems

[guus86va...@gmail.com]

Dear All,

 

For the genomic knock-out of primary cells I have succesfully used the LentiCRISPRv2 plasmid (>90% efficiency when I use 400 ng lenitivirus on 100k cells). As a negative control I intended to use the original Stuffer construct, however merely over-expressing the Cas9 protein is not a very nice control for the enormous amount of DNA breaks that are introduced in my knock-out cells.

 

Preferably I would like to use a scrambled control or gRNA targetting GFP. To my dismay I find published articles with this LentiCRISPR construct where people compare the KO cell clones with the original heterogenous cell pool as a control. Are there any published scrambled control sequences? I noticed Santa Cruz sells a universal negative control, but the sequence is off course not mentioned...

 

What is you opinion on proper negative controls for CRISPR/Cas9 genome editing?

 

Kind regards,

 

Guus

[Explorer]

Here is the scrambled sequence from OriGene

5’ GCACTACCAGAGCTAACTCA 3’

http://www.origene.com/support/FAQs/getFAQ.aspx?prod=CRISPR/CAS9

Hope it helps

[Jack Wong]

In the GeCko screen library, they generated multiple dummy guide which are supposed to be non targeting. I personally did not like the idea of using just the Cas9 cells as a negative control. Could you kindly explain what do you mean by the Cas9 protein generating an enormous amount of DNA breaks in the knock out cells, non targeting?

On Monday, June 29, 2015 at 7:01:32 AM UTC-4, guus86va...@gmail.com wrote: