In vitro Cas9 digestion / cleavage assay fail

[lvanri...@gmail.com]

Hi all,

I have been trying an in vitro Cas9 digestion, but everytime I end up with a completely empty gel (aside from some sporadic really vague bands). At first I thought it was just the amount of DNA target I was adding to my reaction (the protocol said 3 nM, so with a PCR product of around 1 kb and a 30 uL reaction I end up with only 30 ng per reaction). But when I try to increase the amount of DNA, I still do not see anything. When I just load the same amount of DNA used in the reaction, I do see a band. I feel kind of stupid for this question, but could Cas9 just be eating away my PCR product DNA target entirely?

I am using the NEB protocol (https://www.neb.com/protocols/2014/05/01/in-vitro-digestion-of-dna-with-cas9-nuclease-s-pyogenes-m0386) with a home-made Cas9 reaction buffer and Cas9 enzyme we received from another lab that produces it themselves.

Really hope someone can give me a hint on what I am doing wrong! It seems like a really simple protocol and further increasing my DNA target concentration might be a logical thing to do, but I am anxious I might be overlooking something simple and wasting a lot of Cas9 enzyme in my attempts.

Best,

Lotte

[lvanri...@gmail.com]

Oh, we are also using sgRNAs that we are producing by in vitro transcription using the MegaSCRIBE kit and a clean-up with the MegaCLEAR kit. Does anyone know if this clean-up will get rid off the TURBO DNase used in the in vitro transcription? Because that would explain my problems.

[Wes]

Cas9 remains bound to the DNA target after cleavage. You need to degrade away the protein in order to visualize the cleaved bands on a gel. Perform a proteinase K digestion (1-2mg/ml proteinase K in 100mM Tris-HCl pH=7.4, 150mM NaCl, 25mM EDTA) 15 minute incubation at 65C. Add loading dye/buffer.

You should see your bands now.

Good Luck!

Wes

[Wes]

MegaClear kits remove protein (DNase, RNA polymerase) so there should not be any DNase remaining. Try the proteinase K procedure described and I am pretty sure it will solve your problems!

[qwa...@ualberta.ca]

Hi Lotte,

I am wondering did you solve the problem by doing proteinase K digestion? I have the same problem as you described and i am so frustrated.

Qian

On Friday, July 1, 2016 at 4:21:59 AM UTC-4, lvanri...@gmail.com wrote:

[王强]

Have you solved your problem? I found I encountered the same issue.  I choose 4 different PAM site, there is no cleavage band. I wonder whether the gRNA need phosphatase treatment. Or there is something wrong with the T7 promoter ? This is my forward primer:

aagcTAATACGACTCACTATAgg(N)18GTTTTAGAGCTAGAAATAGCAAG

在 2016年8月29日星期一 UTC-5上午9:50:25，qwa...@ualberta.ca写道：

[王强]

Have you solved your problem? I found I encountered the same issue.  I choose 4 different PAM site, there is no cleavage band. I wonder whether the gRNA need phosphatase treatment. Or there is something wrong with the T7 promoter ? This is my forward primer:

aagcTAATACGACTCACTATAgg(N)18GTTTTAGAGCTAGAAATAGCAAG

在 2016年7月1日星期五 UTC-5上午9:28:58，Wes写道：

[ray.n...@gmail.com]

I have done many in vitro cleavage assays, always using the protocol from PNA Bio, the company from which we purchased the Cas9. Recently I tried a sample of NEB's Cas9 and used their protocol for the assay. Cleavage was much worse (barely/not detectable), regardless of Cas9 source, and improved using the PNA protocol. Granted I have not had the empty gel issue, but give this a try:

60 ng purified pcr product (target DNA)

150 ng Cas9

100 ng gRNA

1 uL BSA

1 uL NEB buffer 3 (NOT 3.1)

H2O to 10 uL

37 degrees, 1h

65 degrees, 10 min

Run on agarose gel

No RNP incubation necessary. You can try -RNA and/or -Cas9 controls as necessary.

[Birdman]

This is what i usually do, and it works just fine.

[Margarita Meer]

Hi!

I'm new to the CRISPR/Cas9 field. I was surprised to read this:

"Cas9 remains bound to the DNA target after cleavage."

Do you have a reference for this? Does Cas9 always stay on DNA after cleavage?

I check my gRNAs on a PCR-amplified genomic region. After cleavage I run TapeStation and see perfect bands corresponding to the original DNA and two fragments which are the result of digestion. 

It's still possible that something like TapeStation buffer cases detaching. 

Can you give any comments on this?

Best

[ray.n...@gmail.com]

This paper provides some data on Cas9's association with DNA. From the abstract: "We show that dissociation of Cas9 from double-stranded DNA (dsDNA) substrates is slow (lifetime ~6 h)". Later: "We note that exponentially growing mammalian cells require only 1 h to repair 90% of the double-strand breaks caused by ionizing radiation but 15 h to resolve 90% of Cas9 lesions, suggesting that the long lifetime of the Cas9-DNA complex could be a limiting factor in genome editing".

I've done lots of any vitro assays and never had problems with it though, just used the 10 minutes at 65 degrees and no proteinase K. Could also be that the complex is destabilized by the electrophoresis conditions. 

[Doug]

Hi Wes,

We use proteinase K treatment to remove Cas9, too.  Do you know of any references that actually show that proteinase K treatment is sufficient to degrade Cas9?  I've searched, but can't find any direct evidence.

Thanks,

Doug

On Friday, July 1, 2016 at 7:18:42 AM UTC-7, Wes wrote: