Compelling Evidence (again) that msh could be the only and a PROFOUND treatment for an Isc. Stroke Patient befor and soon after to alleviate severity of BRAIN DAMAGE

604 views
Skip to first unread message

Uhohinc

unread,
Aug 9, 2014, 4:22:49 PM8/9/14
to

To note, Retrophen's drug, an analogue of human AdrenoCoritropic ACTH and pig ACTH derivatives as in the only other on market ACTH is not effective and apparently a worse outcome predictor in my interpretation of this human study of 111 stroke patients.

A good percentage of the people reading this will have a stroke eventually. Other than drugs to break the clot and minimize damage but difficult to administer in real life, because they must be administered almost immediately, or brain damage incurs.  There is nothing one can do.  A drug that can cause the effects of minimizing the axiom and myliene damage or neuronal death could save billions in loss of use of body or paralysis as well as billions in physical therapy.  Although not yet where one can say a cure, it clearly is a direct link of a lessening of the effects of a stroke.  Again it is based on the anti-inflammatory links that an msh or Afamelanotide insinuate.

I think the countering or down regulation of many harmful Interleukines, in this study il-6 is indicated, but also inference is that Retrophen drug RE-34 form of ACTH would be the control patients not favorable outcome.  Probably natural levels of ACTH are a indirectly negative result of the overall body response to the very stressful event, related to POMC and others.  ACTH was not studied here to determine if ACTH was involved, because to get natural ACTH blood levels, the human body has to get all the other well documented bad stress chemicals with ACTH.

The normal static levels of natural melanocyte stimulating hormone in a healthy adult in this study are indicated to be 12.8 pico grams per liter of blood. I forgot what Clinuvel's 16 milligram dissolving implant at present design of drug application are, but they levels are much higher.

To get to the easy reading of this link just go to the Disscussion at the bottom.

Upon approval of Scenesse and adequate revenues, I would suspect Clinuvel will deliberate seriously attempting a clinical trial for this.  Not only does this study indicate that even several hours after a stroke were blood levels of msh very helpful for stroke patient outcome.  (This is important, as diagnosis of a stroke is such that most doctors want one form or other of a image of extremely high electrical induced magnetism forcing of the electrons in all tissues  of the brain to align relative to constituancies and imaging this to indicate an internal picture of the brain. It is the only certain way to diagnose a stroke, and which kind of stroke. In the immediate time after a stroke, most all doctors are hesitant to diagnose and determine which drugs to use, or if it is a cerebral hemmoraging stroke.

This therapy with Sceness with its melanocyte stimulating hormone, and more importantly the dissolving silica implant that can maintain and control the pico gram liter of blood levels of Scenesse at a future determined optimal dose (particularly a 7 amino acid peptide that could slip into the tight spaces of the endothelia of the blood brain barrier) could be incredible if administered not only just after a stroke as indicated in this study.  But many stroke patients are repeats. If someone is high risk identified as a stroke patient, as millions of people already are, it is entirely predictable that the FDA and EMA would fast trak this devastating human malady. 

This is another therapy for Clinuvel, that preliminary studys and logical pathways and biologically is highly probable that Scenesse could help to a significant degree. Even a small degree indicated in a Clinical trial of lessening of some of the physical disability of a stroke is a very valuable drug.  The study did not indicate insignificant results.

Scenesse could be a preventative intervention on high risk patients.  There are multi-millions of patients. The use would be almost all patients.

I could easily see sales here of at least $10 billion in sales of Scenesse here.  Rather than over several years, overnite this could make Clinuvel a $40 Billion in Market Capital and one of the top ten pharmaceutical companys in world.  Still dwarfed by Merck and Pfizer though.  Cinuvel as of now is about a $100 million dollar market capitalization. This could take Clinuvel present stock up about 400 times what it is.

Retrophen's drug pipline is "Blue Sky" .
Clinuvel has a reality and  this is  facts and realitys with evidence based Sciences and studys by reputable sources that anyone can deliberate, or debate facts or degrees or numbers with critical analyisis, but I think just another compelling aspect of a controlled analogue of human melanocyte stimulating hormone.





Uhohinc

unread,
Aug 9, 2014, 5:09:51 PM8/9/14
to
https://www.google.com/search?sourceid=navclient&ie=UTF-8&rlz=1T4GGHP_enUS578US578&q=picograms+in+a+gram

I can not even pronounce what a pictogram number is but a Milligram is such there are one thousand milligrams in one gram. Scenesse has 16 milligrams that last about ten days or so befor no longer saturation to the blood.  Being it last much longer in blood than natural, but I do not think it matters for here in my math.

Scenesse has about 16 milligrams of msh to put in a patients blood, at this present dose over say sixteen days.  That is one thousandsth of a grams a day. 
Natural occurring levels per the study indicate about 12,000,000,000,000ths of one gram of melanocyte stimulating hormone in a health humans blood. at any time. Whatever comes after a billionth of a gram, perhaps gazillionth.

Uhohinc

unread,
Jul 17, 2015, 3:33:09 PM7/17/15
to clin...@googlegroups.com, michaelba...@gmail.com

Skip to main page content

Arteriosclerosis, Thrombosis, and Vascular Biologyatvb.ahajournals.org
  1. ATVBAHA.115.305348 Published online before print June 25, 2015, doi: 10.1161/ATVBAHA.115.305348

  • Original Research

Both MC1 and MC3 Receptors Provide Protection From Cerebral Ischemia-Reperfusion–Induced Neutrophil Recruitment

  1. Paul M. Holloway,
  2. Pascal F. Durrenberger,
  3. Marjan Trutschl,
  4. Urska Cvek,
  5. Dianne Cooper,
  6. A. Wayne Orr,
  7. Mauro Perretti,
  8. Stephen J. Getting,
  9. Felicity N.E. Gavins

+ Author Affiliations

  1. From the Division of Brain Sciences, Imperial College London, London, United Kingdom (P.M.H., P.F.D., F.N.E.G.); LSU Shreveport, LA (M.T., U.C.); William Harvey Research Institute, Barts and The Royal London School of Medicine, London, United Kingdom (D.C., M.P.); Faculty of Science and Technology, University of Westminster, London, United Kingdom (S.J.G.); and LSU Health Science Center, Shreveport, LA (P.M.H., A.W.O., F.N.E.G.).
  1. Correspondence to Felicity N.E. Gavins, Department of Molecular and Cellular Physiology, LSU Health–Shreveport, 1501 Kings Highway, Shreveport, LA 71103. E-mail fga...@lsuhsc.edu

Abstract

Objective—Neutrophil recruitment is a key process in the pathogenesis of stroke, and may provide a valuable therapeutic target. Targeting the melanocortin (MC) receptors has previously shown to inhibit leukocyte recruitment in peripheral inflammation, however, it is not known whether treatments are effective in the unique cerebral microvascular environment. Here, we provide novel research highlighting the effects of the MC peptides on cerebral neutrophil recruitment, demonstrating important yet discrete roles for both MC1 and MC3.

Approach and Results—Using intravital microscopy, in 2 distinct murine models of cerebral ischemia-reperfusion (I/R) injury, we have investigated MC control for neutrophil recruitment. After global I/R, pharmacological treatments suppressed pathological neutrophil recruitment. MC1 selective treatment rapidly inhibited neutrophil recruitment while a nonselective MC agonist provided protection even when coadministered with an MC3/4 antagonist, suggesting the importance of early MC1 signaling. However, by 2-hour reperfusion, MC1-mediated effects were reduced, and MC3 anti-inflammatory circuits predominated. Mice bearing a nonfunctional MC1 displayed a transient exacerbation of neutrophil recruitment after global I/R, which diminished by 2 hours. However importantly, enhanced inflammatory responses in both MC1 mutant and MC3−/− mice resulted in increased infarct size and poor functional outcome after focal I/R. Furthermore, we used an in vitro model of leukocyte recruitment to demonstrate these anti-inflammatory actions are also effective in human cells.

Conclusions—These studies reveal for the first time MC control for neutrophil recruitment in the unique pathophysiological context of cerebral I/R, while also demonstrating the potential therapeutic value of targeting multiple MCs in developing effective therapeutics.

Key Words:
  • Received January 19, 2015.
  • Accepted June 11, 2015.
  • © 2015 American Heart Association, Inc.



Uhohinc

unread,
Jun 16, 2020, 2:14:57 AM6/16/20
to Clinuvel Afamelanotide SCENESSE senescence CUV ASX.CUV CLVLY ur9

Uhohinc

unread,
Oct 28, 2020, 5:40:44 PM10/28/20
to Clinuvel Afamelanotide SCENESSE senescence CUV ASX.CUV CLVLY ur9

Arterial Ischaemic Stroke
Arterial Ischaemic Stroke (AIS) patients suffer an acute and life-threatening condition due to a blood clot in a major brain vessel which deprives the brain of blood flow and oxygen. This leads to rapid death of brain tissue and loss of function. Ischemic stroke accounts for approximately 85% of the estimated 15 million global stroke cases reported annually.  
Clinical and regulatory process
October 2020: CLINUVEL announced that it would commence a pilot Phase IIa study (CUV801) to evaluate SCENESSE® (afamelanotide 16mg) in patients suffering from AIS who are ineligible to receive standard therapy (IVT/EVT), and in stroke affecting the M2 segment or higher, where there is a great unmet medical need. Read the announcement here.  
About AIS

A stroke occurs when a clot in a major vessel blocks the flow of blood and oxygen to the brain, causing instant death of brain tissue. Stroke is often characterised by a patient’s sudden impairment of consciousness, inability to move one side of the body and limitation in speech. The centre of the brain injury is called the necrotic core (dead brain tissue), and the larger surrounding brain injury is known as the penumbra (meaning shadow around the core). The necrotic core is dead brain tissue which is unsalvageable, but the penumbra is part of the brain deprived of oxygen which can be recovered if the patient is treated quickly. 

Current standard therapy relies on early intervention following stroke onset to restore blood flow to the brain by either chemically dissolving or physically removing the clot. Intravenous thrombolytic therapy (IVT) in the form of recombinant tissue plasminogen activator (alteplase or tenecteplase; rt-PA) can be administered within 4.5 hours, aiming to dissolve the clot within the brain artery. This therapy is usually combined with endovascular thrombectomy (EVT) which aims to mechanically remove the clot and is ideally performed within 24 hours of the stroke. Brain imaging, using a computed tomography (CT) scan, is performed upon hospital admission for patients displaying symptoms of stroke, and physicians assess the loss of neurological functions using the modified Rankin Scale (mRS), a scoring of severity of disability.

The location of the brain clot determines whether a stroke patient is eligible for the combined therapy thrombolysis (IVT) and thrombectomy (EVT) treatment, as well as having an impact on overall patient prognosis. Clots in the main “M1” segment of the brain are generally eligible for IVT or EVT due to the wider diameter of the artery and accesibility to physically remove the clot. Those in smaller arteries (segments “M2” and higher) off the middle cerebral artery (MCA) are considered impossible to remove or of too great a risk to the patient.

Globally, 15 million patients suffer from a stroke annually, and over 5.5 million do not survive. Around 40% of AIS patients do not survive the first year, with most patients who do survive experiencing permanent life-long disability and further impairment of function over time due to brain tissue damage. As many as 50% of stroke survivors suffer disability and stroke is one of the most frequent causes of dementia. A quarter of stroke patients will experience another stroke within five years, with 12% of AIS patients being readmitted to hospital within 30 days of discharge.

Figure 1 A clot in the brain vessel of a stroke patient leads to instant death of brain tissue closest to the clot, shown in dark pink. The larger area surrounding the core (shaded) is characterised as the penumbra, tissue which can still be rescued.

Most patients require ongoing care and face limitations in their daily social activity, as well as significant rehabilitation costs and loss of earnings. Families often have to shoulder excessive rehabilitation costs and lost wages. In the United States alone, recent estimates place the cost of stroke in excess of $34 billion per year.



On Monday, June 15, 2020 at 11:14:57 PM UTC-7 Uhohinc wrote:
https://www.clinuvel.com/photomedicine/scientific-communiques/scientific-communique-v

Uhohinc

unread,
Oct 29, 2020, 11:36:30 AM10/29/20
to Clinuvel Afamelanotide SCENESSE senescence CUV ASX.CUV CLVLY ur9
Just saying.................if one reads my soliquy in the  first post on the top of this subject..........6 and a half years ago ...............my predicts there on the predicates based on Scenesse (Prenumbra) and the collective studys and info have all come true except one......................that this will make  Clinuvel a $10 Billion company in stock.....................this upon an approved  therapy with Prenumbra by Clinuvel I think is an excellent monetizing of melanocyte stimulating hormone.  Competition will have to be an evolving evaluation......but I think getting thru the famous blood brain barrier and shelf life  may hinder other mcr1 stimulants.

Zero tolerance

unread,
Oct 29, 2020, 4:53:02 PM10/29/20
to Clinuvel Afamelanotide SCENESSE senescence CUV ASX.CUV CLVLY ur9
Your predictions are amazing.  Yes, Clinuvel is far from $10 billion, but....would you predict this valuation in the not too distant future?
Message has been deleted

Uhohinc

unread,
Nov 19, 2020, 11:51:38 AM11/19/20
to Clinuvel Afamelanotide SCENESSE senescence CUV ASX.CUV CLVLY ur9

In pathology and anatomy the penumbra is the area surrounding an ischemic event such as thrombotic or embolic stroke. Immediately following the event, blood flow and therefore oxygen transport is reduced locally, leading to hypoxia of the cells near the location of the original insult.

Uhohinc

unread,
Nov 20, 2020, 9:22:53 AM11/20/20
to Clinuvel Afamelanotide SCENESSE senescence CUV ASX.CUV CLVLY ur9
Wu et al. Journal of Neuroinflammation (2019) 16:192 https://doi.org/10.1186/s12974-019-1591-4
RESEARCH
Open Access
                 NDP-MSH binding melanocortin-1 receptor ameliorates neuroinflammation and BBB disruption through CREB/Nr4a1/NF-κB pathway after intracerebral hemorrhage in mice
Xuan Wu1, Siming Fu1, Yun Liu1, Hansheng Luo1, Feng Li1, Yiying Wang2, Meng Gao2, Yuan Cheng1 and Zongyi Xie1*
                      Abstract
Background: Neuroinflammation and blood-brain barrier (BBB) disruption are two vital mechanisms of secondary brain injury following intracerebral hemorrhage (ICH). Recently, melanocortin-1 receptor (Mc1r) activation by Nle4- D-Phe7-α-MSH (NDP-MSH) was shown to play a neuroprotective role in an experimental autoimmune encephalomyelitis (EAE) mouse model. This study aimed to investigate whether NDP-MSH could alleviate neuroinflammation and BBB disruption after experimental ICH, as well as the potential mechanisms of its neuroprotective roles.
Methods: Two hundred and eighteen male C57BL/6 mice were subjected to autologous blood-injection ICH model. NDP-MSH, an agonist of Mc1r, was administered intraperitoneally injected at 1 h after ICH insult. To further explore the related protective mechanisms, Mc1r small interfering RNA (Mc1r siRNA) and nuclear receptor subfamily 4 group A member 1 (Nr4a1) siRNA were administered via intracerebroventricular (i.c.v) injection before ICH induction. Neurological test, BBB permeability, brain water content, immunofluorescence staining, and Western blot analysis were implemented.
Results: The Expression of Mc1r was significantly increased after ICH. Mc1r was mainly expressed in microglia, astrocytes, and endothelial cells following ICH. Treatment with NDP-MSH remarkably improved neurological function and reduced BBB disruption, brain water content, and the number of microglia in the peri-hematoma tissue after ICH. Meanwhile, the administration of NDP-MSH significantly reduced the expression of p-NF-κB p65, IL- 1β, TNF-α, and MMP-9 and increased the expression of p-CREB, Nr4a1, ZO-1, occludin, and Lama5. Inversely, the knockdown of Mc1r or Nr4a1 abolished the neuroprotective effects of NDP-MSH.
Conclusions: Taken together, NDP-MSH binding Mc1r attenuated neuroinflammation and BBB disruption and improved neurological deficits, at least in part through CREB/Nr4a1/NF-κB pathway after ICH.
Keywords: Intracerebral hemorrhage, Neuroinflammation, Blood-brain barrier, NDP-MSH, Mc1r, Nr4a1
                                                       * Correspondence: zyxiene...@yahoo.com
1Department of Neurosurgery, The Second Affiliated Hospital, Chongqing Medical University, 76th Linjiang Road, Yuzhong District, Chongqing 400010, China
Full list of author information is available at the end of the article
© The Author(s). 2019 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
     
Wu et al. Journal of Neuroinflammation (2019) 16:192
Page 2 of 13
Background
Intracerebral hemorrhage (ICH) is a severe cerebral vascular disease with high morbidity and mortality, and its incidence is increasing annually [1]. Mounting evi- dence has demonstrated that neuroinflammation and blood-brain barrier (BBB) disruption are two critical mechanisms of ICH-induced brain injury, which are closely associated with poor prognosis [2]. Therefore, a therapeutic strategy targeting neuroinflammation and BBB disruption would be beneficial for attenuating brain injury following ICH.
The neuropeptide α-melanocyte-stimulating hormone (α-MSH) is a member of the melanocortin family, a group of peptides derived from pro-opiomelanocortin (POMC) [3]. α-MSH exerts well-established roles in the regulation of skin pigmentation and energy homeostasis, as well as inflammatory reaction [4, 5]. The biological function of α-MSH is mediated by five melanocortin re- ceptors (termed Mc1r to Mc5r) [6]. Melanocortin-1 re- ceptor (Mc1r), a G protein-coupled receptor, is best known as a mediator of the synthesis of melanin pig- ments, and it is also implicated in inflammation which is regulated by NF-κB signaling pathway [7–9]. α-MSH is released from cells in the central nervous system; how- ever, the chemical property of α-MSH is unstable, trans- formed into the protease-stable Nle4-D-Phe7-α-MSH (NDP-MSH), which has a specific higher affinity to Mc1r [8, 10, 11]. Treatment with NDP-MSH was proven to reduce inflammation and vasospasm after subarach- noid hemorrhage [12]. Likewise, the administration of NDP-MSH ameliorated blood-brain barrier (BBB) dis- ruption by activating Mc1r in a model of experimental autoimmune encephalomyelitis (EAE) [13]. Despite the well-recognized roles of NDP-MSH and Mc1r on in- flammation, the effects of NDP-MSH and Mc1r on neu- roinflammation and BBB integrity after ICH have not been elucidated.
Nuclear receptor subfamily 4 group A member 1 (Nr4a1), a member of Nur nuclear receptor family of transcriptional factors, is involved in neuroinflamma- tion as a regulator of microglia activation in EAE in mice [14]. A previous study indicated that Nr4a1 was induced and functions immediately downstream of Mc1r signaling in melanocytic cells [15]. Further- more, Mykicki et al. showed that NDP-MSH binding to Mc1r initiated the phosphorylation of cAMP response element-binding protein (CREB), and activated Nr4a1, subsequently exerted long-lasting neuroprotective roles in mice with EAE [13]. It was reported that Nr4a orphan re- ceptors could regulate NF-κB signaling in microglial and myeloid cells [16, 17]. Moreover, mounting evidence revealed that Nr4a1 negatively modulated the transcrip- tional activity of NF-κB and inhibited inflammatory gene expression [18–21].
In the present study, we hypothesized that Mc1r acti- vation by NDP-MSH could attenuate neuroinflammation and preserve BBB integrity after experimental ICH, and the protective mechanism is mediated through CREB/ Nr4a1/NF-κB pathway.
Methods
Animals
All experimental protocols for this study were approved by the Animal Ethics Committee of Chongqing Medical University. The study complied with the National Insti- tutes of Health guide for the care and use of Laboratory Animals and the ARRIVE (Animal Research: Reporting In Vivo Experiments) guidelines. A total of 218 C57BL/6 mice (male, weight about 25 g) were purchased from and bred at the Animal Center of Chongqing Medical Univer- sity. All mice were housed in a light- and temperature- controlled room with free access to food and water.
Experimental design
Four separate experiments were designed as follows (Fig. 1). A total of 218 mice were used (Additional file 1: Table S1).
Experiment 1
The time course of endogenous Mc1r in the peri- hematoma tissue was measured by Western blot. The cellular localization of Mc1r was detected by double im- munofluorescence staining at 24 h after ICH.
Experiment 2
To evaluate the effects of NDP-MSH on neuroinflamma- tion and BBB integrity, three doses of NDP-MSH (1.5, 5, 15 μg/mouse, Anaspec, USA) dissolved in phosphate- buffered saline (PBS) were administered intraperitoneally at 1 h after ICH insult. Mice were randomly divided into five groups: sham, ICH + vehicle (PBS), ICH + NDP- MSH (1.5 μg/mouse), ICH + NDP-MSH (5 μg/mouse), and ICH + NDP-MSH (15 μg/mouse). Neurological test and brain water content were examined at 24 and 72 h after ICH. Evans blue (EB) extravasation was evaluated at 24 h after ICH.
Experiment 3
To assess the effect of in vivo knockdown of Mc1r on neuroinflammation and BBB permeability, Mc1r small interfering RNA (siRNA) was administered by intra- cerebroventricular (i.c.v) injection at 48 h before ICH in- duction, and then followed with NDP-MSH (5μg/ mouse) treatment at 1h after ICH. Neurological test, brain water content, EB extravasation, immunofluorescence staining, and Western blot were carried out at 24 h post- ICH. Mice were randomly divided into five groups: sham, ICH + vehicle (PBS), ICH + NDP-MSH (5 μg/mouse), ICH + NDP-MSH (5 μg/mouse) + scrambled siRNA (Scr

Wu et al. Journal of Neuroinflammation (2019) 16:192
Page 3 of 13
      Fig. 1 Experimental design and animal groups. ICH, intracerebral hemorrhage; Mc1r, melanocortin-1 receptor; Nr4a1, nuclear receptor subfamily 4 group A member 1; IF staining, immunofluorescence staining; WB, Western blot; Scr siRNA, scrambled siRNA
   siRNA), and ICH + NDP-MSH (5 μg/mouse) + Mc1r siRNA. In addition, to verify the knockdown efficiency of Mc1r siRNA, the expression of Mc1r in the right hemi- sphere was analyzed by Western blot. Mice were randomly assigned to four groups: Naive+Scr siRNA, Naive+Mc1r siRNA, ICH + Scr siRNA, and ICH + Mc1r siRNA.
Experiment 4
To investigate the underlying mechanisms of NDP-MSH- mediated neuroprotective effects, Nr4a1 siRNA was admin- istered by i.c.v injection at 48 h before ICH induction, and then followed with NDP-MSH (5 μg/mouse) treatment at 1 h after ICH. Neurological test, brain water content, and
Western blot were implemented at 24h following ICH. Mice were randomly allotted into five groups: sham, ICH + vehicle, ICH + NDP-MSH (5 μg/mouse), ICH + NDP-MSH (5 μg/mouse) + Scr siRNA, and ICH + DNP-MSH (5 μg/ mouse) + Nr4a1 siRNA. Moreover, to validate the knock- down efficiency of Nr4a1 siRNA, the expression of Nr4a1 was measured by Western blot. Mice were randomly assigned to four groups: Naive + Scr siRNA, Naive + Nr4a1 siRNA, ICH + Scr siRNA, and ICH + Nr4a1 siRNA.
ICH mouse model induction
The ICH model was induced by autologous blood injec- tion as previously described [22]. Briefly, the mice were

Wu et al. Journal of Neuroinflammation (2019) 16:192
Page 4 of 13
anesthetized and fixed prone in a stereotaxic frame. Drill a small hole about 1 mm in diameter at 2 mm to the right of the bregma. Then 30 μl autologous arterial blood without anticoagulation was drawn from the central ar- tery of the tail and delivered into the basal ganglion (stereotaxic coordinates: 0.2 mm anterior, 2.3 mm right lateral to the bregma, and 3.5 mm ventral to the skull). Firstly, 5 μl of blood was injected at 0.7 mm above the target position. Five minutes later, the remaining 25μl blood was delivered at 3.5mm depth. The needle was left for 10min more after injection and withdrawn slowly at a rate of 1 mm/min. Bone wax was then ap- plied to cover the drilled hole. The sham-operated ani- mals were delivered an equal volume of sterile saline at the same position.
Intracerebroventricular injection
Intracerebroventricular injection was performed as pre- viously described [23]. Briefly, mice were anesthetized and placed in a stereotactic head frame in the prone position. A longitudinal incision was made along the midline and a burr hole was drilled to the right of the bregma (1.0mm lateral of the bregma). Following the manufacturer’s instructions, Mc1r siRNA (Thermo Fisher Scientific, USA, MSS275666, GCG AUU CUG UAU GCC CAC AUG UUC A, UGA ACA UGU GGG CAU ACA GAA UCG C), Nr4a1 siRNA (Thermo Fisher Scientific, USA, MSS205160, GAA GAU GCC GGU GAC GUG CAA CAA U, AUU GUU GCA CGU CAC CGG CAU CUU C), or scramble siRNA was dissolved in sterile RNase-free water. Mc1r siRNA mixture or scram- ble siRNA (100 pmol/2 μl) was delivered into the ipsilat- eral ventricle at the depth of 2.5 mm. The needle was left for an additional 5 min after injection to avert pos- sible leakage and was slowly withdrawn at a rate of 1 mm/min. The burr hole was sealed with bone wax, and the incision was closed with sutures. Mice were placed in an individual recovery cage.
Neurobehavioral function test
Neurobehavioral functions were evaluated using the modified Garcia test and corner turn test at 24 or 72 h following ICH by a blinded investigator as previously de- scribed [24]. In the modified Garcia test, seven items in- cluding spontaneous activity, axial sensation, vibrissae touch, limb symmetry, lateral turning, forelimb walking, and climbing were tested. In the corner turn test, mice were allowed to approach a 30° corner. The mice exited the corner with either a right turn or left turn. Ten trials were performed, with at least a 30-s break between the trials. The percentage of a right turn to 10 trials was then calculated.
BBB permeability
To evaluate BBB permeability, Evans blue (Aladdin, China) was injected intraperitoneally (100 μl of 4% solution in sa- line) as previously described with a slight modification [25]. After 3 h circulation, mice were transcardially perfused with cold phosphate-buffered saline (0.1 M, PBS, pH 7.4) under deep anesthesia. Afterwards, the brain was removed and di- vided into left and right hemispheres and stored at − 80 °C immediately. The right part of the brain was homogenized in 1100 μl PBS, sonicated, and centrifuged (12,000 g, 4 °C, 30 min). The supernatant was collected and added an equal amount of trichloroacetic acid (TCA) to incubate overnight by 4 °C. After centrifugation (12,000 g, 4 °C, 30 min), Evans blue stain was measured by spectrophotometer (Thermo Fisher Scientific, USA) at 610 nm.
Brain water content
Brain water content was measured at 24 h and 72 h after ICH by an investigator blind to group information as previously described [26]. In short, mice were sacrificed under deep anesthesia. The brain was immediately re- moved and cut into 4 mm coronal slice. The brain slice was separated into five parts: ipsilateral and contralateral basal ganglia, ipsilateral and contralateral cortex, and cerebellum. The cerebellum was retained as an internal control. Each part was immediately weighed on an elec- tronic analytical balance (FA2204B, Techcomp, USA) to determine the wet weight (WW) and then dried at 100 °C for 72 h to determine the dry weight (DW). Brain water content (percentage) was calculated as [(WW− DW)/WW] × 100%.
Immunofluorescence staining
Double fluorescence staining was performed as described previously [27]. The mice were deeply anes- thetized and were transcardially perfused with 20 ml ice- cold PBS followed by 20 ml of 4% paraformaldehyde at 24 h post-ICH. The whole brain was collected and then fixed in 4% paraformaldehyde for another 24h. After- wards, the brain was fixed in 20% sucrose solution until the tissue sink to the bottom followed by 30% sucrose solution for another 24 h. After being frozen at − 25 °C, the brain was cut into 10-μm-thick coronal sections using a cryostat (CM1860; Leica Microsystems, Germany). To conduct double immunohistochemistry staining, the brain sections were incubated with primary antibody of anti-ionized calcium-binding adaptor molecule 1 (Iba-1, 1:100, Abcam, ab153696), anti-glial fi- brillary acidic protein (GFAP, 1:200, CST, 3670, AB_ 561049), anti-von Willebrand factor (vWF, 1:50, Santa Cruz, sc-365712, AB_10842026), anti-NeuN (1:100, Abcam, ab104224, AB_10711040), and anti-Mc1r (1:50, Genetex, GTX108190) overnight at 4 °C. After being in- cubated with the appropriate secondary antibody (1:200,

Wu et al. Journal of Neuroinflammation (2019) 16:192
Page 5 of 13
Bioss) at 37 °C for 1 h, the sections were visualized and photographed with a fluorescence microscope (U- HGLGPS, OLYMPUS, Japan). Microphotographs were analyzed with cellSens Standard software. The numbers of Iba-1-positive cells were identified and counted in three different fields in peri-hematoma area from five random coronal sections per brain, and data were expressed as cells/field.
Western blotting
After mice were perfused with ice-cold PBS (0.1 M, pH 7.4) at 24 h post-operation, the peri-hematoma tissues were col- lected and stored in − 80 °C freezer until use. Western blot- ting was performed as previously described [28]. After sample preparation, equal amounts of protein were loaded onto an SDS-PAGE gel. After being electrophoresed and transferred to a PVDF membrane, the membrane was blocked 2 h at 37 °C followed by incubated with the primary antibody overnight at 4°C. The primary antibodies were anti-Mc1r (1:1000, Abcam, ab180776), anti-Nr4a1 (1:500, Abcam, ab13851, AB_300679), anti-phospho-CREB (1: 1000, cell signaling, 9198, Ser133, AB_2561044), anti-CREB (1:1000, cell signaling, 9197, AB_331277), anti-phospho- NF-κB p65 (1:1000, cell signaling, 3033, AB_331284), anti- NF-κB p65 (1:1000, cell signaling, 8242, AB_10859369), anti-IL-1β (1:1000, cell signaling, 31202), anti-TNF-α (1: 1000, cell signaling, 11948, AB_2687962), anti-MMP-9 (1: 500, Abcam, ab38898, AB_776512), anti-occludin (1:50000, abcam, ab167161, AB_2756463), anti-ZO-1 (1:1000, affinity, AF5145), anti-Lama5 (1:1000, abcam, ab184330), and anti- β-actin (1:5000, proteintech, 60008-1-Ig). The secondary antibodies (ZSGB-BIO) were incubated for 1h at 37°C. Immunoblots were then probed with an ECL Plus chemiluminescence reagent kit (4A Biotech) and visualized with the image system (Bio-Rad, Universal Hood III). All data were analyzed using the software ImageJ.
Statistics analysis
All data were expressed as mean and standard devi- ation (mean ± SD). All analyses were performed using SigmaPlot 11.0 and GraphPad Prism 6 (GraphPad software, San Diego, CA, USA). Firstly, Shapiro-Wilk normality test was implemented in determining data normality. For the data that conformed to normal dis- tribution, one-way ANOVA analysis followed by Tukey’s post hoc test was used for multiple-group comparisons. For the data that failed the normality test, Kruskal-Wallis one-way ANOVA on ranks, followed by Tukey’s multiple comparison post hoc analysis was performed. Statistical differences between two groups were analyzed using Student’s unpaired, two-tailed t test. P value of less than 0.05 was defined statistically significant (Additional file 2).
Results
Mortality and exclusion
The total mortality of ICH mice was 9.34% (17/182) in this study. None of the sham group mice died. There was no significant difference in mortality rate among the ex- perimental groups. Six mice were ruled out from this study due to no hemorrhage (Additional file 1: Table S1).
Expression of Mc1r after ICH
As shown in Fig. 2a, the Mc1r expression in the peri- hematoma tissue was significantly increased at 24 h and reached its peak at 72 h after ICH, when compared to the sham group. Double immunofluorescence staining showed that Mc1r was mainly expressed in the micro- glia, astrocytes, and endothelial cells in the peri- hematoma tissue at 24 h after ICH (Fig. 2c).
Administration of NDP-MSH improved neurological deficits and reduced brain edema and BBB permeability after ICH
The neurological deficits and brain edema were evi- dently worse at 24 and 72 h post-ICH in the ICH + ve- hicle and ICH + NDP-MSH (1.5 μg/mouse) groups, when compared with sham group. However, the admin- istration of NDP-MSH (5 μg/mouse) and NDP-MSH (15 μg/mouse) significantly improved the neurological deficits (Fig. 3a, b) and reduced brain edema in ipsilat- eral basal ganglion (Fig. 3c). Based on these results, the optimal dose of NDP-MSH was 5 μg/mouse, which was used for the rest of the experiments. BBB permeability was assessed by EB extravasation in the right cerebral hemispheres. EB extravasation in the ICH + vehicle group was significantly increased at 24h after ICH, whereas NDP-MSH treatment (5 μg/mouse) prominently decreased EB dye leakage compared with the ICH + ve- hicle group (Fig. 3d).
Mc1r in vivo knockdown aggravated neurological deficits, brain edema, and BBB disruption after ICH
To further investigate, the protective role of NDP-MSH and Mc1r siRNA was administered by i.c.v injection to knockdown the expression of endogenous Mc1r. West- ern blot showed that the Mc1r expression was inhibited by Mc1r siRNA at 72h after injection (Fig. 4a). The knockdown of Mc1r abolished the protective effect of NDP-MSH on neurological functions (Fig. 4b, c), brain edema (Fig. 4d), and BBB integrity (Fig. 4e) at 24 h post- ICH.
Effect of NDP-MSH treatment and knockdown of Mc1r on the expression of downstream molecules after ICH Treatment with NDP-MSH increased phospho-CREB (p- CREB) expression in the peri-hematoma tissue at 24h post-ICH, which increased the expression of downstream

Wu et al. Journal of Neuroinflammation (2019) 16:192 Page 6 of 13
      Fig. 2 Expression of Mc1r after intracerebral hemorrhage (ICH). a Representative Western blot band and quantitative analyses of Mc1r time- dependent expression from the peri-hematoma tissue after ICH. #P < 0.05 vs sham. n = 6 per group. b Representative brain sample with schematic illustration presenting the four regions in peri-hematoma area (indicated by black boxes). c Representative images of double immunofluorescence staining showed that Mc1r was colocalized with microglia (Iba-1), endothelium (vWF), astrocyte (GFAP), and neuron (NeuN) and at 24h after ICH. n=3 per group. Scale bar=50μm
         Fig. 3 The neuroprotective effects of NDP-MSH on neurological functions, brain water content, and blood-brain barrier permeability after intracerebral hemorrhage (ICH). Treatment with NDP-MSH significantly improved neurological deficits (a and b) and reduced brain water content (c) at 24 and 72 h, as well as decreased EB extravasation at 24 h after ICH (d). n = 6 for each group. Brain sections were divided into five parts: ipsilateral basal ganglia (ipsi-BG), contralateral basal ganglia (contra-BG), ipsilateral cortex (ipsi-CX), contralateral cortex (contra-CX), and cerebellum. #P < 0.05 vs sham; *P < 0.05 vs vehicle and NDP-MSH (1.5 μg)
   
Wu et al. Journal of Neuroinflammation (2019) 16:192
Page 7 of 13
      Fig. 4 The effect of Mc1r siRNA on neurological functions, brain water content and BBB integrity at 24 h after ICH. a The expression of Mc1r was obviously reduced in the right hemisphere by Mc1r siRNA at 24 h post-ICH. &P < 0.05 vs Scr siRNA. b–e Knockdown of Mc1r using Mc1r siRNA aggravated neurological deficits and increased brain edema and BBB permeability at 24 h following ICH. n = 6 per group. #P < 0.05 vs sham; *P < 0.05 vs ICH + vehicle; @P < 0.05 vs ICH + NDP-MSH, and ICH + NDP-MSH + Scr siRNA. Scr siRNA, scrambled siRNA
   molecules including Nr4a1, ZO-1, occludin, and laminin- α5 (Lama5) and inhibited the expression of downstream inflammation-related proteins and MMP-9 (Fig. 5a-j), compared with ICH + vehicle group. In contrast, the knockdown of Mc1r using specific siRNA got opposite changes on the expression of downstream signaling mole- cules (Fig. 5a–j), compared with the ICH + NDP-MSH group.
Treatment with NDP-MSH decreased microglial counts after ICH
We investigated whether the anti-inflammatory function of NDP-MSH was associated with the decrease in the numbers of microglia in peri-hematoma tissue. As pre- sented in Fig. 6, the numbers of Iba-1-positive cells were dramatically increased in ICH + vehicle group at 24 h post-ICH. The administration of NDP-MSH significantly reduced the number of Iba-1-positive cells, whereas the knockdown of Mc1r abolished this effect.
Knockdown of Nr4a1 abolished the neuroprotective effects of NDP-MSH after ICH
To further determine whether the neuroprotective ef- fects of NDP-MSH were regulated by Nr4a1, Nr4a1 siRNA was administered by i.c.v injection at 48 h before ICH induction and treated with NDP-MSH at 24 h post- ICH. Nr4a1 siRNA significantly decreased Nr4a1 expres- sion at 72 h after injection (Fig. 7a). The knockdown of Nr4a1 exacerbated neurological impairments (Fig. 7b, c) and increased brain water content (Fig. 7d) at 24 h after ICH. Furthermore, the knockdown of Nr4a1 significantly increased the expression of p-NF-κB p65, IL-1β, TNF-α, and MMP-9 with a decrease of ZO-1, occludin, and Lama5 in the peri-hematoma tissue (Fig. 7e–l).
Discussion
The novel findings in the present study were as follows: (1) Mc1r was significantly increased in the peri- hematoma tissue after ICH; (2) the administration of

Wu et al. Journal of Neuroinflammation (2019) 16:192
Page 8 of 13
      Fig. 5 The effects of NDP-MSH treatment and knockdown of Mc1r on expression of downstream molecules at 24 h after ICH. a Representative Western blot bands of the downstream signaling pathway protein. b-j Densitometric quantification suggested that the administration of NDP- MSH, a agonist of Mc1r, prominently upregulated the levels of p-CREB, Nr4a1, ZO-1, occludin, and laminin-α5 (Lama5) at 24 h post-ICH . In addition, treatment with NDP-MSH significantly decreased p-NF-κB p65, IL-1β, TNF-α, and MMP-9 at the same time. In contrast, the knockdown of Mc1r led to a decrease of p-CREB, Nr4a1, ZO-1, occludin, and Lama5 and an increase of p-NF-κB p65, IL-1β, TNF-α, and MMP-9. #P < 0.05 vs sham; *P < 0.05 vs ICH + vehicle; @P < 0.05 vs ICH + NDP-MSH, and ICH + NDP-MSH + Scr siRNA. Scr siRNA, scrambled siRNA
   NDP-MSH attenuated brain edema and BBB disruption and improved neurological deficits following ICH; (3) treatment with NDP-MSH inhibited the expression of p- NF-κB p65, IL-1β, TNF-α, and MMP-9, as well as increased the expression of p-CREB, Nr4a1, ZO-1, occludin, and Lama5, thereby ameliorated brain injury post-ICH; (4) knockdown of Mc1r and Nr4a1 by specific siRNA aggravated neurological deficits, BBB damage, and inflammatory response after ICH; (5) CREB/Nr4a1/ NF-κB signaling pathway was the potential mechanism of neuroprotection of NDP-MSH. Taken together, our findings indicated that NDP-MSH, by binding to Mc1r, attenuated neruoinflammation and BBB disruption after ICH, which is at least in part mediated by CREB/Nr4a1/ NF-κB signaling pathway.
An ongoing body of researches demonstrated that in- flammatory reaction and BBB disruption are critical
factors to induce secondary brain injury following ICH [29, 30]. Following ICH, blood components rapidly enter the cerebral parenchyma and cause an inflammatory re- sponse. Furthermore, intensive inflammatory cascades aggravate BBB disruption, contribute to blood compo- nents infiltration into the brain in turn, and subse- quently trap in a vicious circle to exacerbate brain injury after ICH.
Numerous studies have revealed that α-MSH ana- log NDP-MSH could inhibit inflammation and pre- serve BBB integrity [12, 13, 31]. In rat microglial cells, NDP-MSH exerted its anti-inflammatory effect by promoting a M2-like phenotype in microglia [31]. Following subarachnoid hemorrhage, treatment with NDP-MSH reduced vasospasm and inflammation through the decrease in the phosphorylation of extracellular-signal-regulated kinases (ERK1/2) [12].

Wu et al. Journal of Neuroinflammation (2019) 16:192
Page 9 of 13
      Fig. 6 Microglial counts in the peri-hematoma area at 24 h following ICH. Representative microphotographs and quantification of Iba-1-stained microglia showed that NDP-MSH treatment reduced the number of Iba-1-positive cells, while this effect was reversed by Mc1r siRNA. #P < 0.05 vs sham; *P<0.05 vs ICH+vehicle; @P<0.05 vs ICH+NDP-MSH. n=3 per group, scale bar=50μm
   Furthermore, NDP-MSH preserved BBB integrity and ameliorated neuroinflammation by preventing im- mune cell infiltration into the brain in mice with EAE through Mc1r/CREB/Nr4a1 signaling pathway [13]. Consistent with previous findings, our results revealed that treatment with NDP-MSH contributed to the upregulation of p-CREB, Nr4a1, ZO-1, occlu- din, Lama5, and downregulation of MMP-9 and inflammation-related molecules, and thus, attenuated neuroinflammation and BBB breakdown after ICH.
NDP-MSH exerts an anti-inflammatory effect by binding to different melanocortin receptors (Mc1r to Mc5r) [10, 13, 32, 33]. However, it has been proven that NDP-MSH has a specific higher affinity for Mc1r than other receptors [8, 10, 11]. Mc1r is widely dis- tributed among various cell types, including macro- phage, neutrophils, endothelial cells, and astrocytes [10]. In the present study, we observed that Mc1r was mainly expressed in the microglia, astrocytes, and endothelial cells after ICH. Moreover, the knockdown of Mc1r with Mc1r siRNA significantly abolished neu- roprotective effects of NDP-MSH by increasing the expression of the inflammation-related molecules and MMP-9 and by decreasing the expression of ZO-1, occludin, and Lama5. Therefore, it is reasonable to speculate that Mc1r activation mediates NDP-MSH-
induced neuroprotective effects after ICH. However, the finding was different from the previous observations, which showed that activating Mc4r with NDP-MSH or RO27-3225 could alleviate inflamma- tory reaction in the animal model of testicular ische- mia and ICH [34, 35]. We supposed that such discrepancy may be due to the difference in animal models and tissue types.
Nr4a1 has been shown to inhibit inflammatory re- sponse by regulating the transcriptional activity of NF-κB [14, 18–20]. Nr4a1 also regulated microvessel permeability by increasing endothelial nitric-oxide synthase expression and by destabilizing endothelial junctions [36]. The NF-κB signaling pathway is well- known to be involved in mediating inflammatory re- sponse and BBB integrity after stroke [28, 37]. In the current study, the knockdown of Nr4a1 increased the expression of p-NF-κB p65, IL-1β, TNF-α, and MMP- 9; decreased the expression of ZO-1, occludin, and Lama5; and resulted in neuroinflammation and BBB disruption. Therefore, knockdown of Nr4a1 reversed the neuroprotective roles of NDP-MSH.
There are some limitations in our study. NDP-MSH had been reported to possess multiple beneficial properties in a central nervous system disease, including anti-inflammation, anti-apoptosis, and anti-oxidation

Wu et al. Journal of Neuroinflammation (2019) 16:192
Page 10 of 13
      Fig. 7 Knockdown of Nr4a1 reversed the neuroprotection of NDP-MSH following ICH. a The expression of Nr4a1 was significantly decreased in the right hemisphere by Nr4a1 siRNA at 24 h post-ICH. &P < 0.05 vs Scr siRNA. b–d Knockdown of Nr4a1 aggravated neurological deficits and increased brain edema at 24 h following ICH. e–l Knockdown of Nr4a1 reversed the neuroprotection of NDP-MSH-induced change in protein levels of p-NF-κB p65, IL-1β, TNF-α, MMP-9, ZO-1, occludin, and Lama5 after ICH. #P < 0.05 vs sham; *P < 0.05 vs ICH + vehicle; @P < 0.05 vs ICH + NDP-MSH, and ICH + NDP-MSH + Scr siRNA. Scr siRNA, scrambled siRNA
   [13, 31, 34, 38, 39]. In this study, we only investigated the neuroprotective functions of NDP-MSH on neuroin- flammation and BBB integrity after ICH. Thus, we can- not rule out the possibility that NDP-MSH-mediated anti-apoptosis and anti-oxidation may be involved in the neuroprotective effects after ICH. Further studies are
needed to explore other functions of NDP-MSH after ICH and its underlying mechanisms. Second, we did not investigate the NDP-MSH-induced long-term neuro- logical benefits following ICH. In addition, we only used male mice in this study. Thus, we cannot infer the effect of NDP-MSH on female mice after ICH.

Wu et al. Journal of Neuroinflammation (2019) 16:192
Page 11 of 13
      Fig. 8 The schematic diagram of potential molecular mechanisms of neuroprotective effects of NDP-MSH through CREB/Nr4a1/NF-κB pathway after ICH
   Conclusion
NDP-MSH binding Mc1r could alleviate neuroinflam- mation and BBB disruption and improve neurological impairments after ICH in mice. The neuroprotective role of NDP-SMH was mediated at least via CREB/Nr4a1/ NF-κB signaling pathway (Fig. 8). Therefore, NDP-MSH might serve as a potential therapeutic agent against neu- roinflammation for ICH patients.
Supplementary information
Supplementary information accompanies this paper at https://doi.org/10. 1186/s12974-019-1591-4.
Abbreviations
BBB: Blood-brain barrier; CREB: cAMP response element-binding protein; GFAP: Glial fibrillary acidic protein; Iba-1: Ionized calcium-binding adaptor molecule 1; ICH: Intracerebral hemorrhage; Mc1r: Melanocortin-1 receptor; NDP-MSH: Nle4-D-Phe7-α-MSH; Nr4a1: Nuclear receptor subfamily 4 group A member 1; vWF: von Willebrand factor; α-MSH: α-Melanocyte-stimulating hormone
Acknowledgements
The authors thank Prof. Mei Yang from the Department of Human Anatomy, Chongqing Medical University, for providing experimental assistance.
Authors’ contributions
XW and ZX designed the research. XW, SF, YW, and MG performed the research. YL, HL, FL, and YC analyzed the data. XW and ZX wrote the manuscript. All authors read and approved the final manuscript.
Funding
This work was supported by the National Natural Science Foundation of China (81771961) and Kuanren Talents Program of the Second Affiliated Hospital of Chongqing Medical University (201959).
Availability of data and materials
The data used in the present study are available from the corresponding author on reasonable request.
Ethics approval and consent to participate
All experimental protocols for this study were approved by the Animal Ethics Committee of Chongqing Medical University in accordance with the National Institutes of Health guidelines for the care and use of experimental animals.
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
   Additional file 1: Table S1. Summary of experimental groups and mortality rate in the study.
Additional file 2: Table S2. The t statistic and degrees of freedom of results.
  
Wu et al. Journal of Neuroinflammation (2019) 16:192
Page 12 of 13
Author details
1Department of Neurosurgery, The Second Affiliated Hospital, Chongqing Medical University, 76th Linjiang Road, Yuzhong District, Chongqing 400010, China. 2Department of Human Anatomy, Chongqing Medical University, Chongqing 400016, China.
Received: 15 January 2019 Accepted: 20 September 2019
References
1. Hemphill JC 3rd, Adeoye OM, Alexander DN, Alexandrov AW, Amin-Hanjani S, Cushman M, George MG, LeRoux PD, Mayer SA, Qureshi AI, et al. Clinical performance measures for adults hospitalized with intracerebral hemorrhage: performance measures for healthcare professionals from the American Heart Association/American Stroke Association. Stroke. 2018;49: e243–61.
2. Xi T, Jin F, Zhu Y, Wang J, Tang L, Wang Y, Liebeskind DS, He Z. MicroRNA- 126-3p attenuates blood-brain barrier disruption, cerebral edema and neuronal injury following intracerebral hemorrhage by regulating PIK3R2 and Akt. Biochem Biophys Res Commun. 2017;494(1–2):144–51.
3. Brzoska T, Luger TA, Maaser C, Abels C, Bohm M. Alpha-melanocyte- stimulating hormone and related tripeptides: biochemistry, antiinflammatory and protective effects in vitro and in vivo, and future perspectives for the treatment of immune-mediated inflammatory diseases. Endocr Rev. 2008;29:581–602.
4. Anderson EJ, Cakir I, Carrington SJ, Cone RD, Ghamari-Langroudi M, Gillyard T, Gimenez LE, Litt MJ. 60 YEARS OF POMC: regulation of feeding and energy homeostasis by alpha-MSH. J Mol Endocrinol. 2016;56:T157–74.
5. Singh M, Mukhopadhyay K. Alpha-melanocyte stimulating hormone: an emerging anti-inflammatory antimicrobial peptide. Biomed Res Int. 2014; 2014:874610.
6. Catania A. Neuroprotective actions of melanocortins: a therapeutic opportunity. Trends Neurosci. 2008;31:353–60.
7. Holloway PM, Durrenberger PF, Trutschl M, Cvek U, Cooper D, Orr AW, Perretti M, Getting SJ, Gavins FNE. Both MC1 and MC3 receptors provide protection from cerebral ischemia-reperfusion-induced neutrophil recruitment. Arterioscler Thromb Vasc Biol. 2015;35:1936–44.
8. Holloway PM, Smith HK, Renshaw D, Flower RJ, Getting SJ, Gavins FNE. Targeting the melanocortin receptor system for anti-stroke therapy. Trends Pharmacol Sci. 2011;32:90–8.
9. Herraiz C, Garcia-Borron JC, Jimenez-Cervantes C, Olivares C. MC1R signaling. Intracellular partners and pathophysiological implications. Biochim Biophys Acta. 2017;1863:2448–61.
10. Catania A, Gatti S, Colombo G, Lipton JM. Targeting melanocortin receptors as a novel strategy to control inflammation. Pharmacol Rev. 2004;56:1–29.
11. Getting SJ. Targeting melanocortin receptors as potential novel therapeutics. Pharmacol Ther. 2006;111:1–15.
12. Gatti S, Lonati C, Acerbi F, Sordi A, Leonardi P, Carlin A, Gaini SM, Catania A. Protective action of NDP-MSH in experimental subarachnoid hemorrhage. Exp Neurol. 2012;234:230–8.
13. Mykicki N, Herrmann AM, Schwab N, Deenen R, Sparwasser T, Limmer A, Wachsmuth L, Klotz L, Köhrer K, Faber C, et al. Melanocortin-1 receptor activation is neuroprotective in mouse models of neuroinflammatory disease. Sci Transl Med. 2016;8:146.
14. Rothe T, Ipseiz N, Faas M, Lang S, Perez-Branguli F, Metzger D, Ichinose H, Winner B, Schett G, Kronke G. The nuclear receptor Nr4a1 acts as a microglia rheostat and serves as a therapeutic target in autoimmune-driven central nervous system inflammation. J Immunol. 2017;198:3878–85.
15. Smith AG, Luk N, Newton RA, Roberts DW, Sturm RA, Muscat GE. Melanocortin-1 receptor signaling markedly induces the expression of the NR4A nuclear receptor subgroup in melanocytic cells. J Biol Chem. 2008; 283:12564–70.
16. De Miranda BR, Popichak KA, Hammond SL, Jorgensen BA, Phillips AT, Safe S, Tjalkens RB. The Nurr1 activator 1,1-bis(3′-indolyl)-1-(p- chlorophenyl)methane blocks inflammatory gene expression in BV-2 microglial cells by inhibiting nuclear factor kappaB. Mol Pharmacol. 2015;87: 1021–34.
17. McEvoy C, de Gaetano M, Giffney HE, Bahar B, Cummins EP, Brennan EP, Barry M, Belton O, Godson CG, Murphy EP, et al. NR4A receptors differentially regulate NF-kappaB signaling in myeloid cells. Front Immunol. 2017;8:7.
18. Hamers AA, van Dam L, Teixeira Duarte JM, Vos M, Marinkovic G, van Tiel CM, Meijer SL, van Stalborch AM, Huveneers S, Te Velde AA, et al. Deficiency of nuclear receptor Nur77 aggravates mouse experimental colitis by increased NFkappaB activity in macrophages. PLoS One. 2015;10:e0133598.
19. Popichak KA, Hammond SL, Moreno JA, Afzali MF, Backos DS, Slayden RD, Safe S, Tjalkens RB. Compensatory expression of Nur77 and Nurr1 regulates NF-kappaB-dependent inflammatory signaling in astrocytes. Mol Pharmacol. 2018;94:1174–86.
20. Liu TY, Yang XY, Zheng LT, Wang GH, Zhen XC. Activation of Nur77 in microglia attenuates proinflammatory mediators production and protects dopaminergic neurons from inflammation-induced cell death. J Neurochem. 2017;140:589–604.
21. You B, Jiang YY, Chen S, Yan G, Sun J. The orphan nuclear receptor Nur77 suppresses endothelial cell activation through induction of IkappaBalpha expression. Circ Res. 2009;104:742–9.
22. Rynkowski MA, Kim GH, Komotar RJ, Otten ML, Ducruet AF, Zacharia BE, Kellner CP, Hahn DK, Merkow MB, Garrett MC, et al. A mouse model of intracerebral hemorrhage using autologous blood infusion. Nat Protoc. 2008;3:122–8.
23. Xie Z, Huang L, Enkhjargal B, Reis C, Wan W, Tang J, Cheng Y, Zhang JH. Recombinant Netrin-1 binding UNC5B receptor attenuates neuroinflammation and brain injury via PPARgamma/NFkappaB signaling pathway after subarachnoid hemorrhage in rats. Brain Behav Immun. 2018; 69:190–202.
24. Krafft PR, McBride DW, Lekic T, Rolland WB, Mansell CE, Ma Q, Tang J, Zhang JH. Correlation between subacute sensorimotor deficits and brain edema in two mouse models of intracerebral hemorrhage. Behav Brain Res. 2014;264: 151–60.
25. Xie Z, Enkhjargal B, Reis C, Huang L, Wan W, Tang J, Cheng Y, Zhang JH. Netrin-1 preserves blood-brain barrier integrity through deleted in colorectal cancer/focal adhesion kinase/RhoA signaling pathway following subarachnoid hemorrhage in rats. J Am Heart Assoc. 2017;19:6.
26. Tong LS, Shao AW, Ou YB, Guo ZN, Manaenko A, Dixon BJ, Tang J, Lou M, Zhang JH. Recombinant Gas6 augments Axl and facilitates immune restoration in an intracerebral hemorrhage mouse model. J Cereb Blood Flow Metab. 2017;37:1971–81.
27. Xie Z, Huang L, Enkhjargal B, Reis C, Wan W, Tang J, Cheng Y, Zhang JH. Intranasal administration of recombinant Netrin-1 attenuates neuronal apoptosis by activating DCC/APPL-1/AKT signaling pathway after subarachnoid hemorrhage in rats. Neuropharmacology. 2017;119:123–33.
28. Zhu Q, Enkhjargal B, Huang L, Zhang T, Sun C, Xie Z, Wu P, Mo J, Tang J, Xie Z, et al. Aggf1 attenuates neuroinflammation and BBB disruption via PI3K/Akt/NF-kappaB pathway after subarachnoid hemorrhage in rats. J Neuroinflammation. 2018;15:178.
29. Zhou Y, Wang Y, Wang J, Anne Stetler R, Yang QW. Inflammation in intracerebral hemorrhage: from mechanisms to clinical translation. Prog Neurobiol. 2014;115:25–44.
30. Keep RF, Andjelkovic AV, Xiang J, Stamatovic SM, Antonetti DA, Hua Y, Xi G. Brain endothelial cell junctions after cerebral hemorrhage: changes, mechanisms and therapeutic targets. J Cereb Blood Flow Metab. 2018;38: 1255–75.
31. Carniglia L, Ramirez D, Durand D, Saba J, Caruso C, Lasaga M. [Nle4, D- Phe7]-alpha-MSH inhibits toll-like receptor (TLR)2- and TLR4-induced microglial activation and promotes a M2-Like phenotype. PLoS One. 2016; 11:e0158564.
32. Saba J, Carniglia L, Ramirez D, Turati J, Imsen M, Durand D, Lasaga M, Caruso C. Melanocortin 4 receptor activation protects striatal neurons and glial cells from 3-nitropropionic acid toxicity. Mol Cell Neurosci. 2019;94:41–51.
33. Catania A, Lonati C, Sordi A, Leonardi P, Carlin A, Gatti S. The peptide NDP- MSH induces phenotype changes in the heart that resemble ischemic preconditioning. Peptides. 2010;31:116–22.
34. Minutoli L, Bitto A, Squadrito F, Irrera N, Rinaldi M, Nicotina PA, Arena S, Magno C, Marini H, Spaccapelo L, et al. Melanocortin 4 receptor activation protects against testicular ischemia-reperfusion injury by triggering the cholinergic antiinflammatory pathway. Endocrinology. 2011;152:3852–61.
35. Chen S, Zhao L, Sherchan P, Ding Y, Yu J, Nowrangi D, Tang J, Xia Y, Zhang JH. Activation of melanocortin receptor 4 with RO27-3225 attenuates neuroinflammation through AMPK/JNK/p38 MAPK pathway after intracerebral hemorrhage in mice. J Neuroinflammation. 2018;15:106.
36. Zhao D, Qin L, Bourbon PM, James L, Dvorak HF, Zeng H. Orphan nuclear transcription factor TR3/Nur77 regulates microvessel permeability by
 
 Wu et al. Journal of Neuroinflammation (2019) 16:192 Page 13 of 13
targeting endothelial nitric oxide synthase and destabilizing endothelial
junctions. Proc Natl Acad Sci U S A. 2011;108:12066–71.
37. LiuY,TangG,LiY,WangY,ChenX,GuX,ZhangZ,WangY,YangGY. Metformin attenuates blood-brain barrier disruption in mice following
middle cerebral artery occlusion. J Neuroinflammation. 2014;11:177.
38. Ramirez D, Saba J, Turati J, Carniglia L, Imsen M, Mohn C, Scimonelli T, Durand
D, Caruso C, Lasaga M. NDP-MSH reduces oxidative damage induced by
palmitic acid in primary astrocytes. J Neuroendocrinol. 2019;31:e12673.
39. Ramirez D, Saba J, Carniglia L, Durand D, Lasaga M, Caruso C. Melanocortin
4 receptor activates ERK-cFos pathway to increase brain-derived neurotrophic factor expression in rat astrocytes and hypothalamus. Mol Cell Endocrinol. 2015;411:28–37.
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Uhohinc

unread,
Nov 20, 2020, 9:42:32 AM11/20/20
to Clinuvel Afamelanotide SCENESSE senescence CUV ASX.CUV CLVLY ur9
To clarify, the above study is not an ischemic stroke, ischemic is the stroke whereby a clot or vascular  plaque that usually breaks away from carotid in neck .........Ischemic is what Prenumbra appears to be the type Clinuvel is targeting....to prevent the inflammatory brain  damage immediately after this stroke 

This study indicating positive toward better outcome in a bleeding in brain stroke....often from an latent annuryism or sudden and high blood pressure increase.

This is very fortuitous for Clinuvel. Very good because upon a stroke, which drugs and thinners is used by the attending physician are held off to scan to ascertain which type of stroke.
If its a bleeding in brain stroke, the blood thinners that are helpful for an ischemic stroke can do more damage or kill in case its a cerebral (bleeding) hemorraghic stroke. Time is very important as damage to brain accrues  by the minute.

This would maybe play out that upon symptoms of stroke, the Clinuvel drug could be shot into the blood right away, and the scan can be done asap.

This broadens the therapeutic potential in multifold in the intended ischemic stroke in itself by removing physicians timidity........and as a therapy in all types of strokes.

Johnny H

unread,
Nov 20, 2020, 10:30:15 PM11/20/20
to Clinuvel Afamelanotide SCENESSE senescence CUV ASX.CUV CLVLY ur9
Huh.  This accidentally got deleted.  You write it, you own it.
Compelling Evidence (again) that msh could be the only and a PROFOUND treatment for an Isc. Stroke Patient befor and soon after.png

Uhohinc

unread,
Nov 21, 2020, 8:57:13 AM11/21/20
to Clinuvel Afamelanotide SCENESSE senescence CUV ASX.CUV CLVLY ur9
Verrrrrry interesting. I am pretty sure , but not completely,,,,,,that the only one whom can delete a post is me since i reset.....maybe the poster can still delete.....
Someone could have reported the “sick and twisted” to google.....but I think its another phrase that gets red flagged auto remove or for review.  I think red flagged for review as the phrase was there a few days....but, it does not say “ deleted”

Uhohinc

unread,
Nov 21, 2020, 8:59:34 AM11/21/20
to Clinuvel Afamelanotide SCENESSE senescence CUV ASX.CUV CLVLY ur9
No I correct myself it does say deleted....

Uhohinc

unread,
Nov 21, 2020, 9:00:48 AM11/21/20
to Clinuvel Afamelanotide SCENESSE senescence CUV ASX.CUV CLVLY ur9
Now we see what happens to it.........

Uhohinc

unread,
Nov 27, 2020, 12:22:53 PM11/27/20
to Clinuvel Afamelanotide SCENESSE senescence CUV ASX.CUV CLVLY ur9
Still there....Zero did you delete, i just want to know for informational reason, the sick and twisted comment I do not care ?

Zero tolerance

unread,
Nov 27, 2020, 3:17:04 PM11/27/20
to Clinuvel Afamelanotide SCENESSE senescence CUV ASX.CUV CLVLY ur9
Yes, uhoh.  The breathalyzer hasn't been installed on my laptop yet, so I often have to clean up digital messes.


Uhohinc

unread,
Apr 22, 2021, 2:59:43 PM4/22/21
to Clinuvel Afamelanotide SCENESSE senescence CUV ASX.CUV CLVLY ur9
above here, in 2014, when i wrote the lullaby about strokes, Clinvuel stock was a 100m market cap

Uhohinc

unread,
May 3, 2021, 2:02:57 AM5/3/21
to Clinuvel Afamelanotide SCENESSE senescence CUV ASX.CUV CLVLY ur9
Oxid Med Cell Longev
. 2020 Nov 12;2020:8864100.
 doi: 10.1155/2020/8864100. eCollection 2020.
Activation of the Melanocortin-1 Receptor by NDP-MSH Attenuates Oxidative Stress and Neuronal Apoptosis through PI3K/Akt/Nrf2 Pathway after Intracerebral Hemorrhage in Mice
Affiliations expand
Free PMC article
Abstract

Oxidative stress and neuronal apoptosis play crucial roles in secondary brain injury (SBI) after intracerebral hemorrhage (ICH). Recently, Nle4-D-Phe7-α-melanocyte-stimulating hormone (NDP-MSH), a synthetic agonist of the melanocortin-1 receptor (Mc1r), has been proved to inhibit neuroinflammatory in several diseases. This study is aimed at exploring if NDP-MSH could reduce oxidative stress and neuronal apoptosis following ICH, as well as the potential mechanism. A mouse ICH model was induced by autologous blood injection. NDP-MSH was intraperitoneally injected at 1 h after ICH. Mc1r siRNA and PI3K inhibitor LY294002 were administrated to inhibit the expression of Mc1r and phosphorylation of PI3K, respectively. Neurological test, brain water content, enzyme-linked immunosorbent assay (ELISA), terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling (TUNEL), immunofluorescence, and Western blot analysis were utilized in this study. The results exhibited that Mc1r was mainly expressed in neurons, and its level in the ipsilateral hemisphere was significantly elevated after ICH. NDP-MSH treatment significantly attenuated the neurological deficits and brain water content 24 hours after ICH, which was accompanied by the inhibition of oxidative stress and neuronal apoptosis. The administration of NDP-MSH after ICH significantly promoted the expression of Mc1r, p-PI3K, p-Akt, and p-Nrf2, followed by an increase of Bcl-2 and reduction of cleaved caspase-3. Conversely, downregulating the expression of Mc1r and phosphorylation of PI3K aggravated the neurological deficits and brain edema at 24 hours after ICH, meanwhile, the effect of NDP-MSH on the expression of Mc1r, p-PI3K, p-Akt, p-Nrf2, Bcl-2, and cleaved caspase 3 was also abolished. In conclusion, our data suggest that the activation of Mc1r by NDP-MSH ameliorates oxidative stress and neuronal apoptosis through the PI3K/Akt/Nrf2 signaling pathway after ICH in mice.

Copyright © 2020 Siming Fu et al.

Conflict of interest statement

The authors declare no conflicts of interest.

Figures

Figure 1 

Experimental design and animal groups.…

 

Figure 2 

Endogenous expression of Mc1r after…

 

Figure 3 

The administration of NDP-MSH improved…

 

Figure 4 

Oxidative stress-related proteins were detected…

 

Figure 5 

Effects of NDP-MSH on neuronal…

 

Figure 6 

Knockdown of Mc1r expression abolished…

All figures (7)
Similar articles
References
    1. Hemphill J. C., Adeoye O. M., Alexander D. N., et al. Clinical performance measures for adults hospitalized with intracerebral hemorrhage: performance measures for healthcare professionals from the American Heart Association/American Stroke Association. Stroke. 2018;49(7):e243–e261. doi: 10.1161/STR.0000000000000171. - DOI PubMed
    1. Hemphill JC 3rd, Greenberg S. M., Anderson C. S., et al. Guidelines for the management of spontaneous intracerebral hemorrhage: a guideline for healthcare professionals from the American Heart Association/American Stroke Association. Stroke. 2015;46(7):2032–2060. doi: 10.1161/STR.0000000000000069. - DOI PubMed
    1. Wang Z., Zhou F., Dou Y., et al. Melatonin alleviates intracerebral hemorrhage-induced secondary brain injury in rats via suppressing apoptosis, inflammation, oxidative stress, DNA damage, and mitochondria injury. Translational Stroke Research. 2018;9(1):74–91. doi: 10.1007/s12975-017-0559-x. - DOI PMC PubMed
    1. Xie R. X., Li D. W., Liu X. C., et al. Carnosine Attenuates Brain Oxidative Stress and Apoptosis After Intracerebral Hemorrhage in Rats. Neurochemical Research. 2017;42(2):541–551. doi: 10.1007/s11064-016-2104-9. - DOI PubMed
    1. Duan X., Wen Z., Shen H., Shen M., Chen G. Intracerebral hemorrhage, oxidative stress, and antioxidant therapy. Oxidative Medicine and Cellular Longevity. 2016;2016:17. doi: 10.1155/2016/1203285.1203285 - DOI PMC PubMed
Show all 49 references 
Related information
LinkOut - more resources

Uhohinc

unread,
May 3, 2021, 5:49:56 AM5/3/21
to Clinuvel Afamelanotide SCENESSE senescence CUV ASX.CUV CLVLY ur9
Long-Term Survival and Causes of Death After Stroke
and for the Danish MONICA Study Group
Originally published1 Sep 2001https://doi.org/10.1161/hs0901.094253Stroke. 2001;32:2131–2136

    Abstract

    Background and Purpose As part of the Danish contribution to the World Health Organization (WHO) MONICA (Monitoring Trends and Determinants in Cardiovascular Disease) Project, a register of patients with stroke was established in 1982. The purpose of the present study was to analyze long-term survival and causes of death after a first stroke and to compare them with those of the background population.

    Methods The study population comprised all subjects aged 25 years or older who were resident in a geographically defined region in Copenhagen County. All stroke events in the study population during 1982–1991 were ascertained and validated according to standardized criteria outlined for the WHO MONICA Project. After completion of the stroke registry at the end of 1991, all patients were followed up by record linkage to official registries. Standardized mortality ratios were calculated for various causes of death and periods after the stroke.

    Results The estimated cumulative risks for death at 28 days, 1 year, and 5 years after onset were 28%, 41%, and 60%, respectively. Compared with the general population, nonfatal stroke was associated with an almost 5-fold increase in risk for death between 4 weeks and 1 year after a first stroke and a 2-fold increase in the risk for death subsequent to 1 year. The excess mortality rate in stroke patients was due mainly to cardiovascular diseases but also to cancer, other diseases, accidents, and suicide. The probability for long-term survival improved significantly during the observation period for patients with ischemic or ill-defined stroke.

    Conclusions Stroke is a medical emergency associated with a very high risk for death in the acute and subacute phases and with a continuous excess risk of death. Better prevention and management of strokes may improve the long-term survival rate.

    Knowledge of the epidemiology of stroke has increased over the last decades, although it is well established that stroke is associated with a high risk for death, especially in the first few weeks after the attack. Studies of incidence and mortality have shown that case fatality rates vary considerably among populations.1,2 Few studies have been published on the long-term prognosis after stroke, and they are somewhat heterogeneous as regards study objectives, design, and the subjects investigated.

    Studies of the determinants and probabilities of survival and at various times after the index stroke have included all strokes,3 first stroke,4–6 or ischemic stroke,7–10 with emphasis on stroke subtype,11 age,12 or place of management.13 The absolute risk for death after a stroke is an appropriate variable in analyses of prognostic factors, but the inferences to be drawn from the absolute survival probability may be limited because most stroke patients were in their 70s or 80s. Few community-based studies have included comparisons of mortality rates after stroke with the mortality rates and causes of death in the general population of the same age and sex.4–6,14

    In this article we describe the long-term absolute and relative risks for death and the causes of death of a large, unselected, community-based cohort of stroke patients registered in the Danish portion of the World Health Organization (WHO) MONICA (Monitoring Trends and Determinants in Cardiovascular Disease) Project and compare them with the background population from which the cohort was drawn.

    Subjects and Methods

    A stroke register was established within the Glostrup Population Studies in 1982, with the objective of monitoring stroke events in the community over a 10-year period15 and contributing data to the WHO MONICA Project.1,2

    The Danish MONICA population was defined as all residents (approximately 330 000) of 11 municipalities in Copenhagen County. Stroke events were registered among the subpopulation aged 25 years or older (approximately 210 000), and validated, irrespective of survival status and place of occurrence and management. Multiple and overlapping sources were used to identify strokes among both hospitalized and nonhospitalized patients. The details of case ascertainment were described recently.15

    Stroke was defined as rapidly developing signs of focal (or global) disturbance of cerebral function lasting >24 hours (unless interrupted by surgery or death), with no apparent nonvascular cause; the study population included patients presenting with clinical signs and symptoms suggestive of subarachnoid hemorrhage, intracerebral hemorrhage, or cerebral infarct.

    At the end of 1991, when the stroke register was completed, 5262 stroke events had been registered prospectively for the 10 years. The events were subdivided into first or recurrent and into fatal or nonfatal, a fatal stroke being defined as one in which death occurred within 28 days. All patients were followed up for vital status for at least 5.5 years (range, 5.5 to 15.5 years) and for causes of death for at least 4 years (range, 4 to 14 years). Data were obtained by record linkage to the Danish Civil Registration System and the Cause of Death Registry on the basis of the unique individual person number (a 10-digit code including the date of birth). Data on deaths and causes of death in the general population covered by the stroke register (the Danish MONICA population), distributed by sex, age, and calendar year, were derived from the same official registries. The expected number of deaths in the general population was estimated for each sex by calculating the age- and time-specific person-years of observation multiplied by the similar age- and time-specific population death rate. Standardized mortality ratios (SMRs) and excess death rates (EDRs) were estimated and 95% confidence limits were established after it was assumed that the numbers of deaths followed a Poisson distribution. The SMR is the quotient of the observed to the expected numbers of deaths, and the EDR is the observed minus the expected number of deaths per 1000 person-years. The SMR is suitable for comparing mortality rates among stroke patients with those of the general population, whereas EDR is a measure of the excess number of deaths due to the disease over that expected. SMRs and EDRs were calculated for all causes of death, and SMRs were calculated for specific causes of death: cardiovascular diseases, cancer, other diseases, accidents, and suicide. Information on the cause of death after a nonfatal stroke (ie, among 28-day survivors) was available for 1828 patients who died before January 1, 1996; no information was available in 11 such cases.

    For patients who survived for at least 28 days but for whom the exact date of onset of stroke was not specified, it was assumed to have occurred on the 15th day of the month. One hundred seventy-three patients with fatal stroke were randomly assigned a survival time between 0 and 27 days when only month of onset was known and death occurred before the 28th day in the following month.

    Stroke was clinically defined in the protocol of the MONICA Project. The stroke subtype was recorded for patients with fatal stroke who were examined postmortem and for patients examined by neuroimaging techniques within 28 days of onset. Cases with insufficient data on stroke subtype were labeled “acute but ill-defined stroke.” Since stroke was defined as an event lasting 28 days, we chose to regard stroke as the cause of death in fatal events. Hence, we analyzed short-term survival in relation to the subtype of stroke but did not further explore the direct cause of death in these cases. Because the protocol of the MONICA Project did not include clinical data on the severity of stroke or on comorbidity in individual patients, our data do not permit analyses of determinants of survival.

    Time trends in survival probability up to 5 years after a stroke were analyzed in a Cox regression model that included the covariates sex, age at stroke onset, and time. Changes in mortality rates in the general population were taken into account by including the expected number of deaths in the model with the “offset variable” facility in the “proc phreg” procedure in the SAS software package.16

    Results

    A total of 4162 patients with a first stroke were eligible for the analyses. Table 1 shows the proportions of fatal and nonfatal stroke by sex and age group.

    Fatal and Nonfatal First Strokes in the Danish MONICA Population 1982–1991, by Sex and Age

    StrokeMenWomen25–69 y≥70 y≥25 y25–69 y≥70 y≥25 yNo.%No.%No.%No.%No.%No.%
    Fatal
    237
    18.1
    296
    33.8
    533
    24.4
    169
    22.6
    470
    38.3
    639
    32.4
    Nonfatal
    1073
    81.9
    581
    66.2
    1654
    75.6
    580
    77.4
    756
    61.7
    1336
    67.6
    All
    1310
    100.0
    877
    100.0
    2187
    100.0
    749
    100.0
    1226
    100.0
    1975
    100.0

    Short-Term Survival by Stroke Subtype

    Valid information on stroke subtype was available for 1887 (45.3%) of the patients. The subtypes were cerebral infarct in 1318, primary intracerebral hemorrhage in 331, and subarachnoid hemorrhage in 238. The remaining 2275 were classified as ill-defined stroke. The patients with subarachnoid hemorrhage were younger than the other patients (mean age, 53.1 years), whereas patients with documented cerebral infarct or primary intracerebral hemorrhage were of similar ages, the mean ages being 61.4 years and 62.8 years, respectively. Sufficient information on stroke subtype was more frequently available for younger than for older patients: the mean age of patients with ill-defined stroke was 74.0 years. Figure 1 shows the Kaplan-Meier estimates of the survival probability for each stroke subtype and ill-defined stroke. The short-term survival probability was clearly best for cerebral infarct and poorest for primary intracerebral hemorrhage. The patients with ill-defined stroke had survival probabilities similar to those with known cerebral infarct, despite their markedly greater age.

    Figure 1. Short-term survival probability (Kaplan-Meier estimates) after a first stroke by subtype. SAH indicates subarachnoid hemorrhage; PICH, primary intracerebral hemorrhage; CI, cerebral infarct; and IDS, ill-defined stroke.

    Long-Term Survival

    A total of 2990 patients (72%) survived their first stroke by >27 days, and 2448 (59%) were still alive 1 year after the stroke; thus, 41% died after 1 year. The risk for death between 4 weeks and 12 months after the first stroke was 18.1% (95% CI, 16.7% to 19.5%). After the first year, the annual risk for death was approximately 10% and remained almost constant.

    The estimated cumulative risk for death was 60%, 76%, and 86% at 5, 10, and 15 years after index stroke, respectively.

    Figure 2 shows the long-term survival probability for a person aged 65 at the time of a first nonfatal stroke. The prognosis was better for subarachnoid hemorrhage than for the other 3 categories (P<0.001, adjusted for the effect of sex and age). There were no differences in long-term survival for the other 3 categories (P=0.16).

    Figure 2. Long-term survival probability for patients aged 65 years at first nonfatal stroke by subtype (Cox regression). Abbreviations are as defined in Figure 1.

    Table 2 shows the SMRs and EDRs for men and women by age group for various periods after a nonfatal stroke. Those who had survived their initial stroke by 4 weeks had an almost 5-fold greater risk for dying within 1 year after the stroke than persons of the same age and sex in the general population in the same geographic area. The excess risk for death was significantly higher for women than for men during the first year after a stroke but did not differ significantly between sexes after the first year.

    SMRs* and EDRs† by Sex and Age for Patients After a First Nonfatal Stroke

    Age Group, yYears After StrokeSMR (95% CI)EDR (95% CI)MenWomenAllMenWomenAll
    *Quotient of observed to expected numbers of deaths.
    †Observed minus expected number of deaths per 1000 person-years.
    25–69
    0–1
    4.64 (3.71–5.72)
    9.27 (6.94–12.1)
    5.72 (4.81–6.75)
    66.7 (49.8–86.6)
    86.8 (62.4–117)
    73.7 (59.5–89.8)

    1–5
    3.01 (2.63–3.43)
    3.52 (2.80–4.35)
    3.14 (2.80–3.50)
    43.3 (35.1–52.3)
    31.1 (22.3–41.4)
    38.9 (32.7–45.7)

    5–10
    2.75 (2.39–3.15)
    3.32 (2.66–4.09)
    2.90 (2.58–3.25)
    49.9 (39.5–61.3)
    38.6 (27.6–51.4)
    45.6 (37.9–54.0)

    10–15
    2.50 (1.94–3.18)
    2.45 (1.60–3.59)
    2.49 (2.01–3.05)
    55.5 (34.7–80.4)
    31.2 (13.0–55.8)
    45.7 (30.9–62.8)
    ≥70
    0–1
    3.70 (3.15–4.32)
    5.18 (4.54–5.87)
    4.46 (4.04–4.92)
    245 (195–301)
    328 (278–383)
    291 (255–329)

    1–5
    1.92 (1.68–2.18)
    2.05 (1.81–2.30)
    1.99 (1.82–2.17)
    93.3 (69.2–120)
    92.9 (71.8–116)
    93.1 (77.0–110)

    5–10
    1.89 (1.56–2.27)
    1.99 (1.67–2.36)
    1.94 (1.71–2.20)
    117 (73.8–166)
    104 (69.6–142)
    109 (82.1–139)

    10–15
    2.49 (1.48–3.93)
    1.67 (1.08–2.47)
    1.94 (1.40–2.61)
    253 (80.7–498)
    98.0 (12.1–214)
    143 (61.6–246)
    ≥25
    0–1
    3.98 (3.50–4.51)
    5.62 (5.00–6.30)
    4.73 (4.34–5.15)
    124 (104–145)
    213 (184–244)
    162 (145–180)

    1–5
    2.34 (2.13–2.56)
    2.27 (2.04–2.52)
    2.31 (2.15–2.47)
    56.1 (47.4–65.5)
    57.9 (47.4–69.2)
    56.9 (50.1–64.0)

    5–10
    2.37 (2.11–2.64)
    2.37 (2.07–2.70)
    2.37 (2.17–2.58)
    60.0 (49.0–72.0)
    57.1 (44.5–71.0)
    58.8 (50.4–67.7)

    10–15
    2.50 (2.00–3.09)
    2.00 (1.49–2.63)
    2.28 (1.92–2.70)
    66.4 (44.2–92.6)
    42.7 (20.9–69.7)
    56.1 (40.0–74.3)

    The mean age at stroke was 67.2 years during 1982–1986 and 68.7 years during 1987–1991. The survival probability improved significantly during the observation period for patients with infarcts or ill-defined stroke. Figure 3 shows, as an example, the survival probability for a person aged 65 years with onset of cerebral infarct or ill-defined stroke during 1982–1986 compared with 1987–1991. The difference is statistically significant (P<0.01). The survival curves show that the risks for acute and early death did not differ, but the probability of long-term survival increased after the first year beyond the index stroke.

    Figure 3. Long-term survival probability for patients aged 65 years at first cerebral infarct or ill-defined stroke by period of attack (Cox regression).

    Causes of Death

    Two thirds of the patients with nonfatal stroke subsequently died from vascular diseases (Table 3). The mortality rate due to all cardiovascular diseases was almost 4 times higher than that in the background population (Table 4). More patients died from cerebrovascular disease than from heart disease, particularly women. The risk for cerebrovascular death was 8 to 9 times that of the general population, but the excess mortality was not confined to vascular diseases since the rates for cancer, other diseases, accidents, and suicide were also significantly higher than expected. Ischemic heart disease and other vascular diseases were more than twice as often the cause of death than expected, but vascular diseases other than stroke contributed only slightly more than other diseases to the overall excess mortality. The frequency of other diseases, accidents, and suicide as the cause of death was approximately double that for the general population, and stroke survivors also had a statistically significant 26% increase in the risk for dying from cancer.

    Causes of Death of Patients With Nonfatal Stroke Who Died Before January 1, 1996

    Cause of Death*MenWomenAllNo.%No.%No.%
    International Classification of Diseases (ICD) codes: 8th edition for deaths before January 1, 1994; 10th edition for deaths after January 1, 1994.
    *Unknown in 11 cases.
    Cardiovascular diseases ICD-8: 390–458; ICD-10: I00–I99
    626
    63.4
    608
    72.3
    1234
    67.5
        Ischemic heart disease ICD-8: 410–414; ICD-10: I20–I25
    242
    24.5
    173
    20.6
    415
    22.7
        Cerebrovascular disease ICD-8: 430–438; ICD-10: I60–I69
    268
    27.2
    318
    37.8
    586
    32.1
    Cancer ICD-8: 140–209; ICD-10: C00–D09
    133
    13.5
    83
    9.9
    216
    11.8
    Other diseases ICD-8: 0–136, 210–389, 460–796; ICD-10: A00–B99, D10–H95, J00–R99
    205
    20.8
    130
    15.4
    335
    18.3
    Accidents and suicide ICD-8: E800–E999; ICD-10: V00–Y99
    23
    2.3
    20
    2.4
    43
    2.4
    Total
    987
    100
    841
    100
    1828
    100

    SMRs* by Sex and Causes of Death of Patients After a First Nonfatal Stroke

    Cause of DeathSMR (95% CI)MenWomenCerebral InfarctIll-Defined StrokeAll Strokes†Cerebral InfarctIll-Defined StrokeAll Strokes†
    *Quotient of observed to expected numbers of deaths.
    †Subarachnoid hemorrhage, primary intracerebral hemorrhage, cerebral infarct, and ill-defined stroke.
    Cardiovascular diseases
    4.01 (3.43–4.66)
    3.62 (3.29–3.98)
    3.75 (3.46–4.06)
    5.77 (4.67–7.06)
    3.77 (3.44–4.12)
    4.03 (3.71–4.36)
        Ischemic heart disease
    2.85 (2.22–3.60)
    2.62 (2.24–3.06)
    2.64 (2.32–2.99)
    3.64 (2.42–5.26)
    2.41 (2.03–2.84)
    2.50 (2.14–2.90)
        Cerebrovascular disease
    9.07 (7.07–11.5)
    7.70 (6.62–8.91)
    8.32 (7.35–9.37)
    12.1 (8.89–16.0)
    8.19 (7.20–9.27)
    8.89 (7.94–9.92)
        Other cardiovascular diseases
    2.99 (2.03–4.25)
    2.58 (2.04–3.21)
    2.70 (2.23–3.24)
    3.98 (2.40–6.21)
    2.41 (1.95–2.94)
    2.54 (2.10–3.05)
    Cancer
    1.40 (1.03–1.86)
    1.15 (0.92–1.43)
    1.22 (1.02–1.44)
    1.87 (1.21–2.76)
    1.17 (0.87–1.53)
    1.33 (1.06–1.65
    Other diseases
    2.17 (1.64–2.82)
    2.24 (1.89–2.64)
    2.20 (1.91–2.52)
    2.48 (1.63–3.60)
    1.74 (1.41–2.11)
    1.83 (1.53–2.18)
    Accidents and suicide
    2.60 (1.25–4.78)
    1.44 (0.72–2.58)
    1.88 (1.19–2.83)
    2.86 (0.93–6.68)
    1.72 (0.97–2.84)
    1.82 (1.11–2.81)
    Total
    2.68 (2.38–3.01)
    2.55 (2.36–2.75)
    2.58 (2.43–2.75)
    3.58 (3.03–4.19)
    2.73 (2.53–2.95)
    2.85 (2.66–3.05)

    Discussion

    In this community-based study, in which we followed up unselected patients with a first stroke for a sufficient length of time and in sufficiently large numbers for accurate statistics on the absolute and relative long-term risks for death, our results are in agreement with those of previous investigations, showing that the highest risk for death is in the acute phase of a stroke and then gradually declines. More than 1 year after a first stroke, the excess mortality appears to level off, the risk for death being approximately twice that of the general population. In the Oxfordshire Community Stroke Project,5 675 patients with a first stroke were followed up for up to 6.5 years, and the relative risk of death was found to vary between 1.1 and 2.9 at 2 to 6 years after the stroke. In the Perth Community Stroke Study,4 in which 362 patients with a first stroke were followed up for 5 years, the relative risk for death beyond 1 year after the stroke was between 2.0 and 2.3. Loor et al6 followed up 221 patients up to 3 years and reported the relative risk for death to be 2.0 in the interval 2 to 3 years after the stroke. We found a SMR ≥2.0 for as long as 10 to 15 years after the initial stroke. Hence, we conclude that persons who survive a stroke have a continuing excess risk of death, which remains at least double that of the background population.

    Case fatality rates vary considerably among populations,1 and it has been found frequently that the age-standardized case fatality rates are higher for women than for men. We found that, after 4 weeks, women continued to have a higher risk for death than men for as long as 1 year after the stroke. The female stroke victims were older than the men, but the effect of age was controlled for in the analyses, and our data do not offer any explanation for the difference. A similar difference was found in a study in the Netherlands6; in other community-based studies, risk estimates were not reported by sex.

    The most frequent cause of death in patients with nonfatal strokes was cardiovascular disease (either cerebrovascular disease or heart disease). The distribution of causes of death is similar to that found among 30-day survivors in other studies: cerebrovascular diseases accounted for 43% and other vascular causes for 26% of deaths in the Netherlands,6 and the corresponding figures were 36% and 34% in Oxfordshire5 and 27% and 31% in Perth, Australia.4 We found that 32.1% of deaths after nonfatal stroke were due to cerebrovascular disease and 22.7% to ischemic heart disease. In comparison with the background population, the risk for death from cardiovascular diseases other than stroke was more than double that expected (Table 4), and the estimated risk for death from cerebrovascular disease was more than 8-fold that expected. Ischemic heart disease and vascular diseases other than stroke contributed little more than did the category “other diseases” to the overall excess mortality. The relative distribution of causes of death may, however, be biased. Since our analyses were based on official death statistics, it is likely that the SMRs for cerebrovascular disease are overestimated, because certifying doctors may more readily have recorded “cerebrovascular disease” as the cause of death when there was a history of stroke and no more obvious specific cause. The ratios for heart disease and other diseases may be underestimated for the same reason, whereas the registration of cancer deaths, accidents, and suicide is less likely to be influenced.

    The finding that death from cancer was more frequent may reflect an association with stroke as a result of shared risk factors such as smoking. There was a tendency to excess mortality from lung cancer among male but not among female stroke patients (data not shown), whereas deaths from chronic bronchitis and emphysema were more frequent among female patients but not among male patients (data not shown).

    A degree of disability after a stroke that made the patient ineligible for antineoplastic therapy may also have played a role in the excess mortality from cancer, and this factor may similarly have limited the possibilities for effective treatment of any other condition, thereby accounting in part for the excess death rates. In the study in Perth, physical disability before a stroke increased the risk for death of stroke patients; we assume that poststroke disability may have a similar effect.

    Disabled persons may also have a higher risk for accidents, in particular falls. In the study of Loor et al,6 it was found that 5 of 62 deceased patients (8%) died of complications after a fracture of the femur. It can only be speculated that poststroke depression might lead to suicide.

    In view of the definition in the protocol of the WHO MONICA Project of a stroke event, we analyzed survival probability after a fatal stroke by stroke subtype and not by direct or indirect causes of death. In studies in which the direct cause of death within 30 days after a first stroke was examined,4–6 death was due to cerebrovascular disease in 91% of patients in the Oxfordshire Community Stroke Project and in 85% in the Perth Community Stroke Study. Loor et al6 found that only 1 of 58 patients did not die of the index stroke. A study in Rochester, Minn, 10 included stroke of uncertain type in the analyses of cerebral infarct because it was assumed that the overwhelming majority of patients had had a cerebral infarct. We were tempted to reach a similar conclusion for our category of ill-defined stroke because the survival curves for verified cerebral infarct and ill-defined stroke were almost identical. However, the cohort was established during a period when neuroimaging was less frequently used than today. An exact diagnosis was established more frequently in younger than in older patients, and a complete workup was assumed to have been done more often for patients presenting with severe symptoms and suspected to have intracranial bleeding.

    Because some diagnoses were established postmortem, the short-term survival rates for patients with particular stroke subtypes are biased. The short-term prognosis was assumed to be better for all patients with cerebral infarct than for those in whom this subtype was diagnosed. Only the survival rates for patients with subarachnoid hemorrhage can be considered to be unbiased. These patients constituted 6% of the total, and we consider it unlikely that there were many cases of this subtype among the ill-defined strokes.

    Our findings clearly show that stroke is a medical emergency with a high risk for death shortly after onset. The selection bias in the risk estimates for subtypes of stroke do not alter the fact that hemorrhagic stroke is more often fatal than cerebral infarct, illustrating why relatively few cases of bleeding complications can balance the therapeutic gain of rapid treatment of cerebral infarct.

    Our findings suggest that the probability of long-term survival was significantly better for patients with ischemic or ill-defined stroke during 1987–1991 than for patients with stroke onset at the beginning of the study period. A similar improvement in survival over time was found in northern Sweden.17 In previous analyses of all strokes,15 we found no positive time trend in short-term survival: the age-adjusted 28-day case fatality rates did not change significantly during 1982–1991, and the improvement was restricted to those who survived longer. Our data do not offer any specific explanation because we had no information on stroke severity or comorbidity. We know, however, that the incidence rates of stroke declined.15 We consider this to be in part the result of improved primary prevention, in particular control of hypertension. Awareness of means for preventing cardiovascular diseases in general increased during the 1980s, and it was at the end of this decade that warfarin was shown to be effective in preventing stroke in patients with arterial fibrillation; this was also the time when the concept of dedicated stroke units was introduced. No such unit was available to the patients included in the present study, but we strongly believe that the focus on appropriate stroke management has had a positive influence on patient care.

    We have pointed to stroke-related disability as a possible explanation for the excess mortality from other diseases, cancer, accidents, and suicide. If this assumption is true, it emphasizes the need for improved rehabilitation to minimize poststroke disability. The most important risk of stroke survivors is recurrent cerebrovascular disease, which was >8 times higher than that of the background population and much more pronounced than the excess risk for death from other causes, including ischemic heart disease. In our opinion, this is a strong argument in favor of continuing and increasing efforts in the field of secondary stroke prevention.

    The incidence of stroke declined,15 and the present results suggest that long-term survival improved in Denmark during a time when it became clear that stroke is a public health issue. This improvement may be the result of better prevention, better management or, more likely, a combination of the two.

    The DAN-MONICA Stroke Project was supported in part by grants from the Danish Heart Foundation. The authors wish to acknowledge the work of all members of the Danish MONICA team and the support received from collaborating institutions and organizations.

    Footnotes
    Correspondence to Henrik Brønnum-Hansen, National Institute of Public Health, 25 Svanemøllevej, DK 2100 Copenhagen Ø, Denmark. E-mail h...@dike.dk

    References

    Uhohinc

    unread,
    May 3, 2021, 2:14:16 PM5/3/21
    to Clinuvel Afamelanotide SCENESSE senescence CUV ASX.CUV CLVLY ur9
    from CDC, references at bottom
    Stroke Facts

    The country’s highest death rates from stroke are in the southeastern United States.2

    Find facts and statistics about stroke in the United States.

    Stroke Statistics
    • In 2018, 1 in every 6 deaths from cardiovascular disease was due to stroke.1
    • Someone in the United States has a stroke every 40 seconds. Every 4 minutes, someone dies of stroke.2
    • Every year, more than 795,000 people in the United States have a stroke. About 610,000 of these are first or new strokes.2
    • About 185,000 strokes—nearly 1 of 4—are in people who have had a previous stroke.2
    • About 87% of all strokes are ischemic strokes, in which blood flow to the brain is blocked.2
    • Stroke-related costs in the United States came to nearly $46 billion between 2014 and 2015.2 This total includes the cost of health care services, medicines to treat stroke, and missed days of work.
    • Stroke is a leading cause of serious long-term disability.2 Stroke reduces mobility in more than half of stroke survivors age 65 and over.2
    Stroke Statistics by Race and Ethnicity
    • Stroke is a leading cause of death for Americans, but the risk of having a stroke varies with race and ethnicity.
    • Risk of having a first stroke is nearly twice as high for blacks as for whites,2 and blacks have the highest rate of death due to stroke.1
    • Though stroke death rates have declined for decades among all race/ethnicities, Hispanics have seen an increase in death rates since 2013.1
    Stroke Risk Varies by Age
    • Stroke risk increases with age, but strokes can—and do—occur at any age.
    • In 2009, 34% of people hospitalized for stroke were less than 65 years old.3
    Early Action Is Important for Stroke

    Know the warning signs and symptoms of stroke so that you can act fast if you or someone you know might be having a stroke. The chances of survival are greater when emergency treatment begins quickly.

    • In one survey, most respondents—93%—recognized sudden numbness on one side as a symptom of stroke. Only 38% were aware of all major symptoms and knew to call 9-1-1 when someone was having a stroke.4
    • Patients who arrive at the emergency room within 3 hours of their first symptoms often have less disability 3 months after a stroke than those who received delayed care.4
    Americans at Risk for Stroke

    High blood pressurehigh cholesterol, smoking, obesity, and diabetes are leading causes of stroke. 1 in 3 US adults has at least one of these conditions or habits.2 

    You can take steps to prevent stroke.

    More Information

    From CDC:

    From other organizations:

    References
    1. Centers for Disease Control and Prevention. Underlying Cause of Death, 1999–2018. CDC WONDER Online Database. Atlanta, GA: Centers for Disease Control and Prevention; 2018. Accessed March 12, 2020.
    2. Virani SS, Alonso A, Benjamin EJ, Bittencourt MS, Callaway CW, Carson AP, et al. Heart disease and stroke statistics—2020 update: a report from the American Heart Associationexternal iconCirculation. 2020;141(9):e139–e596.
    3. Hall MJ, Levant S, DeFrances CJ. Hospitalization for stroke in U.S. hospitals, 1989–2009. NCHS data brief, No. 95. Hyattsville, MD: National Center for Health Statistics; 2012.
    4. Fang J, Keenan NL, Ayala C, Dai S, Merritt R, Denny CH. Awareness of stroke warning symptoms—13 states and the District of Columbia, 2005MMWR 2008;57:481–5.

    Uhohinc

    unread,
    May 6, 2021, 2:41:40 PM5/6/21
    to Clinuvel Afamelanotide SCENESSE senescence CUV ASX.CUV CLVLY ur9
    I suspect, Clinuvel Prenumbra will be handled similar to Imcivree


    https://www.rhythmtx.com/IMCIVREE/patient-information.pdf

    Uhohinc

    unread,
    May 11, 2021, 2:49:30 AM5/11/21
    to Clinuvel Afamelanotide SCENESSE senescence CUV ASX.CUV CLVLY ur9
    this appears misfiled by me from june of 2019 under autophagy area of research by melanocortins.

    Contents lists available at ScienceDirect
    Neuropeptides
    journal homepage: www.elsevier.com/locate/npep
    Possible involvement of PI3K/AKT/mTOR signaling pathway in the protective effect of selegiline (deprenyl) against memory impairment following ischemia reperfusion in rat
    Hossein Amini-Khoeia,⁎, Elham Saghaeia, Gholam-Reza Mobinia, Milad Sabzevary-Ghahfarokhia, Reza Ahmadia, Nader Bagheria, Tahmineh Mokhtarib,c
    a Medical Plants Research Center, Basic Health Sciences Institute, Shahrekord University of Medical Sciences, Shahrekord, Iran b Nervous System Stem Cells Research Center, Semnan University of Medical Sciences, Semnan, Iran
    c Department of Anatomy, School of Medicine, Semnan University of Medical Sciences, Semnan, Iran
    ARTICLE INFO
    Keywords:
    Ischemia
    Memory
    Rat
    Selegiline PI3K/AKT/mTOR signaling
    ABSTRACT
    Short-term cerebral ischemia led to memory dysfunction. There is a pressing need to introduce effective agents to reduce complications of the ischemia. Involvement of PI3K/AKT/mTOR signaling pathway has been determined in the neuroprotective effect of various agents. Selegiline (deprenyl) possessed neuroprotective properties. In this study global ischemia/reperfusion was established in rats. Selegiline (5 mg/kg for 7 consecutive days) admini- strated via intraperitoneal route. Possible involvement of PI3K/AKT/mTOR signaling pathway was evaluated using qRT-PCR, immunohistochemistry and histophatologic evaluations in the hippocampus. Spatial memory was evaluated by morris water maze (MWM). Results showed that ischemia impaired the memory and ischemic rats spent more time to find hidden platform in the MWM. Ischemia significantly decreased levels of PI3K, AKT and mTOR in the hippocampus. Histopathologic assessment revealed that the percent of dark neurons sig- nificantly increased in the CA1 area of the hippocampus of ischemic rats. Selegiline improved the memory as ischemic rats spent fewer time to find hidden platform in the MWM. Findings showed that selegiline increased the level and expression of PI3K, AKT and mTOR as well as decreased the proportion of dark neurons in the CA1 area of the pyramidal layer of the hippocampus. We concluded that selegiline, partially at least, through in- creases the expression of PI3K, AKT and mTOR as well as decreases the percent of dark neurons in the hippo- campus could improve the memory impairment following the ischemia in rats.
    1. Introduction
    Stroke is one of the most common causes of disability with high economic burden and increasing incidence in the world (Mozaffarian et al., 2016; Hirt et al., 2017; Schuhmann et al., 2017). Cut of blood flow to the brain in the ischemic stroke (IS) is associated with the brain injury (Bi et al., 2017; Jia et al., 2008). Short-term cerebral ischemia led to neuronal necrosis, apoptotic cell death, silent infarcts and cognitive decline (Ünal et al., 2001). Several clinical and preclinical studies have demonstrated that ischemic stroke led to memory dysfunction, neuro- degeneration and cognition impairment (Schaapsmeerders et al., 2015; Eve et al., 2016; Silva et al., 2015; Sadelli et al., 2017). Although sev- eral agents have been introduced for treatment of stroke, little have effectiveness in this disorder (O'collins et al., 2006; Sacco et al., 2007). Today, thrombolysis is only acute treatment available apply to restore
    blood flow to the ischemic area. In this regards, tissue plasminogen activator (tPA) approved for acute treatment. Unfortunately, tPA has some adverse effects including hemorrhage and also has short ther- apeutic time-window (Siket, 2016; Karatas et al., 2018). Indeed, eva- luation and development of novel agents with high therapeutic index and protective effects on memory impairment consequence of ischemis warranted further studies.
    Selegiline (deprenyl) is a selective and irreversible inhibitor of the monoamine oxidase (MAO)-B broadly administrated for Parkinsonism patients (Mizuno et al., 2017; Cereda et al., 2017). It has been showed that selegiline at higher doses acts as non-selective inhibitor of MAO-A and MAO-B enzymes so is effective for treatment of major and atypical depression (Finberg and Tenne, 1982; Youdim and Weinstock, 2004; Youdim and Bakhle, 2006). In case of preclinical studies, literature demonstrated that selegiline improves motivational dysfunctions and
    ⁎ Corresponding author at: Medical Plants Research Center, Basic Health Sciences Institute, Shahrekord University of Medical Sciences, Shahrekord, Iran. E-mail address: aminik...@skums.ac.ir (H. Amini-Khoei).
    https://doi.org/10.1016/j.npep.2019.101942
    Received 15 April 2019; Received in revised form 17 June 2019; Accepted 26 June 2019
    0143-4179/ © 2019 Published by Elsevier Ltd.
    Please cite this article as: Hossein Amini-Khoei, et al., Neuropeptides, https://doi.org/10.1016/j.npep.2019.101942

    H. Amini-Khoei, et al.
    Neuropeptides xxx (xxxx) xxxx
    also exerts antidepressant effect (Yohn et al., 2017; Contreras-Mora et al., 2018; Amiri et al., 2016). Selegiline enhances striatal dopamine concentrations and has amphetamine-like action in the brain (Lamensdorf et al., 1996; Reynolds et al., 1978; Kalász et al., 2014). It has been well-known that levels of dopamine significantly decreased in Alzheimer's disease (AD). In this concept, studies have clarified that augmentation of dopaminergic activity improve memory and learning deficit in animal model of AD (Golani et al., 2014; Okada et al., 2015; Kemppainen et al., 2015; Martorana and Koch, 2014). It has been de- termined that acute and chronic administration of selegiline possessed anti-apoptotic and neuroprotective effects and reduce the size of infarct area in experimental ischemia (Semkova et al., 1996; Ünal et al., 2001). An explorative study showed that l-deprenyl significantly improves cognitive tests and functional recovery in stoke patients (Bartolo et al., 2015). However, the exact mechanisms of protective effect of selegiline in IS are still unknown.
    The phosphatidylinositol 3-kinase/protein kinase-B/mammalian target of rapamycin (PI3K/AKT/mTOR) signaling pathway is an im- portant intracellular cascade controls cell proliferation, differentiation, cellular metabolism, apoptosis, cell survival and cytoskeletal re- structuring (Janku et al., 2012; Polivka and Janku, 2014; Porta et al., 2014; Peltier et al., 2007). Previous studies showed that mTOR/cad- herin signaling is involved in cell growth and adhesion (Wei and Wang, 2018; Jiang et al., 2018; Yin et al., 2018). It has been demonstrate that PI3K/AKT has a pivotal role in the proliferation of hippocampal neural progenitor cells (Peltier et al., 2007). Activation of PI3K/AKT cascade triggers neural stem cells proliferation consequently induced neuro- genesis (Le Belle et al., 2011). The PI3K/AKT/mTOR pathway exerted neuroprotive activity in traumatic brain injury. In this regards, it has been determined that this pathway via suppression of neuronic autop- hagy in the hippocampus, possessed neuroprotective effects (Zhang et al., 2017). Researchers showed that activation of AKT/mTOR pathway possessed neuroprotective effects in ischemic brain injury (Huang et al., 2014). Recently, it has been well-known that activation of PI3K/AKT/mTOR pathway exerted the neuroprotective effect via decrease of oxidative stress, improvement of neurotransmission and neurogenesis in the AD induced by Amyloid-β in rat (Singh et al., 2017). However, there is currently almost no data about involvement of this signaling pathway in the protective effect of selegiline.
    Since ischemia accounts for majority of strokes, it is crucial to evaluate the underlying mechanisms of cerebral ischemia. Therefore, introducing effective therapeutic targets has high importance to pre- vent neural damage in ischemic injuries of the brain. Considering neuroprotective effect of PI3K/AKT/mTOR signaling pathway and also above-mentioned beneficial effects of selegiline in ischemia, in the current study we aimed to evaluate the possible involvement of PI3K/ AKT/mTOR pathway in advantageous effect of selegiline (L-deprenyl) in rat model of stroke.
    2. Materials and methods
    2.1. Animals
    Forty male, two months old Sprague Dawley rats (Pasteur institute, Tehran, Iran) weighing 250–300 g were used. Animals were kept in Plexiglas boxes under standard laboratory conditions (temperature: 22 ± 2 °C, humidity: 50 ± 10%, 12-h light–dark cycle and free access to food and water ad libitum). All procedures were performed ac- cording to the National Institutes of Health (NIH) Guide for the Care and Use of Laboratory Animals (NIH publication # 80–23) and in- stitutional guidelines for animal care and use (Shahrekord University of Medical Sciences. Shahrekord, Iran). Each experimental group con- tained 10 animals.
    2.2. Study design
    Selegiline HCl (Sigma, St Louis, MO, USA) was dissolved in saline and injected subcutaneously (s.c.) at dose of 5 mg/kg for 7 consecutive days. Dose and duration of selegiline's administration was selected ac- cording to previous published studies (Amiri et al., 2016; Tsunekawa et al., 2018; Shimazu et al., 2005) and our pilot studies.
    Of the forty rats used in this study, twenty rats were subjected to global ischemia model and twenty rats were remained intact. Rats were divided into four groups as follows: 1) Control group without surgery received saline 2) rats which were underwent ischemia reperfusion model and received saline 3) ischemic reperfusion rats received sele- giline and 4) rats which were underwent ischemia reperfusion model and received selegiline.
    Rats were treated with saline or selegiline for 7 days (days 0–7) and then were subjected to water maze test for evaluation of memory. After memory assessment, rats were euthanized under anesthesia using pentobarbital (60 mg/kg,i.p.) and hippocampi were dissected out and histopathological changes in the CA1 area as well as expression of PI3K, AKT and mTOR genes were evaluated in the hippocampus using RT- PCR method. In addition, the level of PI3K, AKT, mTOR and p-mTOR (phosphorylated mTOR) was evaluated by immunohistochemistry method.
    2.3. Global ischemia/reperfusion model establishment
    Transient global ischemia was induced according to the previously described method (Li et al., 2006; Cao et al., 2011). For short, an- esthesia was induced by intraperitoneal administration of ketamine (60 mg/kg) and xylazine (6 mg/kg). The bilateral common carotid ar- teries were exposed through a 2 cm ventral midline cervical opening and carefully detached from the vagus nerves, then obstructed bilat- erally for 5 min using clip. Five minutes later, the clips were removed to restore cerebral blood flow and reperfusion. Animals were recovered on a heating pad for 2 h to protect from hypothermia. Also, full efforts were made to minimize the use of animals and to optimize their com- fort.
    2.4. Morris water maze test (MWM)
    MWM is a valid device to evaluate spatial memory in rodents. The apparatus is a round black-painted tank (150 cm diameter and 60 cm deep) which filled with water (20 ± 2 °C) to a depth of 30 cm. Several distal visual objects were placed on the walls of the MWM room and their location stayed unchanged during the tests. The maze was divided into four s quadrants with four starting locations called north (N), east (E), south (S), and west (W) at same distances to the border. A Plexiglas escape circular platform (10 cm in diameter) was kept 1 cm beneath the surface of the water in the center of the north-west quadrant (target quadrant). Throughout the tests, the animal motion was recorded by a camera located above the maze which was connected to a computer. A videotracking system (Etho-Vision XT® v 8.5; Noldus Information Technology, Wageningen, the Netherlands) was used to record the time spent to find the hidden platform (escape latency) and also path length to reach the hidden platform (traveled distance). To do this experiment, rats were trained in the MWM. For this purpose, each rat was allowed to swim during 60 s to discover the hidden platform directed by distal spatial indications.
    Subsequently finding the platform, animals were permitted to stay there for 20 s, and were then placed in a cage for 20 s till the start of the next trial. If an animal did not find the platform within this period, it was manually guided to the platform by the experimenter and allowed to rest for 20 s. Escape latency was recorded in each trial for evaluation of spatial memory. Probe trial (retrieval test session) was performed 24h afterward training. The probe trial was involved a 60-s free swimming period without a platform and escape latency as well as
    2

