Trouble in cloning sgRNA to lenti sgRNA(MS2)_zeo backbone

[Ma]

Hi!

I am trying to apply transcriptional activation system of Cas9-SAM, but there are some troubles.

After annealing of oligos of sgRNA, I cloned it to lenti sgRNA(MS2)_zeo backbone according to protocol and transfected into stbl3.

After plating, many clonies were observed, but products of miniprep of 8 colonies are all negative shown below.

1. collection by mini prep is very low (only 0.5-1μg)

2. the plasmid size AFTER cutcheck with BsmBI is the same size with that of control plasmid (lenti sgRNA(MS2)_zeo backbone WITHOUT BsmBI)

3. sequencing with the primers in the protocol has failed 

I suppose that golden gate reaction did not go well.

Are there any advices or any persons with such an experience?

Thank you in advance.

Regard, 

[Silvana Konermann]

Hi Ma,

I'm sorry to hear that you are having trouble with your golden gate reaction. I'm assuming you used the golden gate protocol from the SAM website? Did you use the recommended ligase (enzymatics T7 with 2X rapid ligation buffer) and BsmBI enzyme (Fermentas Fast Digest)? 

This matters, as the BsmBI from Fermentas requires 1mM Dtt, which is supplied by the enzymatics 2X rapid ligation buffer (keep it at -20C to preserve the Dtt).

For your specific points:

1. your miniprep yield for lenti sgRNA(MS2)_zeo should be quite high (as this is a large plasmid), so it's a bit worrisome that it is so low. (I would usually get >20ug/miniprep fopr this vector)

2. The plasmid size before and after sgRNA cloning should be the same (there is no stuffer in the backbone)

3. Did you use the primers listed on addgene? the following primers should work:

forward: gagggcctatttcccatgattccttcatat (this anneals at the beginning of the U6 promoter)

reverse: ggagccagtacacgacatca (this anneals at the beginning of EF1a) 

Have you tried sequencing your lenti sgRNA(MS2)_zeo backbone (before cloning, e.g. with primers above) just to make sure the BsmBI sites are ok? 

I hope this helps and the golden gate works the next time. Please let me know if you have any more questions in the future!

Best,

Silvana

[Ma]

Dear Silvana

Thank you very much for your quick response and kind help!

Concerning your kind suggestion, there might be some serious problems in golden gate reaction.

I used the golden gate protocol from the SAM website and used T7 ligase and BsmBI.

But these are obtained from other company (NEB).

So I think I should use the same one. I will try again as soon as the product arrives.

Regards,

2015年6月2日火曜日 10時45分59秒 UTC+9 Silvana Konermann:

[Neal]

Hi Silvana,

I am also having some problem with the sgRNA-MS2-Zeo plasmid. I tried to use the BsmBI from NEB to digest the backbone, I can see three bands after electrophoresis, but there're only 2 BsmBI sites according to the sequence on Addgene. Also I tried the golden gate cloning using the protocol on the website (I used all reagents from NEB) but non of the sequences was correct after hU6 primer sequencing. I am wondering whether addgene sent us the wrong plasmid, and I am planning to use other enzyme to digest the backbone and verify. May I have your suggestions? Thank you very much!

Neal 

[Phil Abbosh]

Silvana
Thank you for such good work and willingness to help all the forum users.  Quick question. Which kit do you use to get 20 ug of plasmid from a miniprep?  i use the qiagen miniprep kit and cant get more than ~2 ug.  i talked with them several times and no one can figure it out.  they sent a new kit...same result.  I use 5 mL of either LB or 2XYT in an 8-16 h culture in a 14 mL tube, snap cap applied loosely. 100 ug amp/ml of media.

if i could get 20 ug that would greatly speed up my workflow. any advice would be great.

phil

[Silvana Konermann]

Hi Phil,

The yield for my minipreps (Quiagen, grown in 2-3ml TB in 14ml round bottom tubes (Falcon #352059) for 16-18h) depends largely on the plasmid size (assuming you are only dealing with high-copy plasmids).

For a very small plasmid (3-4kb) such as the SAM non-lenti sgRNA cloning backbone (addgene # 61424), getting 2ug total would be acceptable.

For a large plasmid, (>10kB) such as most lenti plasmids including the SAM lenti sgRNA(MS2)_zeo backbone mentioned above (addgene #61427) yields of >20ug should be achieved easily.

If you keep getting very low yields for large, high-copy plasmids grown as described, I would measure the OD of your culture (dilute 100ul 1:10, measure in a cuvette, aim for OD of 1.0 after dilution (which corresponds to  OD of 10 of the culture).

I hope this helps!

Best,

Silvana

[Silvana Konermann]

Hi Neal,

I would recommend to sequence your Addgene backbone with the primers I had suggested for Ma above (or your own hU6 primer) to make sure your BsmBI cloning sites are intact.

If the sequencing looks good, I would try to perform the golden gate reaction using the reagents recommended in the protocol (Fermentas FD BsmBI and enzymatics T7 ligase). 

If your sequencing of your backbone does not look good, let me know. Maybe you can get a new aliquot from Addgene?

I hope this helps and let me know how if you have any other questions!

Best,

Silvana

[mat...@gmail.com]

Hi Silvana,

I have a few questions.

- Could I use the lenti sgRNA(MS2)_zeo together with a Cas9 expressing plasmid to target a specific gene? or more simply, do you have any version of this plasmid without the MS2 loops?

(In fact I would need a lenti gRNA expressing plasmid with a resistance other than Puro)
- Do you have libraries for gene inhibition that use inactive Cas9 like the SAM system?

Thanks a lot.

Matias

[Neal]

Hi Silvana,

We sequenced the backbone using your primer sequence and it only goes about 100bp and stops, we think it's just background noise. We can't see BsmBI either. We have contacted addgene and asked for a new vial. Thank you!

Neal

[Silvana Konermann]

Hi Neal,

I'm glad you found the issue and good luck with your new vial!

Best,

Silvana

[Ma]

Dear Silvana

This is MA, thank you very much for the helpful comments!

I tried golden gate reaction using new enzyme according to the protocol, and transfect int Stbl3.

However, negative control (only lenti sgRNA(MS2)_zeo+enzyme(T7 ligase, Bsmbi), without annealed template) also yielded a lot of colony

(Ampicillin is OK)

Is that OK? I think this negative control SHOULD NOT yield colonies.

Thank you in advance,

Regars,

Ma

Tokyo Univ

2015年6月2日火曜日 10時45分59秒 UTC+9 Silvana Konermann:

Hi Ma,

[Winston Yan]

Hi Ma,

If you are using the golden gate method for the negative control, the lost BsmBI fragment can re-ligate back to create a circularized plasmid over the cycles of golden gate, so you will get many background colonies. In my experience though, the number of successful clones is extremely high from the positive plate due to the high molar excess of the annealed insert. Typically, I pick two clones and both are positive. If the sequencing result reveals BsmBI still in the plasmid, then most likely it's been due to primer design error or a bad restriction enzyme stock rather than something that would be fixed by picking more colonies. 

Hope this help,

Winston

Zhang Lab 

__

mobilewinston

--
You received this message because you are subscribed to the Google Groups "Genome Engineering using CRISPR/Cas Systems" group.
To unsubscribe from this group and stop receiving emails from it, send an email to crispr+un...@googlegroups.com.
For more options, visit https://groups.google.com/d/optout.

[Ma]

Dear Winston

Thank you very much for your valuable comments! And I apologize for late response.

I totaliy misunderstanded the negative control.

I would like to proceed the experiments.

Best Regards,

Ma  

2015年6月19日金曜日 21時28分06秒 UTC+9 Winston Yan:

[Maria Cherepkova]

Dear authors of the article, 

could you please explain why did you choose golden gate reaction for this cloning? Have you ever tried to perform simple cutting and ligation?

And also have you tried to use T4 instead of T7 ligase?

Than you in advance!

Sincerely, 

Maria. 

[Elkholi]

Hi everyone,

I have a question for those who already cloned individual sgRNA to the MS2 backbone, please. I used the golden gate described in the recent Nature Protocol to insert sgRNAs in the MS2 backbone of the SAM system. After sequencing those vectors with the U6 Fwd, I found my sequences inserted directly after U6 promoter at the base 242 (starting with the "CACC overhang"), however, the GAA bases (which are supposed to precede the CACC overhang as simulated by SnapGene Restriction Cloning tool) are after the insert not before! This was consistent in five different clonings.

So if this is the case with how the SAM library's vectors are, the last 8 bases of the priming site (GAAA CACC) of the designed primers wouldn't match. If not, and the problem is the golden gate experiment, I'm not sure what could have gone wrong with the method. I used the recommended reagents and the empty backbone was verified by Sanger sequencing. 

Many thanks in advance,

Islam

[Julia Joung]

See my response to your "Primers for sequencing the SAM and GeCKO libraries" thread.

Julia

--

You received this message because you are subscribed to the Google Groups "Genome Engineering using CRISPR/Cas Systems" group.

To unsubscribe from this group and stop receiving emails from it, send an email to crispr+unsubscribe@googlegroups.com.
To post to this group, send email to cri...@googlegroups.com.

[Elkholi]

Many thanks Julia! Much appreciated!

Islam

To unsubscribe from this group and stop receiving emails from it, send an email to crispr+un...@googlegroups.com.