Good protocol for in vitro transcription with T7

[JP]

Hi everyone,

I'm getting poor transfection with my primary cells and I would like to try transfecting RNA components. I have already cloned all my gRNAs into pX330 and verified that they cut the loci of interest by Surveyor nuclease in 293T cells. 

Has anyone made RNA transcripts from pX330? Could you recommend a good reference protocol, please?

JP

[JP]

I understand from "One-Step Generation of Mice Carrying Mutations in Multiple Genes by CRISPR/Cas-Mediated Genome Engineering" that the primers needed are as follows:

Cas9-f	TAATACGACTCACTATAGGGAGAATGGACTATAAGGACCACGAC
Cas9-r	GCGAGCTCTAGGAATTCTTAC
Target sgRNA-f	TTAATACGACTCACTATAGGXXXXXXXXXXXXXXXXXXXX
sgRNA-r	AAAAGCACCGACTCGGTGCC

Where "XXXXXXXXXXXXXXXXXXXX" represents the 20-bp target sequence.

Does this look right?

[Renchao Chen]

That's right.

在 2014年1月28日星期二UTC+8上午10时04分25秒，JP写道：

[anshika srivastava]

Hi,

I also have some doubts related to IVT. First, what would be the template when we are amplifying the cas9 and sgRNAs ? Second what would be the pcr conditions for the amplification of both the cas9 and sgRNA?

Thanks 

Anshika

[Fatwa Adikusuma]

Hi Guys,

I found the way Ivan makes gRNA is very efficient and quick (discussed at old thread). Once your primers arrive, it takes only one day to make the gRNA, skipping the cloning and plasmid prep steps. And it is cheaper as well. Here I paste what Ivan explained. Please note that PX330, PX335, PX458, PX459 can be used as the PCR template.

Cheers,

Fatwa

Of course, here goes the example:

gRNA:

FW primer for the px330/335  5´-3´--> T7(capital letters)+targetsite(N´s)+scaffold(lower case letters), note: ommit the PAM sequence in the targetsequence!

TGTAATACGACTCACTATAGGNNNNNNNNNNNNNNNNNNNNgttttagagctagaaatagc

Rv primer for the px330/335 5´-3´-->AGCACCGACTCGGTGCCACT

cas9 mRNA template generation for px330 and px335(this is the nickase mutant) respectively:

FW 5´-3´-->TGTAATACGACTCACTATAGGGAGAATGGACTATAAGGACCACGAC

Rv 5´-3´-->GCGAGCTCTAGGAATTCTTAC

FW 5´-3´-->TGTAATACGACTCACTATAGGATGTACCCATACGATGTTCC

Rv 5´-3´-->GCGAGCTCTAGGAATTCTTAG

You can choose to leave out the 2 nucleotides in front of the T7 binding site, its said that it increases binding efficiency, it worked fine without it as well. 
If you encounter any mistakes please feel free to correct me ;-).

Best
Ivan

[anshika srivastava]

Hi Fatwa,

Thanks for sharing the information, it was really very helpful. Can you please let me know the PCR conditions and band sizes for both Cas9n and Cas9Wt. Also I am interested in knowing that while using the pX335 vector as a template for the PCR, do we need to digest it for linearization? If yes what would be the preferred enzymes?

Thanks 

Anshika 

On Monday, January 27, 2014 7:46:59 PM UTC-5, JP wrote:

[anshika srivastava]

Hi,

I have one more doubt, that since you have not inserted the 20nt target sequence in your plasmid of interest say pX335 (in my case) how you will carry out the pcr amplification of the same?

Since I am new to this field so just getting so much confusions. Please suggest.

Thanks

Anshika

On Monday, January 27, 2014 7:46:59 PM UTC-5, JP wrote:

[Ryan Costello]

Hi Anshika,

If you look at the forward primer for the gRNA that Ivan/Fatwa suggests they actually contain the 20nt target sequence which removes the need for inserting them into the pX335 (in your case).

The forward primer contains the T7 sequence (capitals) and the target sequence (Ns) and the last part of the primer (lower case) is specific for the scaffold (pX335 or pX330)

I hope this helps,

Ryan 

[anshika srivastava]

Hi Everyone,

Can you please provide me the details of pcr reaction mixture and pcr conditions for both sgRNA and Cas9n. 

Thanks

Anshika

On Monday, January 27, 2014 7:46:59 PM UTC-5, JP wrote:

[JP]

I, too, would be interested in the PCR conditions. If you analyze the reverse primer it is predicted to form extensive secondary structure with a self-Tm identical to its target Tm. I am trying to use it right now without success despite three rounds of optimization.

[JP]

I am referring to the gRNA reverse primer.

[Ivan Ivandic]

For sg RNA I usually use the 2 step PCR, it works fine. Phusion, 98 30 sec , (98 30 sec, 72 20 sec)x 34 , 72 1 min, 4 pause. You can adjust the times if desired;-).

For cas9 template generation I use 50°C annealing and 3,4 min extension step in the cycling in a 3 step PCR. These conditions work fine for me. Meanwhile I have adjusted the reverse Primer(sgRNA) with additional nucleotides(covers the most end of the scaffold) and also I adjusted/extendet my reverse primer for cas9 generation in the way that it amplifies the pA signal as well, my idea is that tailing can be left out by this method...I cannot say how efficient this works in general but the px330 and 335 both have the pA signal in the vector already. In zebrafish we also have the MLM3613 (cas9) and pDR274(sgRNA) which work perfectly as templates as well, just to mention.

This maybe a repetition, but there is a new review out by DJ Burgess on off targets and also a new joung paper about shorter targetsites minimizing off target effects. Cho et all uses longer targetsites(additional GG).

Best
Ivan

[JP]

Are you using the regular HF buffer or the GC buffer?

Sorry to be so specific but I am having a terrible time dealing with a no-template, non-specific product despite rounds of optimization with other polymerases.

[Ivan Ivandic]

Hey,

the regular HF buffer…I usually take few tubes paralelly to have more product for IVT. also I stopped agarose purification, just purifying the PCR via kit and subseq. proceed with IVT.

--
You received this message because you are subscribed to a topic in the Google Groups "Genome Engineering using CRISPR/Cas Systems" group.
To unsubscribe from this topic, visit https://groups.google.com/d/topic/crispr/CdwWi27CrK0/unsubscribe.
To unsubscribe from this group and all its topics, send an email to crispr+un...@googlegroups.com.
For more options, visit https://groups.google.com/groups/opt_out.

[JP]

Thank you! Still got a band in the NT control even with Phusion and HF buffer, though much reduced. Using Phire buffer instead seems to have solved the problem. At last.

[Yi Liu]

Hi all,

I am experiencing the same problem when I tried to amplify the template for ivt. 

This is the primer that I used:

F  TTAATACGACTCACTATAGGG  g +20bp target sequence

R  AAAAGCACCGACTCGGTGCC

However I do not get specific sharp band. 

My questions are:

first: Should I expect a super bright band around 100bp? I ran the pcr product on a 2% agarose gel, but could not see very a sharp band.  

second: I looked at the tm value of the 20bp target sequence and it is around 53C. but the reverse primer sequence about 60C. Is this a potential problem for PCR. I am considering about shortening the reverse primer so I can have a primer with a lower Tm value or adding DMSO to prevent hairpin structure formation. 

I wonder if anyone could give any more suggestions to solve this problem. Thanks!

YL 

[JP]

I get a sharp band of the expected length using these primers on pX330 with the appropriate guide sequence cloned in:

Target sgRNA-f	TTAATACGACTCACTATAGGXXXXXXXXXXXXXXXXXXXX
sgRNA-r	AAAAGCACCGACTCGGTGCC

Where "XXXXXXXXXXXXXXXXXXXX" represents the 20-bp target sequence.

I use NEB Phusion polymerase and the HF buffer that comes with the Phusion polymerase or the Phire buffer. I use this PCR program:

98C x 30 sec , (98C x 30 sec, 72C x 20 sec)x 34 , 72 1 min, 4 pause.

[Alejandro T]

Thanks Ivan for your insight. Could you share with us the new primers with additional nucletoides? I have a couple of questions that I hope you can help me with...

1) What concentration of px330 are you using as your template?

2) How are you purifying this for transcription?

3) Should I sequence my PCR product before transcription?

Thanks!!!

[Andrei Ry]

Not sure if keeping poly A signaling make any sense. As far as I understand it is needed for RNA-polymerase complex to add Poly A in the nucleus, as soon as mRNA is made invitro by T7 polimerase, I doubt it is processed in cytoplasmic poliadenilation  with additional tailing, as cytoplasmic poliadenilation is seems occur only in specialized cell types

[Amandine C]

Hey Alejandro!

I used 10 ng plasmid (maximum template authorized by the kit) and it worked beautifully with JP's protocol.

Haven't done the next steps yet

[TVN]

Hi Fatwa,

This looks like a very interesting way to omit the cloning steps in the CRISPR/Cas9 technology. I have a remark about your primer however: the GG at the end of the T7 promotor are the first transcribed nucleotides, so if you would use this setup you would get a 22 nt target sequences: GGNNNNNNNNNNNNNNNNNNNN. Shouldn't you make sure your target sequence starts with GG and include them in the 20 bp target sequence when you use  T7. In other words your FW primer would become:
TGTAATACGACTCACTATA GGN18 gttttagagctagaaatagc.

Best

Tom

Op woensdag 29 januari 2014 02:35:14 UTC+1 schreef Fatwa Adikusuma:

[Fatwa Adikusuma]

Nice spotting Tom. What I normally do is only use one G at the end of T7 promoter. Here is one example that I used for the forward 5' TTAATACGACTCACTATAGNNNNNNNNNNNNNNNNNNNNgttttagagctaGAAAtagc

Cheers,

Fatwa

[mithilkumar soni]

Hi Fatwa

The primary promoter sequence necessary for T7 transcription (mMessage mMachine T7 kit) is TAATACGACTCACTATAGGG....While you have TTAATACGACTCACTATAG.?
I read one protocol that specifically mentions to include these GG if I do not have that at 5' end of my 20nt tartget sequence. I am attaching it for your reference.

Does it affect efficiency of gRNA if it has 5'CCC before 20nt target sequence? You will also have 5' C before your 20nt sequence.

Another question is regarding transcription kit. I know most labs use T7 Megascript kit for transcription of sgRNA but can I use mMessage mMachine T7 kit for sgRNA transcription? Will it add polyA at the end?

Thanks you,
Mithil

[Fatwa Adikusuma]

Hi Mithil,

The choosing of using only one G is based on Wang, Jaenisch 2013 Cell paper. We just followed that and worked very efficiently (nearly 100% efficiency). We do IVT using Feng's recommendation which is using HiScribe IVT kit from NEB which is cheaper. Purify the RNA using RNeasy minikit column.

Cheers,

Fatwa

[Razieh Monjezi]

Hi Fatwa,

thanks for sharing these helpful data with us. I have a confusion about the design of forward primer sequence, since there are extra nucleotids for scaffold after the gRNA aequence (scaffold(lower case letters), which in Jaenisch Cell paper does not exists. is it neccessary to include this sequence? second, as I understood it correct, it does not matter if the gRNAs are cloned or not, right? 

next question is about the addition of one extra G after T-7 promotor, what is the rational behind that? 

at the end, it would be a great help if possibly you can share the PCR condition you used for the amplification with us. 

Best regards

Razieh

[Fatwa Adikusuma]

Hi Razieh,

Bear in mind that this way is different from Jaenisch way. This is a cloning-free protocol. I personally prefer using Jaenisch way since oligos are prone to have mistake which can lead to off-target. The first G is actually part of T7 promoter.

Cheers,

Fatwa

[Angelo]

Hi JP,

I'm also having faint bands around 0.1 kb in my NT control. Have you looked further into this?

Thanks

[Ranjai kumar]

Hi Yi Liu

Calculate annealing temp on Thermo tm Calculator and also try 2 step or GC buffer.