    H. Amini-Khoei, et al.
    Neuropeptides xxx (xxxx) xxxx
    Table 1
    Primer sequences for qRT-PCR.
    Five sections obtained from each brain and were deparaffinized using xylene and stained with H&E. Histological analysis was performed under light microscopy (400; Olympus microscope) after preparing images under objective lens using a digital camera (Olympus, Japan) and exhibited on a computer monitor. Three fields from each slide were selected and the compactness of dark neurons and normal neurons within the pyramidal cell layer of CA1 area was estimated in each field. In histological studies dark neurons are recognized by hyperbasophilia property as a type of cell degeneration. The percent of dark (dead) neurons (the relation of dark neurons to normal neurons + dark neu- rons (total number of neurons)) was evaluated in each group. The fields were randomly selected. All measurements were performed using Image J software by a blinded pathologist (Zsombok et al., 2005; Amini-Khoei et al., 2017).
    2.8. Statistical analysis
    Comparison between the groups was analyzed using two-way ANOVA followed by tukey's post test. Graph-pad prism software (ver- sion 6) was used for data analysis. P < 0.05 was considered statisti- cally significant.
    3. Results
    3.1. Selegiline improved the memory function in the Morris water maze swimming test
    Two- way ANOVA analysis showed that ischemic (IS) rats sig- nificantly spent fewer time in the zone1 of the apparatus in compared with control (CO) rats in the probe trail (on fifth day of test) (P < 0.001, Fig. 1A). Results demonstrated that following treatment with selegiline, time spent in the correct quadrant (zone1) significantly increased in the IS rats (P < 0.001). In case of spatial memory as- sessments (Fig. 1B), ischemic rats spent more time to find the escape platform in training days in comparison with control rats (training days 1 and 3 P < 0.01, training days 2 and 4 P < 0.05). Our findings showed that treatment of ischemic rats with selegiline significantly reduced the latency time to find the hidden platform in compared with saline-treated IS rats (P < 0.05 in training day 1 and 4).
    3.2. Selegiline decreased the dead neurons (%) of the CA1 region
    The percentage of dead neurons (damaged cells with sparsely ar- range and fuzzy shape) were calculated inthe CA1 region of the hip- pocampus (Fig. 2A). The mean percentage of dead neurons in the is- chemic (IS) rats was significantly higher than those in the control (CO) rats (P < 0.001, Fig. 2B). A significant decrease was recorded in the mean percentage of dead neurons in the selegiline-treated IS (IS+SE) rats (P < 0.01) in compared with the IS group.
    3.3. Selegiline increased the level of AKT, PI3K, mTOR and p-mTOR in the hippocampus
    As summarized in Table 2 and showed in Fig. 3 (AKT), Fig. 4 (PI3K), Fig. 5 (mTOR) and Fig. 6 (p-mTOR) ischemia hypoperfusion sig- nificantly decreased the expression of AKT, PI3K, mTOR and p-mTOR (phosphorylated mTOR) in the hippocampus in compared to the control group. Treatment with selegiline in the IS rats significantly increased the expression of AKT, PI3K, mTOR and pmTOR when compared with the saline-treated IS animals.
    3.4. Selegiline increased the gene expression of AKT, PI3K and mTOR in the hippocampus
    As shown in Fig. 7, expression of AKT (A), PI3K (B) and mTOR (C) was significantly decreased in the IS group in comparison with the
    Primer name
    AKT mTOR Pi3K B2m
    Forward sequence
    TAGCCATTGTGAAGGAGGGC GCTCCAGCACTATGTCACCA GCAACTCCTGGACTGCAACT CGTGATCTTTCTGGTGCTTGTC
    Reverse sequence
    CCTGAGGCCGTTCCTTGTAG CGTCTGAGCTGGAAACCAGT CAGCGCACTGTCATGGTATG GGAAGTTGGGCTTCCCATTCT
    traveled distance were recorded (Amiri et al., 2016; Vorhees and Williams, 2006).
    2.5. Quantitative reverse transcription–PCR (qRT-PCR)
    Total RNA was extracted using Tripure isolation reagent (Roche) according to the manufacturer's instructions and quantified by a ND- 100 spectrophotometer (Nanodrop Technologies). Variations in mRNA expression of looked-for genes were assessed by qRT–PCR after reverse transcription of 1 μg RNA from each sample with PrimeScript RT re- agent kit (Takara) according to the manufacturer's order. The qRT–PCR was done on a light cycler apparatus (Roche Diagnostics) using SYBR Premix Ex Taq technology (Takara). Thermal cycling environment in- volved an initial activation phase for 30 s at 95 °C followed by 45 cycles including a denaturation step for 5s at 95°C and a combined an- nealing/extension step for 20s at 60°C. Beta 2-Microglobulin was considered as a normalizer and fold changes in expression of each target mRNA relative to beta 2-Microglobulin (B2m) was calculated based on 2−ΔΔCt relative expression formula as described earlier (Haj-Mirzaian et al., 2017; Amini-Khoei et al., 2017; Lorigooini et al., 2019). The primer sequences are listed in Table 1.
    2.6. Immunohistochemistry
    Immunohistochemical staining was applied using the streptavidin biotin peroxidase-complex method according to our previous protocol (Sabzevary-Ghahfarokhi et al., 2018). AKT, PI3K, mTOR and p-mTOR antibodies were purchased from the Cell signaling company (Cell sig- naling technology, USA). In brief, hippocampi were cut into 4-μm thick sections and stuck on poly-L-lysine slides. The slides were depar- affinized and rehydrated using xylene and a series of ethanols (100%, 100%, 80% and 70%). In order to do antigen retrieving stage, sections were wrapped up in citrate buffer solution (10mM Sodium Citrate, 0.05% Tween 20, pH 6.0) and were exposed to pressure for 20 min. To avoid nonspecific staining, slides were incubated for 2 h with protein block (Abcam, England) containing albumin. Primary antibodies were incubated overnight at 4 °C which was followed by adding 0.3% H2O2 solved in TBS to inhibit endogenous peroxidase activity. Following in- cubating with biotinylated IgG antibody and Streptavidin-Peroxidase Plus at room temperature, 3-diaminobenzidine tetrahydrochloride DAB was used to visualize specific antigen. Finally, Sections were counter- stained with hematoxylin and washed with cool water. Intensity of immunoreactivities against primary antibodies were inspected on all sections using a light microscope (Olympus BX41) by a pathologist blind to the study using a 6-score system (0 = negative), 0.5 = 0–5% positive, 1=5–15% positive, 2=16%–40% positive, 3=41%–90% positive, and 5 > 90% positive.
    2.7. Microscopy
    After euthanasia under anesthesia using pentobarbital (60 mg/kg, i.p.), trans-cardiac perfusion was performed via 0.9% normal saline first and then continued with ice-cold 4% paraformaldehyde in 0.1Mphosphate buffer (pH 7.5). Then, the hippocampi were isolated and after fixation samples were immersed in 10% formalin. Formalin- fixed brains were paraffin-embedded and 5 μm sections were obtained.
    3

    H. Amini-Khoei, et al.
    Neuropeptides xxx (xxxx) xxxx
    Fig. 1. (A): Spent time in zone1 through the probe trial in experimental groups. Data are presented as mean ± SD (n = 7). ⁎⁎⁎p < 0.001 compared with con- trol group, ###P < 0.001 compared with saline-treated ischemic rats. (B): Spatial learning in hidden platform in the MWM through four training days. Data are presentesd as mean ± SD (n = 10). ⁎p < 0.05 and ⁎⁎p < 0.01 com- pared with control group, #P < 0.05 compared with saline-treated ischemic rats. CO (saline-treated control rat), IS (saline-treated ischemic rat), CO + SE (selegiline-treated control rat) and IS+SE (selegiline-treated ischemic rat).
    control group (P < 0.05, P < 0.05 and P < 0.001, respectively). Furthermore, treatment with selegiline in IS rats significantly increased expression of AKT (P < 0.01), PI3K (P < 0.05) and mTOR (P < 0.05) in the hippocampus when compared with saline-treated IS rats.
    4. Discussion
    Results of the present study showed that global ischemia-reperfu- sion led to memory impairment status in the morris water maze test. We found that this status is accompanied with low expression of PI3K/ AKT/mTOR signaling pathway at gene and protein levels as well as histopathological alterations in the hippocampus. Our findings de- monstrated that treatment with selegiline reversed memory impairment following global ischemia-reperfusion model. Interestingly, this con- structive behavioral effect was relevant with over expression of PI3K, AKT and mTOR as well as modification in histology of the hippo- campus.
    Stroke is a disabling disease with high incidence through the world which accounts for > 150 million deaths annually (Tang et al., 2012; Li et al., 2015). It has been demonstrated that cerebral ischemia is the major cause of strokes (Urban et al., 2010). Ischemic stroke is devel- oped when cerebral blood vessel (s) is (are) occluded. Following ischemia neurons enter the apoptotic stage, initiate inflammatory re- sponses, cell death and finally loss of brain's function is formed (Urnukhsaikhan et al., 2017; Chen et al., 2008). Following obstruction of vessels neurons encounter with an oxidative stress which result in mitochondrial dysfunction, activation of caspase family and then DNA
    fragmentation lastly lead to ischemic infarction in the brain (Uzar et al., 2012). Previous evaluations have been determined that subsequent of ischemia, during a period of hours or days neurons have potential to recover from injury(Moskowitz et al., 2010; Ginsberg, 2008). While there are accessible drugs for treatment of ischemic stroke but the lack of an effective treatment is felt. In addition there is no specific agent to expand functional recovery of neurons in ischemic zone. Hence, in- troducing a neuroprotective agent with ability for prevention of neu- ronal death and accelerating of recovery is needed (Ginsberg Ginsberg, 2009).
    It has been demonstrated that activation of the PI3K/AKT/mTOR is important for cell proliferation and apoptosis (Annovazzi et al., 2009). Ample evidences have showed that the PI3K/AKT signaling pathway has critical role in intermediating survival signals in neurons. In this regards, it has been well-known that AKT has an anti-apoptotic role (Datta et al., 1999; Zhao et al., 2006). Beneficial effects of activation of the PI3K/AKT in neuroprotection consequence of ischemic stroke have been determined. In this concept literature said that this pathway through suppression of inflammatory response, decrease of vascular permeability and improve vascular function possessed protective ef- fects. mTOR optimized cytotrophy, energy resource, stimulates protein synthesis and angiogenesis (Xu et al., 2008; Schabbauer et al., 2004). Considering the neuroprotective role of the PI3K/AKT/mTOR pathway in ischemic stroke we showed that this survival pathway inactivated subsequent of cerebral ischemia injury. In line with previous studies we showed that expression of PI3K/AKT/mTOR signals decreased in the hippocampus specimens of rats were subjected to ischemic stroke (Li et al., 2015). Evidences showed that activation of AKT pathway lead to activation of NF-κB transactivation resulting in initiation of transcrip- tion of survival genes such as Bcl-xL and also stimulation of trophic factors (Hussain et al., 2012; Wu et al., 2015).
    Evidences demonstrated that activation of the PI3K/AKT pathway via suppression of JNK prevent neuronal cell death in cerebellar granule neurons (Choi et al., 2018; Shimoke et al., 1999). It has been de- termined that MTOR stimulates angiogenesis, neuronal regeneration, synaptic plasticity and removes neurotoxic substances which are linked with the recovery and survival of injured neurons in ischemic zone (Zhang et al., 2007; Chen et al., 2012a). In this concept it has been shown that inhibition of mTOR using rapamycin increased neuronal apoptosis following brain injury(Chen et al., 2012b). Our results showed that the AKT, PI3K, mTOR and p-mTOR level were significantly decreased in the hippocampus of ischemic rats. However, interestingly treatment with selegiline significantly increased the expression of aforementioned gene and proteins in the hippocampus of ischemic rats.
    Selegiline [(−)-deprenyl] is an irreversible monoamine oxidase (MAO) type B inhibitor which increase level of dopamine in the striatum (Lamensdorf et al., 1996; Amiri et al., 2016). It has been re- solute that selegiline metabolize to (−)-methamphetamine and (−)-amphetamine and in this way affects the brain functions (Reynolds et al., 1978). Furthermore, selegiline through upregulation of dopami- nergic activity exerts beneficial effects in brain's functions such as memory and learning (Kesby et al., 2016; Kumar et al., 2018). It is well- known that agents which enhance dopaminergic neurotransmission increase activity of the PI3K/AKT/mTOR pathway (Emamian, 2012). Previous studies have demonstrated that neuroprotective properties of rasagiline in experimental model of focal ischemia were mediated through MAO independent inhibition (Speiser et al., 1999). In this re- gards, evidences showed that selegiline possessed neuroprotective ef- fects and increased brain's resistance in response to ischemia (Kwon et al., 2004; Ünal et al., 2001).
    CA1 pyramidal neurons are sensitive to ischemia and relatively high percentages of these neurons die following the hypoxia (Duszczyk et al., 2009). In case of learning and memory deficits, literature revealed that selegiline attenuated memory impairment following ischemic brain damage (Puurunen et al., 2001; Kesby et al., 2016). Our results showed that selegiline significantly improved memory impairment in ischemic
    4

    H. Amini-Khoei, et al. Neuropeptides xxx (xxxx) xxxx
    Fig. 2. The effects of treatment with selegiline on hippocampal CA1 area in hypoperfused rat, (A): Representative hematoxylin and eosin (H&E) stained slides from CA1 area (×400). (B): the percent of dead (dark) neurons in the CA1 area of the hippocampus. ⁎⁎⁎P < 0.001 compared with saline-treated control rats, ###P < 0.001 compared with the saline- treated ischemic rats.CO (saline-treated control rat), IS (saline-treated ischemic rat), CO + SE (selegiline-treated control rat) and IS+SE (selegiline-treated ischemic rat).
    Table 2
    Immunohistochemistry expression of AKT, PI3K, mTOR and p-mTOR in the hippocampus. The expression of AKT, PI3K, mTOR and p-mTOR were scored. Data are expressed as percent of positive cells (n = 8). *P < 0.05 compared with saline-treated control rats, #P < 0.005 compared with the saline- treated ischemic rats. CO (saline-treated control rat), IS (saline-treated ischemic rat), CO + SE (selegiline-treated control rat) and IS+SE (selegiline-treated ischemic rat).
    rats. Furthermore, following treatment with selegiline the percent of dark neurons in the CA1 area of the hippocampus significantly de- creased in ischemic rats. Clinical investigations have been clarified that selegiline has therapeutic effects in Neurological diseases including Alzheimer's disease and improves cognitive impairment (Sano et al., 1997; Ebadi et al., 2006). According to experimental studies adminis- tration of selegiline enhanced the survival and density of pyramidal neurons of the hippocampus including CA1 and CA3 cells as well as decreased the proportion of dark neurons in pyramidal area (Paterson et al., 1997; Lahtinen et al., 1997).
    There are evidences revealed that hippocampus is a critical area for processing of memory (Danielson et al., 2016; Garthe et al., 2016). In this regards it has been determined that expansion of connectivity and plasticity of pyramidal cell especially CA1 cells improved memory and
    P-mTOR mTOR PIK3
    14% 24% 15% 10%* 7%* 11%* 16% 16% 19% 14.3%# 18.75%# 18%#
    AKT
    42%
    5% > * 38% 23%#
    Groups
    CO
    IS CO+SE IS+SE
    5

    H. Amini-Khoei, et al. Neuropeptides xxx (xxxx) xxxx
    Fig. 3. The immunohistochemical features of AKT expression in the hippocampus (×400). CO (saline-treated control rat), IS (saline-treated ischemic rat), CO + SE (selegiline-treated control rat) and IS+SE (selegiline-treated ischemic rat).
    Fig. 4. The immunohistochemical features of PI3K expression in the hippocampus (×400). CO (saline-treated control rat), IS (saline-treated ischemic rat), CO + SE (selegiline-treated control rat) and IS+SE (selegiline-treated ischemic rat).
    6

    H. Amini-Khoei, et al. Neuropeptides xxx (xxxx) xxxx
    Fig. 5. The immunohistochemical features of mTOR expression in the hippocampus (×400). CO (saline-treated control rat), IS (saline-treated ischemic rat), CO + SE (selegiline-treated control rat) and IS+SE (selegiline-treated ischemic rat).
    Fig. 6. The immunohistochemical features of p-mTOR expression in the hippocampus (×400). CO (saline-treated control rat), IS (saline-treated ischemic rat), CO + SE (selegiline-treated control rat) and IS+SE (selegiline-treated ischemic rat).
    7

    H. Amini-Khoei, et al. Neuropeptides xxx (xxxx) xxxx
    Fig. 7. The expression of AKT (A), PI3K (B) and mTOR (C) in the hippocampus was determined by qRT-PCR. Data are shown as mean ± SEM from triplicate tests and were analyzed using two- way ANOVA followed by Tukey's post-hoc test. ⁎P < 0.05 and ⁎⁎⁎P < 0.001 compared with saline-treated control rats, #P < 0.05 and ##P < 0.01 compared with the saline- treated ischemic rats. CO (saline-treated control rat), IS (saline-treated ischemic rat), CO + SE (selegiline-treated control rat) and IS+SE (selegiline-treated ischemic rat).
    learning deficits following hippocampal injury (Danielson et al., 2016; Stackman Jr et al., 2016; Havekes et al., 2016; Hansen et al., 2015).
    Morris water maze as a valid behavioral test performed for eva- luation of memory and learning in rodents (Wang et al., 2017). In line with previous studies we found that rats were subjected to ischemic stroke model showed memory impairment in this hippocampal-related behavioral test (Wang et al., 2017; Fan et al., 2015). Our results showed that treatment with selegiline significantly improved memory deficit in ischemic rats.
    5. Conclusion
    Findings of this in vivo ischemia study showed that activation of the PI3K/AKT/mTOR pathway partially, at least, has critical role in re- versing the adverse impacts of ischemic model of stroke in rat. Interestingly our results showed that selegiline probably, at part, through upregulation of PI3K/AKT/mTOR in the hippocampus im- proves memory following ischemia in rat.
    Acknowledgment
    This work was supported by a grant from Shahrekord University of Medical Sciences (SKUMS) with grant number of “1395-01-75-3254”. Authors are thanful for Prof. Mahmoud Rafieian- Kopaei and Mrs. Maryam Makvandi for their assistant to this work.
    Conflict of interests
    The authors declare that there is no conflict of interest.
    Compliance with ethical standards
    All applicable international and institutional guidelines for the care and use of animals were followed.
    References
    Amini-Khoei, H., Amiri, S., Mohammadi-Asl, A., Alijanpour, S., Poursaman, S., Haj- Mirzaian, A., Rastegar, M., Mesdaghinia, A., Banafshe, H.R., Sadeghi, E., 2017. Experiencing neonatal maternal separation increased pain sensitivity in adult male mice: involvement of oxytocinergic system. Neuropeptides 61, 77–85.
    Amiri, S., Amini-Khoei, H., Mohammadi-Asl, A., Alijanpour, S., Haj-Mirzaian, A., Rahimi- Balaei, M., Razmi, A., Olson, C.O., Rastegar, M., Mehdizadeh, M., 2016. Involvement of D1 and D2 dopamine receptors in the antidepressant-like effects of selegiline in maternal separation model of mouse. Physiol. Behav. 163, 107–114.
    Annovazzi, L., Mellai, M., Caldera, V., Valente, G., Tessitore, L., Schiffer, D., 2009. mTOR, S6 and AKT expression in relation to proliferation and apoptosis/autophagy in glioma. Anticancer Res. 29, 3087–3094.
    Bartolo, M., Zucchella, C., Capone, A., Sandrini, G., Pierelli, F., 2015. An explorative study regarding the effect of l-deprenyl on cognitive and functional recovery in pa- tients after stroke. J. Neurol. Sci. 349, 117–123.
    Bi, M., Gladbach, A., Eersel, J., Ittner, A., Przybyla, M., Hummel, A., Chua, S.W., Van Der Hoven, J., Lee, W.S., Muller, J., 2017. Tau exacerbates excitotoxic brain damage in an animal model of stroke. Nat. Commun. 8, 473.
    Cao, Y., MAO, X., SUN, C., ZHENG, P., GAO, J., WANG, X., MIN, D., SUN, H., XIE, N., CAI, J., 2011. Baicalin attenuates global cerebral ischemia/reperfusion injury in gerbils via anti-oxidative and anti-apoptotic pathways. Brain Res. Bull. 85, 396–402.
    Cereda, E., Cilia, R., Canesi, M., Tesei, S., Mariani, C.B., Zecchinelli, A.L., Pezzoli, G., 2017. Efficacy of rasagiline and selegiline in Parkinson's disease: a head-to-head 3- year retrospective case–control study. J. Neurol. 1–10.
    Chen, G., Frøkiær, J., Pedersen, M., Nielsen, S., SI, Z., Pang, Q., Stødkilde-Jørgensen, H., 2008. Reduction of ischemic stroke in rat brain by alpha melanocyte stimulating hormone. Neuropeptides 42, 331–338.
    Chen, H., Qu, Y., Tang, B., Xiong, T., Mu, D., 2012a. Role of Mammalian Target of Rapamycin in Hypoxic or Ischemic Brain Injury: Potential Neuroprotection and Limitations.
    Chen, H., Xiong, T., Qu, Y., Zhao, F., Ferriero, D., Mu, D., 2012b. mTOR activates hy- poxia-inducible factor-1α and inhibits neuronal apoptosis in the developing rat brain during the early phase after hypoxia–ischemia. Neurosci. Lett. 507, 118–123.
    Choi, H.-W., Shin, P.-G., Lee, J.-H., Choi, W.-S., Kang, M.-J., Kong, W.-S., Oh, M.-J., Seo, Y.-B., Kim, G.-D., 2018. Anti-inflammatory effect of lovastatin is mediated via the modulation of NF-κB and inhibition of HDAC1 and the PI3K/Akt/mTOR pathway in RAW264. 7 macrophages. Int. J. Mol. Med. 41, 1103–1109.
    Contreras-Mora, H., Rowland, M.A., Yohn, S.E., Correa, M., Salamone, J.D., 2018. Partial reversal of the effort-related motivational effects of tetrabenazine with the MAO-B inhibitor deprenyl (selegiline): implications for treating motivational dysfunctions. Pharmacol. Biochem. Behav. 166, 13–20.
    Danielson, N.B., Zaremba, J.D., Kaifosh, P., Bowler, J., Ladow, M., Losonczy, A., 2016. Sublayer-specific coding dynamics during spatial navigation and learning in hippo- campal area CA1. Neuron 91, 652–665.
    Datta, S.R., Brunet, A., Greenberg, M.E., 1999. Cellular survival: a play
    Reply all
    Reply to author
    Forward

    Uhohinc

    unread,
    May 11, 2021, 2:52:34 AM5/11/21
    to Clinuvel Afamelanotide SCENESSE senescence CUV ASX.CUV CLVLY ur9
    selegiline is approved for Parkinson's and may be competitive in pathways to msh.

    Uhohinc

    unread,
    Sep 12, 2021, 3:13:50 AM9/12/21
    to Clinuvel Afamelanotide SCENESSE senescence CUV ASX.CUV CLVLY ur9

    u

    Uhohinc

    unread,
    Sep 14, 2021, 1:45:15 AM9/14/21
    to Clinuvel Afamelanotide SCENESSE senescence CUV ASX.CUV CLVLY ur9
    J Leukoc Biol. 2010 May; 87(5): 779–789.
    Published online 2010 Feb 3. doi: 10.1189/jlb.1109766
    PMCID: PMC2858674
    PMID: 20130219
    Inflammatory mechanisms in ischemic stroke: role of inflammatory cells
    This article has been cited by other articles in PMC.
    Abstract

    Inflammation plays an important role in the pathogenesis of ischemic stroke and other forms of ischemic brain injury. Experimentally and clinically, the brain responds to ischemic injury with an acute and prolonged inflammatory process, characterized by rapid activation of resident cells (mainly microglia), production of proinflammatory mediators, and infiltration of various types of inflammatory cells (including neutrophils, different subtypes of T cells, monocyte/macrophages, and other cells) into the ischemic brain tissue. These cellular events collaboratively contribute to ischemic brain injury. Despite intense investigation, there are still numerous controversies concerning the time course of the recruitment of inflammatory cells in the brain and their pathogenic roles in ischemic brain injury. In this review, we provide an overview of the time-dependent recruitment of different inflammatory cells following focal cerebral I/R. We discuss how these cells contribute to ischemic brain injury and highlight certain recent findings and currently unanswered questions about inflammatory cells in the pathophysiology of ischemic stroke.

    Keywords: inflammation, leukocytes, brain ischemia
    Introduction

    Stroke is the third leading cause of death and the most frequent cause of permanent disability worldwide [1], and inflammation appears to play an important role in the pathogenesis of ischemic stroke and other forms of ischemic brain injury. Clinically, the susceptibility of the patients to stroke and the subsequent prognosis are influenced by systemic inflammatory processes [23]. Stroke patients with systemic inflammation exhibit clinically poorer outcomes [4,5,6]. Experimentally, focal cerebral ischemia induces a time-dependent recruitment and activation of inflammatory cells, including neutrophils, T cells, and monocytes/macrophages, and inhibiting the inflammatory response, decreases infarct size and improves neurological deficit in experimental stroke [78]. Although anti-inflammatory approaches have proven successful in animal models [9,10,11], attempts to translate this into clinical application have been unsuccessful [1213], likely as a result of the heterogeneity in mechanisms underlying postischemic brain inflammation and the uncertain time window at which inflammation could be targeted in the human disease situation [13]. Thus, a comprehensive understanding of the time-dependent recruitment of inflammatory cells following focal cerebral I/R and how these cells differentially (and synergistically) contribute to ischemic brain injury is a prerequisite for developing effective therapeutic interventions for the treatment of acute ischemic stroke by targeting inflammatory pathways in a time-dependent manner.

    Despite intense investigation, there are still numerous controversies concerning the time course of the recruitment of inflammatory cells in the brain and their pathogenic roles in ischemic brain injury. In the present review, we provide an overview of the time-dependent recruitment of different inflammatory cells following focal cerebral I/R. This review focuses on the potential contribution of these cells to ischemic brain injury and highlights recent findings and currently open questions regarding inflammatory cells in the pathophysiology of ischemic stroke.

    EXPERIMENTAL STROKE MODELS AND LEUKOCYTE RECRUITMENT

    Ischemic stroke results from transient or permanent reduction in regional cerebral blood flow. In humans, ischemic stroke occurs most often in the area perfused by the MCA [14]. Studies in animal models of stroke have provided an invaluable contribution to our current understanding of the pathophysiology of ischemic stroke [15]. One of the most relevant stroke models involves transient or permanent MCAO in the rats and mice [1415]. Rats are one of the most suitable species for stroke study because of the pathogenetic similarities of strokes in rats and humans [16]. In recent years, the importance of mouse MCAO models has increased rapidly with the development of transgenic or knockout techniques for a targeted single gene [15]. Currently, there are three main categories of transient MCAO: intraluminal MCAO with thread or wire filaments (the most widely used model in the literature); abluminal application of potent vasoconstrictor endothelin-1 to the MCA; and thromboembolic models, including photochemically induced thrombotic MCAO and the introduction of emboli into the cerebral circulation. The details of the design and operation of these animal stroke models have been described elsewhere [1415]. The results of the comparisons between transient and permanent MCAO models in rats and mice are summarized in Table 1.

    TABLE 1.

    Comparison of Transient and Permanent MCAO Stroke Models in Rats and Mice

    Transient MCAOPermanent MCAOReferences
    Reperfusion
    With MCA reperfusion after a defined period of focal cerebral ischemia.
    Without reperfusion.
    [1415]
    Ischemic damage
    Lesions primarily in the ipsilateral cortex and striatum but also shown in hippocampus.
    Lesions primarily in the ipsilateral cortex but also shown in striatum. Lesion size in the cortex comparable with or larger than transient MCAO.
    [8,9,1015]
    Leukocyte infiltration
    Inducing adhesion and infiltration of a large number of leukocytes in the ischemic brain tissue.
    Although inducing a significant amount of leukocyte rolling and adhesion in pial venules, only a small number of leukocytes infiltrated into ischemic tissue.
    [8,9,1015]
    Antileukocyte (including antiadhesion molecule) therapy
    Immunoblocking or genetic deletion of a number of adhesion molecules (e.g., CD11b/CD18, ICAM-1, P-selectin) effectively reduces ischemic brain injury.
    Less effective.
    [9,10,1117,18,19,20,21]
    Clinical relevance
    Generally appreciated, as most cases of human ischemic stroke have spontaneous or tPA-induced reperfusion.
    Limited, as human ischemic stroke is seldom permanent.
    [1415]

    Emerging data indicate that transient MCAO models may better mimic the pathophysiology of human stroke compared with permanent occlusion models in rats and mice (Table 1). In human stroke, cerebral vessel occlusion is seldom permanent, as most cases of human ischemic stroke have spontaneous or thrombolytic therapy-induced reperfusion [1415]. Leukocyte infiltration into the ischemic brain in transient MCAO models is more prominent, and antileukocyte strategies (including antiadhesion molecule strategies) have generally proven to be more effective in animal stroke models of transient but not permanent ischemia [815]. For this reason, experimental studies about leukocyte recruitment and ischemic brain injury are now performed mostly using transient cerebral I/R models in rats and mice [815].

    TIME-DEPENDENT RECRUITMENT OF INFLAMMATORY CELLS DURING CEREBRAL I/R

    The brain’s inflammatory responses to postischemia are characterized by a rapid activation of resident cells (mainly microglial cells), followed by the infiltration of circulating inflammatory cells, including granulocytes (neutrophils), T cells, monocyte/macrophages, and other cells in the ischemic brain region, as demonstrated in animal models [22,23,24,25] and in stroke patients [26,27,28,29]. In the acute phase (minutes to hours) of ischemic stroke, ROS and proinflammatory mediators (cytokines and chemokines) are released rapidly from injured tissue [2223]. These mediators induce the expression of the adhesion molecules on cerebral ECs and on leukocytes and thus, promote the adhesion and transendothelial migration of circulating leukocytes [8]. In the subacute phase (hours to days), infiltrating leukocytes release cytokines and chemokines, especially excessive production of ROS and induction/activation of MMP (mainly MMP-9), which amplify the brain-inflammatory responses further by causing more extensive activation of resident cells and infiltration of leukocytes, eventually leading to disruption of the BBB, brain edema, neuronal death, and hemorrhagic transformation [2223] (Fig. 1). However, many of these proinflammatory factors have a dual role at early and late stages of stroke. For instance, regardless of the cellular origin, MMP-9 has been shown to affect early ischemic brain damage detrimentally but promote brain regeneration and neurovascular remodeling in the later repair phase [22]. Thus, a thorough understanding of the time course of events leading to inflammation in ischemic brain injury is critical [23].

    Potential inflammatory pathways that respond to cerebral I/R. Mac-1 is a β2-integrin (CD11b/CD18); PSGL-1 actually functions as a ligand for E-/P-/L-selectins.

    Resident microglia and blood-derived macrophages

    Microglial cells, the resident macrophages of the brain, are activated rapidly in response to brain injury [3031]. Experimental data have shown that resident microglia are activated within minutes of ischemia onset and produce a plethora of proinflammatory mediators, including IL-1β and TNF-α, which exacerbate tissue damage [32,33,34] but may also protect the brain against ischemic and excitotoxic injury [35,36,37]. Postischemic microglial proliferation peaks at 48–72 h after focal cerebral ischemia and may last for several weeks after initial injury [3839]. In contrast to the rapid resident microglia response, blood-derived leukocytes are recruited to the brain tissue, usually with a delay of hours to a few days [242540].

    However, reactive microglia are morphologically and functionally similar to blood-derived monocyte/macrophages [2425]. To date, it has been difficult to distinguish these cells in the brain, as there is a lack of discriminating cellular markers [2441]. Blood-derived macrophages are able to acquire a ramified morphology indistinguishable from resident microglia, and reactive resident microglia can develop into a phagocytic phenotype indistinguishable from infiltrating macrophages. Fortunately, the use of chimeric mice with the GFP bone marrow provides a powerful tool to distinguish their roles and contributions in ischemic brain injury [242541]. Most current data have shown that blood-derived macrophages are recruited into the ischemic brain tissue, most abundantly at Days 3–7 after stroke (but not significant prior to 3 days after cerebral ischemia) [41,42,43,44]. Schilling et al. [244142] show that resident microglial activation precedes and predominates over blood-derived macrophage infiltration after transient MCAO in a chimeric mouse model. These studies demonstrated that neutrophils are the first blood-derived leukocytes seen at Day 1 in the damaged brain, whereas blood-derived macrophages (GFP-positive) were rarely observed at Day 2 but reached peak numbers at Day 7 and decreased thereafter. In contrast, resident microglial cells (GFP-negative) are already activated rapidly at Day 1 after focal cerebral ischemia. Intriguingly, even at Days 4 and 7, most macrophage-like cells remain GFP-negative, indicating that they are resident microglia-derived; however, in mouse models of transient MCAO [45] and permanent MCAO [25], others demonstrate that blood-derived macrophages (Iba1-positive) are infiltrated into the brain 24–48 h after focal cerebral ischemia, but the number of the infiltrating macrophages remains much lower than activated resident microglia. Together, most current data support the hypothesis that the vast majority of macrophage-like cells in the ischemic brain represents activated resident microglia, especially during the first few days following cerebral I/R injury.

    Neutrophils

    Of the various types of leukocytes, neutrophils are among the first to infiltrate ischemic brain (30 min to a few hours of focal cerebral ischemia), peak earlier (Days 1–3), and then disappear or decrease rapidly with time [823]. However, the infiltrating neutrophils may remain more than 3 days or longer in the ischemic brain after focal cerebral I/R, but most likely, their existence is largely masked after 3 days by large-scale accumulation of activated microglia/macrophages in the inflammatory site [46]. In the rat model of endothelin-1-induced cerebral ischemia, Weston et al. [46] observed that neutrophil infiltration into the brain increases at 1 day, peaks at 3 days, and although reduced, continues through 7 and 15 days after cerebral ischemia.

    A recent study seems to challenge the current view, as it provides evidence demonstrating that the recruitment of other inflammatory cells may precede neutrophil infiltration in response to cerebral ischemia [47]. In a mouse transient MCAO model, flow cytometric analysis of cell samples isolated from the ischemic brains shows that the majority of leukocyte cells in the ischemic hemisphere at 3 days after MCAO includes neutrophils [47], which is consistent with most reports in the literature [434849]. However, an interesting observation is that the infiltration of other inflammatory cells, including macrophages, lymphocytes, and DCs, in the ischemic hemisphere precedes the neutrophilic influx [47].

    T lymphocytes

    Earlier studies suggest that lymphocyte recruitment into the brain is involved in the later stages of ischemic brain injury [50,51,52]. In a rat model of the photochemically induced focal ischemia, immunocytochemistry reveals that numerous T cells infiltrated the border zone around the infarct by Day 3, and the number of infiltrating T cells increased further between Days 3 and 7 [50]. In a mouse model of transient MCAO, flow cytometeric examination of the inflammatory cell infiltration in the ischemic brain reveals that (CD3+) T cells increased relatively late (3–4 days) postischemia, whereas activated (CD11b+) microglia/macrophages and (Ly6G+) neutrophils increased significantly at earlier times postischemia [52]. However, more recent studies in rodent models demonstrate that T cells accumulate in the ischemic brain within the first 24 h after focal cerebral I/R and may influence the evolution of tissue inflammation and injury prior to their appearance in the extravascular brain compartment [4053]. In recent years, increasing research efforts have been devoted to the roles of specific T cell subtypes in ischemic stroke. There are many subtypes of lymphocytes, and several subtypes of T cells have been implicated in the pathogenesis of ischemic stroke [840]. However, the time course of the recruitment of different subtypes of T cells into the ischemic brain remains largely undetermined.

    Other inflammatory cells

    In addition to the above leukocytes, several other types of inflammatory cells such as DCs and MCs have been implicated recently in ischemic brain injury. These inflammatory cells are considered as early responders to act in the first-line defense in response to cerebral ischemia. In a mouse model of transient MCAO, Felger et al. [54] show that DCs accumulated in the ischemic hemisphere at 24 h after focal cerebral ischemia, particularly in the border region of the infarct where T cells accrued. MCs in the brain are typically located perivascularly and contain potent, fast-acting vasoactive and proteolytic substances. In a rat model of transient MCAO, Strbian et al. [55] show that brain MCs regulate early brain swelling and neutrophil accumulation at 4 h after ischemia.

    In summary, our current knowledge about the time-dependent infiltration of inflammatory cells into the brain is based on immunohistochemistry and especially on flow cytometry of brain samples [4752]. However, there are important limitations of these approaches. For flow cytometric analysis, there is a need to isolate cells from brain tissue using enzymatic digestion ex vivo. The surface antigens for specific types of inflammatory cells may be modulated after the enzymatic digestion. In addition, immunohistochemistry and flow cytometry cannot examine dynamic alteration in the same animal as a result of a nonsurvival procedure. Similarly, our current knowledge about adhesive interactions of inflammatory cells with cerebral microcirculation after cerebral I/R is based on optical imaging technologies (especially on intravital microscopy), which allow for observation and quantification of cell adhesion to the walls of intact cerebral microvessels [840]. There are important limitations of these approaches, including the need to examine microvessels on or near the brain surface, labeling the total leukocyte population, and being unable to assess early and late adhesive events in the same animal as a result of a nonsurvival procedure. Of note, there are many inconsistencies in the literature about the time course of the recruitment of various inflammatory cells in the brain following focal cerebral ischemia, even in the very same experimental animal models [4752] (Fig. 2).

    Schematic showing a time-dependent recruitment of inflammatory cells into the brain following focal cerebral ischemia in mice. The figure, adapted from (A) ref. [52] and (B) ref. [47] with permission. Note that a transient 60-min MCAO model in C57Bl6 mice was used in both reports.

    With improvements in imaging technology and labeling methods, such as positron emission tomography/single photon emission tomography and functional MRI, it has now become possible to examine accurately inflammatory cell trafficking and the molecular activity (e.g., MPO and oxidative activity) noninvasively in ischemic brain parenchyma in living animals. Advanced imaging techniques and experimental approaches will provide the opportunity to visualize and assess more directly the dynamic profiles of specific inflammatory cell trafficking, adhesive interactions, and molecular activity of these inflammatory cells with cerebral microcirculation and with each other in the brains of living animals at early and late stages of cerebral I/R. The application of such imaging technologies and approaches should help to address some important unanswered questions about how these cells contribute to ischemic brain injury differentially and collaboratively.

    ROLE OF ACTIVATED MICROGLIA/MACROPHAGES IN CEREBRAL I/R DAMAGE

    Resident microglial cells are major inflammatory cells in the brain that are among the first cells to respond to brain injury, and multiple lines of evidence have shown that activated microglia play a dual role in ischemic stroke. Microglia exert neurotoxic functions through the production of ROS via NADPH oxidase [56], cytokines (IL-1β, IL-6, TNF-α) [3031], and MMP-9 [57]. These events precede leukocyte infiltration into the brain and may play a crucial role in mediating the initial increase in BBB permeability and the early infiltration of circulating leukocytes into the brain [56,57,58]. Microglia activation potentiates damage to BBB integrity, whereas inhibition of microglial activation may protect the brain after ischemic stroke by improving BBB viability and integrity in vivo and in vitro [58].

    In contrast, activated microglia also appear to play a neuroprotective role after cerebral ischemia [59,60,61,62]. Production of neurotoxic and neuroprotective factors emphasizes the complex role of resident microglia in the process of tissue damage, neuronal survival, and regeneration in the response to cerebral ischemia. The protective role of microglia is possibly mediated by their ability to eliminate excess excitotoxins in the extracellular space, in part through phagocytosis of infiltrating neutrophils [39]. Further, accumulating evidence indicates that microglia can produce various neurotrophic factors such as neurotrophins and growth factors (fibroblast growth factor, TGF-β1), which are involved in neuronal survival and brain tissue repair in cases of brain injury [59,60,61,62]. Intriguingly, recent work [63] has identified a neuroprotective role for microglia-derived TNF in cerebral ischemia through TNF-p55R in mice.

    Experimentally, TNF has neuroprotective and neurotoxic effects. Although TNF can be produced by microglia and infiltrating leukocytes in the brain, the neuroprotective effects of TNF appear to be attributed to microglia- but not leukocyte-derived TNF. These findings may have clinical relevance and potential applications. TNF is implicated in ischemic stroke and trauma in humans [64], where similar to the mouse [6566], it is produced by microglia and infiltrating leukocytes [67]. In addition, abundant evidence indicates a neuroprotective role of proliferating microglial cells in cerebral ischemia in vivo [3839]. Selective ablation of proliferating microglial cells exacerbates ischemic brain injury associated with a decrease in insulin-like growth factor-1 and an increase in cytokines (IL-1β, IL-6, TNF-α) [38].

    As discussed above, activated microglia are morphologically and functionally indistinguishable from blood-derived monocyte/macrophages in the brain. Thus, it has been difficult to determine their distinct contribution to the pathogenesis of ischemic stroke. Nevertheless, the difference of the time course of their recruitment in the brain suggests that they contribute to ischemic brain injury in different time-dependent manners. Experimental studies using GFP bone marrow chimera mice indicate that blood-derived macrophage infiltration into the brain occurs at a later time after focal cerebral I/R [242541]. These studies have revealed significant differences in terms of the ratio and contribution of resident microglia versus exogenous infiltrating macrophages to early postischemic cerebral injury. Resident microglia dominate over blood-derived macrophages during the first 3–4 days of cerebral I/R [242541]. In the absence of blood-derived monocytes, brain microglia is able to differentiate into macrophages [56].

    Regardless of their origin, activated microglia/macrophages seem to be critical in the clearance of infiltrating neutrophils after cerebral I/R. As discussed above, neutrophil infiltration occurs in the first 3 days after cerebral I/R, and thereafter, macrophage-like cells replace them as the dominant inflammatory cells in the ischemic site. The major pathway for clearance of infiltrating neutrophils and their potentially cytotoxic substances from the inflammatory sites is apoptosis followed by engulfment by activated microglia/macrophages [68,69,70,71]. Macrophages can resolve neutrophils and therefore, reduce neuronal injury by triggering neutrophil apoptosis, engulfing them, and thereby preventing the release of cytotoxic substances into the surrounding tissue [6869]. Induction of apoptosis and phagocytosis of apoptotic neutrophils by reactive microglia/macrophages is a critical step in the resolution of the inflammatory response and in preventing further exacerbation of the ischemic injury [6971]. In a rat model of endothelin-1-induced cerebral ischemia, Weston et al. [4672] demonstrate that large-scale emigration of neutrophils into the ischemic region occurs during the first day and peaks at 3 days after cerebral ischemia. Double immunostaining clearly shows that macrophages (stained by ED-1) engulf neutrophils (stained by anti-polymorphonuclear neutrophil sera) in the brain and that this engulfment of invading neutrophils increases with time (50% of neutrophils in the brain are engulfed at 3 days and 85% at 15 days) [46]. Nevertheless, it is unclear whether the “ED-1-stained cells” in the brain represent activated resident microglia or/and infiltrating macrophages.

    ROLE OF NEUTROPHIL INFILTRATION IN CEREBRAL I/R DAMAGE

    Despite intense investigation, the exact role of neutrophils in the pathogenesis of ischemic stroke remains under debate. Most experimental and clinical studies support the importance of neutrophil infiltration in ischemic stroke. In animal models of focal cerebral I/R, recruitment of neutrophils in the ischemic brain occurs within 30 min to a few hours and peaks in the first 3 days [823]. Genetic deficiency or antibody blockade of leukocyte adhesion molecules (e.g., ICAM-1, CD11b/CD18, P-selectin) [8,9,10,1117,18,19,20,2149] has been shown to reduce infarct volume, brain edema, neurological deficits, and mortality in animal models of ischemic stroke. These protective effects appear to be more effective in the transient but not permanent MCAO models in rats and mice. Clinical studies have confirmed that neutrophils accumulate intensively in the regions of human cerebral infarction, and this accumulation is correlated with the severity of the brain tissue damage and poor neurological outcome after ischemic stroke [282973]. Furthermore, total leukocyte and neutrophil counts are increased in the first 3 days after symptom onset in stroke patients, and this is associated with larger final infarct volumes (on CT and MRI) and increased stroke severity [2729]. A number of potential mechanisms may explain how activation and accumulation of neutrophils contribute to the pathogenesis of ischemic stroke. These mechanisms include: excessive production of ROS, such as superoxide and hypochlorous acid via NADPH oxidase and MPO, respectively; release of a variety of proinflammatory cytokines (IL-1β, IL-6, TNF-α) and chemokines (MCP-1, MIP-1α, IL-8); release of elastase and MMPs (mainly MMP-9); and enhancing expression of leukocyte β2-integrins (Mac-1, LFA-1) and adhesion molecules (PSGL-1, L-selectin). By these mechanisms, infiltrating neutrophils amplify a cerebral inflammatory response that may exacerbate ischemic brain injury further [82223(Fig. 1). Nevertheless, the pathogenic role of neutrophils in ischemic stroke remains uncertain, and some studies fail to demonstrate a clear correlation between neutrophil infiltration and infarct formation [74,75,76,77,78,79].

    Recent studies suggest that neutrophil infiltration may play a more prominent role in the pathogenesis of ischemic stroke in individuals with elevated systemic inflammation. In stroke patients with prior infection, total leukocyte and neutrophil counts and the extent of leukocyte-platelet adhesion and activation are elevated in the circulation [298081]. Recent experimental studies have shown that systemic inflammation exacerbates neutrophil infiltration in the brain and thus, alters the kinetics of the BBB tight junction disruption after experimental stroke in mice [482]. These studies clearly demonstrate that infiltrating neutrophils are the primary source of increased (fivefold) MMP-9 activity in the ischemic brain of IL-1β-challenged mice at 4, 8, or 24 h after MCAO. A transformation from transient to sustained BBB disruption caused by enhanced neutrophil-derived neurovascular MMP-9 is a critical mechanism underlying the exacerbation of ischemic brain injury by systemic inflammation, mediated through conversion of a transient to a sustained disruption of the tight junction protein, claudin-5, and markedly exacerbated disruption of the cerebrovascular basal lamina protein, collagen-IV [82]. These molecular mechanisms may contribute to the poor clinical outcome in stroke patients presenting with antecedent infection. Stroke patients presenting with an elevated systemic inflammatory status may be at increased risk of MMP-9-mediated neurovascular proteolysis and hemorrhagic transformation [83], particularly when recombinant tPA is administered for thrombolytic therapy, as tPA is known to promotes neutrophil degranulation and MMP-9 release [8485]. In this regard, it is critical to better understand the exact roles of neutrophils in the pathogenesis of ischemic stroke under clinically relevant conditions that are linked to an elevated systemic inflammatory status, such as prior infection, atherosclerosis, type 2 diabetes, obesity, and rheumatoid arthritis.

    ROLE OF DIFFERENT SUBTYPES OF T LYMPHOCYTES IN CEREBRAL I/R DAMAGE

    In recent years, considerable research efforts have been devoted to understanding the roles of lymphocytes in ischemic brain injury. Several subtypes of T cells have been implicated in the pathogenesis of ischemic stroke, and accumulating evidence indicates that different subtypes of T cells play differential roles in response to cerebral I/R injury.

    CD4+ and CD8+ T cells

    Experimental evidence indicates that in the vascular bed of other organs (e.g., intestine, liver, and kidney), CD4+ and CD8+ T cells contribute importantly to the pathogenesis of I/R injury [86,87,88]. Recent work has shown that CD4+ and CD8+ T cells are major contributors to brain inflammation in a mouse model of transient MCAO. Studies using intravital video microscopy show that Rag1(−/−), CD4+ T cell(−/−), CD8+ T cell(−/−), and IFN-γ(−/−) mice have comparable, significant reductions in cerebral I/R-induced leukocyte and platelet adhesion in cerebral microcirculation, compared with wild-type mice after exposure to focal cerebral I/R [40]. Futhermore, data indicate that CD4+ and CD8+ T cells contribute to the inflammatory and thrombogenic responses, brain infarction, and neurological deficit associated with experimental stroke [40]. Moreover, experimental studies have shown that CD4+ TH1 cells may play a key role in the pathogenesis of stroke through releasing proinflammatory cytokines, including IL-2, IL-12, IFN-γ, and TNF-α, whereas CD4+ TH2 cells may play a protective role through anti-inflammatory cytokines such as IL-4, IL-5, IL-10, and IL-13 [89]. It is important to note that some of these cytokines, especially IFN-γ, are known to be critical in prevention of infections, which are a leading cause of death in stroke patients, especially in the postacute phase of stroke [90], which results mainly from immunodepression caused by depletion of circulating T cell and NK cell populations and therefore, the antibacterial cytokine IFN-γ in the early reperfusion period [90]. Therefore, treatment of stroke patients by targeting T cells must be designed carefully to evaluate and reduce deleterious and enhance protective actions of specific T cell subtypes.

    Treg cells

    Treg cells come in many forms, including CD4+CD25+ forkhead box p3+ T cells (Tregs) and other subsets. Treg cells play a key part in controlling immune responses under physiological conditions and in various systemic and CNS inflammatory diseases [91,92,93]. Experimental data have shown that Treg cells are capable of modulating effector T cell function and secreting anti-inflammatory cytokines (IL-10, TGF-β) [9495]. These actions enable Treg cells to be pivotal players in the fields of self-tolerance, immunologic homeostasis, and damage control at the site of inflammation [96]. More recently, an elegant study by Liesz et al. [97] reveals that the Treg cells are key cerebroprotective immunomodulators in acute experimental stroke in mice. They found that Treg cells prevent secondary infarct growth by counteracting excessive production of proinflammatory cytokines and by modulating invasion and/or activation of lymphocytes and microglia in the ischemic brain. Depletion of Treg cells increases delayed brain damage profoundly and deteriorates functional outcome, and Treg cells antagonize enhanced TNF-α and IFN-γ production, which induce delayed inflammatory brain damage. Also, Treg cell-derived secretion of IL-10 is the key mediator of cerebroprotection via suppression of deleterious cerebral cytokine (TNF-α, IFN-γ) production. Absence of Treg cells augmented postischemic activation of resident and infiltrating inflammatory cells including microglia and T cells, the main sources of cerebral TNF-α and IFN-γ [9798], respectively. TNF-α expression is elevated early after ischemia in the brain, where it is generated predominantly by microglia. Whereas IFN-γ is almost absent in normal brain tissue, its expression increases at a later time-point after cerebral ischemia than does TNF-α expression, and its expression is strongly induced after Treg cell depletion. Taken together, these findings reveal a previously unknown role of the Treg cells as cerebroprotective immunomodulators after stroke, thus potentially providing new insights into the endogenous adaptive immune response after acute brain ischemia.

    γδT cells

    γδT cells represent a small subset of T cells that possesses a distinct TCR on their surface. A majority of T cells has a TCR composed of two glycoprotein chains, called α and β TCR chains. In contrast, in γδT cells, the TCR is made up of one γ-chain and one δ-chain. This group of T cells is usually much less common than αβT cells [99]. The conditions that lead to responses of γδT cells are not fully understood, and current concepts of γδT cells as “first line of defense”, “regulatory cells”, or “bridge between innate and adaptive responses” [99] only address facets of their complex behavior. A recent study by Shibata et al. [100] demonstrates that resident γδT cells control early infiltration of neutrophils in the peritoneal cavity of mice after Escherichia coli infection. They indicate that a rapid and transient production of IL-17 after i.p. infection with E. coli precedes the influx of neutrophils. Flow cytometric analysis of intracellular cytokine demonstrates that the γδT cell population is the major source of IL-17. Neutralization of IL-17 results in a reduced infiltration of neutrophils and impaired bacterial clearance. Mice depleted of γδT cells by anti-TCR-γδ mAb treatment have diminished IL-17 production and reduced neutrophil infiltration after E. coli infection [100]. More recently, an elegant study by Shichita et al. [101] reveals a pivotal role of cerebral IL-17-producing γδT cells in the delayed phase of ischemic brain injury. In a mouse model of transient MCAO, they demonstrate that the infiltration of T cells into the brain as well as the production of cytokines IL-17 and IL-23 play pivotal roles in the evolution of brain infarction and accompanying neurological deficits. Blockade of T cell infiltration into the brain by the immunosuppressant FTY720 reduced cerebral I/R damage. The expression of IL-23 (most likely derived from activated microglia/macrophages) [102103] increases on Day 1 after I/R, whereas IL-17 levels are elevated after Day 3, and this induction of IL-17 was dependent on IL-23. Immunohistochemistry shows that γδT cells are localized in the infarct boundary zones at 4 days after cerebral I/R. Intracellular cytokine staining confirms that γδT cells are a major source of IL-17. Further, gene knockouts demonstrate that IL-23 functions in the immediate stage of cerebral I/R injury, whereas IL-17 is an important role in the delayed phase of cerebral I/R injury, during which apoptotic neuronal death occurs in the penumbra. A significant reduction in infarct volume is observed in TCR-γδ knockout mice, as well as in mice treated with TCR-γδ-specific antibody [100]. These findings reveal a previously unknown role of the γδT cells in the pathogenesis of ischemic stroke. Therefore, the γδT cells could be a novel, therapeutic target for limiting the inflammatory events that amplify the initial damage during cerebral I/R.

    ROLE OF OTHER INFLAMMATORY CELLS IN CEREBRAL I/R DAMAGE
    DCs

    DCs are immune cells that form part of the mammalian immune system and constitute key elements in the control of immune activation or immune tolerance [104]. Their main function is to process antigen material and present it on the surface to other cells of the immune system, thus functioning as effective APCs [105]. There are at least two major lineages of DCs [106]: mDCs, which respond to bacteria and fungi, releasing IL-12, and pDCs, which release IFN-α upon viral infection. Both lineages are detected as DCPs in blood, patrolling through the circulation and invading the tissue in response to a local infection or other inflammatory situation. mDCs and/or pDCs appear to play a role in several proinflammatory diseases, especially atherosclerosis [104107]. In multiple sclerosis, mDCs invade the human brain, subsequently triggering cerebral inflammation [108].

    Several clinical and experimental studies suggest the potential importance of DCs in cerebral inflammation and tissue injury during ischemic stroke [54109110]. Using flow cytometeric analysis of blood samples, Yilmaz et al. [109] found that acute stroke leads to a significant but transient decrease in circulating DCPs within 24 h after symptom onset in stroke patients, and patients with large stroke size in CT scan have significantly lower mDCP, pDCP, and total DCPs than those with smaller stroke. Follow-up analysis shows a significant recovery of circulating DCP in the first 2–4 days after stroke. Double immunohistochemical staining demonstrates colocalization of mDCs and T cells and a high expression of HLA-DR close to mDCs observed, suggesting that mDCs are mature and able to activate T cells in the infarcted brain [109]. Thus, circulating DCPs may be recruited into the infarcted brain and thereby trigger cerebral immune/inflammatory reactions in the brain. This view is also supported by previous findings that have shown that DCs are present in the ischemic brain in a rat model of permanent MCAO [110]. Immunohistochemistry showed that numbers of DCs are low in nonischemic (sham) brains but are elevated in the ischemic hemispheres at 1 h (11-fold increase) and increase further in the 6-day observation period with an 84-fold increase at 6 days after MCAO. Activated DCs expressing MHC-II remain elevated at 6 days after MCAO in the ischemic versus nonischemic hemispheres [110]. More recently, Gelderblom et al. [47] demonstrate that DCs are increased by 20-fold on Day 3 and 12-fold on Day 7 and thus, constituted a substantial proportion of infiltrating cells. DCs exhibit a significant up-regulation of MHC-II, and the increase of DCs is even more pronounced if only MHCII high-expressing DCs are analyzed (100-fold increase). To date, there is no direct experimental evidence showing the correlation between the increase of DC numbers and brain infarction in cerebral ischemia. Nevertheless, these previous observations may constitute a basis for further studies about DCs in the pathogenesis of ischemic stroke.

    MCs

    MCs reside in a variety of locations in the brain of different species, including humans, where they appear to be concentrated in the diencephalic parenchyma, thalamus, and cerebral cortex [111112]. Their subendothelial and perivascular location at the boundary between the intravascular and extravascular milieus and their ability to respond rapidly to blood- and tissue-borne stimuli via release of potent vasodilatory, proteolytic, fibrinolytic, and proinflammatory mediators render MCs with a unique status to act in the first-line defense in various pathologies [55]. Experimental evidence indicates an emerging role of mast cells in cerebral ischemic injury and hemorrhage [55]. In experimental cerebral I/R, MCs regulate BBB permeability, brain edema formation, and the intensity of local neutrophil infiltration [55]. Strbian et al. [113] demonstrate that cerebral MCs regulate early ischemic brain swelling and neutrophil accumulation in a rat model of transient MCAO. Pharmacological MC-blocking (sodium cromoglycate) leads to a 39% decrease in brain swelling, and compound 48/80 (MC-degranulating agent) elevates it by 89%. Early ischemic BBB leakage and postischemic neutrophil infiltration are significantly lower in MC-deficient rats than in the wild-type. In addition, MCs appear to play a role in the tPA-mediated cerebral hemorrhages after experimental ischemic stroke and to be involved in the expansion of hematoma and edema following intracerebral hemorrhage [113114]. MC stabilization was reported to reduce hemorrhagic transformation and mortality after administration of thrombolytics in experimental ischemic stroke [114]. Thus, MC stabilization may provide an adjuvant therapy in treatment of acute ischemic stroke in patients.

    ANTI-INFLAMMATORY THERAPY

    The pathologic processes after ischemic stroke can be separated into acute (within hours), subacute (hours to days), and chronic (days to months) phases [115116]. Clinical and experimental data show an acute and prolonged inflammatory response in the brain after stroke, and leukocyte recruitment is a hallmark feature of the prolonged inflammatory response that occurs over hours to days after cerebral ischemia [117118]. Experimental stroke studies demonstrate that reperfusion represents an especially vulnerable period for the brain [8,9,10,11], as it provides the potential benefits of restoring blood flow to an ischemic region and simultaneously opens the flood gates for a massive influx of activated leukocytes into ischemic tissue. Thereby, the subacute reperfusion period after a stroke is considered more amenable to treatment than acute neurotoxicity [116,117,118]. It is hypothesized that stroke outcomes may be improved by antileukocyte strategies (including antiadhesion molecule strategies), which are targeted specifically to the reperfusion period. This hypothesis is supported by numerous experimental findings [815]. As discussed above, inhibition of leukocyte infiltration into the ischemic brain via antiadhesion molecules (e.g., CD11b/CD18, ICAM-1, P-selectin) has been shown to reduce infarct size, edema, and neurological deficits in transient MCAO stroke models in rats and mice [9,10,1117,18,19,20,2172], but the benefits do not extend to permanent MCAO [910]. Further, experimental studies demonstrate that antileukocyte strategies may extend the therapeutic time window of tPA reperfusion therapy in acute stroke [815]. For example, in a rat thromboembolic stroke model, UK-279276 treatment reduces infarct size only in combination with tPA and prolongs the efficacy “time window” for tPA from 2 h to 4 h [11]. UK-279276 is a recombinant glycoprotein and is a selective antagonist of the CD11b integrin of Mac-1 (CD11b/CD18) and has been shown to reduce neutrophil infiltration and infarct volume in the transient MCAO model in rats when administered within 4 h after onset of ischemia [119]. These results raise the question of whether antileukocyte strategies provide an effective therapy for stroke patients.

    Clinically, several drugs that target neutrophil recruitment have been developed as potential therapies for ischemic stroke. Three such drugs were tested in clinical trials: a mAb to ICAM-1 (Enlimomab, R6.5) [12], a humanized antibody to the CD11b/CD18 (Hu23F2G or LeukArrest) [13], and the UK-279276 [120]. All clinical trials with these drugs have been unsuccessful as a result of lack of neuroprotective efficacy and side-effects such as leukopenia and immunosuppression. These clinical outcomes further intensify the debate over the role of neutrophils in ischemic stroke [74,75,76,77,78,79] and raise the question of whether inflammation in general and neutrophils in particular may serve as useful therapeutic targets in treatment of human stroke.

    Despite intense investigation, it remains unclear why anti-inflammatory therapy succeeded in animal models but not in clinical application. Can animal models truly replicate human stroke? The main limitations of the most current animal studies include at least the following: limited clinical relevance of the experiments in animal stroke models that are performed in young and healthy animals and normal physiological conditions and targeting single-cell type (mainly neutrophils) and single adhesion molecule (e.g., ICAM-1 or CD11b/CD18). It is widely acknowledged that no single animal model replicates human stroke perfectly, and the current animal models do not replicate the complexities of human stroke. Nevertheless, animal models can provide mechanistic insights that have correlated quite well with clinical findings in terms of the pathophysiology of stroke [15].

    In addition to neutrophils, in recent years, considerable research has been devoted to understanding the roles of other cell types, in particular, T lymphocyte subtypes in ischemic brain injury. Many relevant questions remain largely unanswerable, at least at present; for example, how different inflammatory cells work together in the brain after stroke (in temporal and spatial domains with different time-dependent manners) and whether (and how) these cells function in a common pathway contributing to the pathogenesis of ischemic stroke. There are no definitive answers to questions such as these, because of the complexity and multiplicity of the mechanisms by which inflammatory cells contribute to ischemic brain damage. Not only do different types of inflammatory cells contribute differentially to the pathogenesis of ischemic stroke, but also, the same cell type may play different roles in different stages of ischemic stroke. Moreover, the same molecule produced by different cells (e.g., microglia- and leukocyte-derived TNF-α) may play different roles [6364]. Nevertheless, oxidative stress might serve as a common pathway for different inflammatory cells [56]. Oxidative stress is an important mediator of tissue injury in acute ischemic stroke. During ischemic stroke, ROS are generated by various types of inflammatory cells and trigger the expression of a number of proinflammatory genes, including cytokines and adhesion molecules, which play an important role in leukocyte-endothelium interactions and secondary brain damage after cerebral ischemia. These proinflammatory genes are regulated by oxidant-sensitive transcription factors (e.g., NF-κB) [56].

    CONCLUSIONS

    Emerging data suggest that inflammatory cells play complex and multiphasic roles after ischemic stroke, and most of the cell types display beneficial and adverse effects. There is a growing body of evidence that inflammatory cell infiltration is predominantly deleterious in the early phase after ischemic stroke. Antileukocyte strategies (including antiadhesion molecule strategies) reduce ischemic brain injury in animal models; however, attempts to translate experimental findings into clinical therapies have been unsuccessful. Most likely, targeting a single cell type or single adhesion molecule is not a feasible way to treat human stroke. Many relevant questions remain to be answered; for example, how different inflammatory cells work together in the brain after stroke; whether (and how) these cells contribute to the pathogenesis of ischemic stroke via a common pathway; and how to evaluate and reduce deleterious and enhance protective actions of specific types of inflammatory cells. By addressing these questions, future research might provide novel, alternative stroke mechanisms and develop new therapeutic directions for ischemic stroke. Future efforts should be directed toward defining the time-dependent interactions between inflammatory cells and their interactions with cerebral vasculature with advanced brain imaging technologies and other approaches in animal models and human stroke patients. Future basic research should be performed under clinical relevant conditions linked to elevated inflammatory states, such as prior infection, atherosclerosis, and type 2 diabetes. More sophisticated therapies with pleiotropic beneficial effects and more sophisticated targeting of potential inflammatory cells (and molecules) will increase the likelihood of successful clinical translation [116].

    AUTHORSHIP

    The concept, design, and writing of the manuscript: Guohong Li; the literature search and discussion of the manuscript: Rong Jin and Guojun Yang, who equally contributed to this work.

    ACKNOWLEDGMENTS

    The work was supported by the National Institutes of Health grant HL087990 (G.L.) and by a Scientist Development grant (0530166N) from American Heart Association (G.L.). We give special thanks to Dr. Michael Wyss for critical review of this manuscript.

    Footnotes

    Abbreviations: BBB=blood-brain barrier, CT=computed tomography, DC=dendritic cell, DCP=DC precursor, EC=endothelial cell, I/R=ischemia and reperfusion, LFA-1=lymphocyte function associated antigen 1, Mac-1=leucocyte integrin CD11B/CD18, MC=mast cell, MCA=middle cerebral artery, MCAO=MCA occlusion, mDC=myeloid DC, MMP=matrix metalloproteinase, MPO=myeloperoxidase, MRI=magnetic resonance imaging, pDC=plasmacytoid DC, PSGL-1=P-selectin glycoprotein ligand-1, ROS=reactive oxygen species, tPA=tissue plasminogen activator, Treg cell=T regulatory cell

    References

    Uhohinc

    unread,
    Sep 22, 2021, 12:36:57 AM9/22/21
    to Clinuvel Afamelanotide SCENESSE senescence CUV ASX.CUV CLVLY ur9
    RESEARCH PAPER

    The melanocortin MC1 receptor agonist BMS-470539 inhibits leucocyte trafficking in the inflamed vasculature
    First published: 13 April 2010
     
    Citations: 27
    Abstract

    Background and purpose: Over three decades of research evaluating the biology of melanocortin (MC) hormones and synthetic peptides, activation of the MC type 1 (MC1) receptor has been identified as a viable target for the development of novel anti-inflammatory therapeutic agents. Here, we have tested a recently described selective agonist of MC1 receptors, BMS-470539, on leucocyte/post-capillary venule interactions in murine microvascular beds.

    Experimental approach: Intravital microscopy of two murine microcirculations were utilized, applying two distinct modes of promoting inflammation. The specificity of the effects of BMS-470539 was assessed using mice bearing mutant inactive MC1 receptors (the recessive yellow e/e colony).

    Key results: BMS-470539, given before an ischaemia–reperfusion protocol, inhibited cell adhesion and emigration with no effect on cell rolling, as assessed 90 min into the reperfusion phase. These properties were paralleled by inhibition of tissue expression of both CXCL1 and CCL2. Confocal investigations of inflamed post-capillary venules revealed immunostaining for MC1 receptors on adherent and emigrated leucocytes. Congruently, the anti-inflammatory properties of BMS-470539 were lost in mesenteries of mice bearing the inactive mutant MC1 receptors. Therapeutic administration of BMS-470539 stopped cell emigration, but did not affect cell adhesion in the cremasteric microcirculation inflamed by superfusion with platelet-activating factor.

    Conclusions and implications: Activation of MC1 receptors inhibited leucocyte adhesion and emigration. Development of new chemical entities directed at MC1 receptors could be a viable approach in the development of novel anti-inflammatory therapeutic agents with potential application to post-ischaemic conditions.

    Abbreviations:
    • ACTH
    • adrenocorticotrophin
    • αMSH
    • alpha-melanocyte-stimulating hormone
    • IR
    • ischaemia–reperfusion
    • LPS
    • lipolysaccharide
    • PAF
    • platelet-activating factor
    Introduction

    The concept of active resolution in inflammation has, in recent years, gained such momentum that several studies are detailing the mechanisms that ensure the correct time – and spatial – dependence of this important phase of the host response. Specific pathways are activated in the body to ensure that, for instance, the process of leucocyte migration, which is incited by several classes of pro-inflammatory mediators and adhesion molecules (Ley et al., 2007), will subside over time in an active mode (Serhan and Savill, 2005Gonzalez-Rey and Delgado, 2007Serhan et al., 2007).

    α-Melanocyte-stimulating hormone (α-MSH) and adrenocorticotrophin (ACTH) are endogenous polypeptides that belong to the group of endogenous anti-inflammatory mediators (Gonzalez-Rey and Delgado, 2007Brzoska et al., 2008). These molecules activate specific receptors, melanocortin (MC) receptors (nomenclature follows Alexander et al., 2009), which inhibit, on one hand, the production of pro-inflammatory cytokines from target cells (Catania et al., 2004), and, on the other, put in motion pro-resolving processes including the induction of haem oxygenase 1 (Lam et al., 2005). In integrated systems, these molecular and cellular events would lead to a tight control on the experimental inflammatory response preventing its overshooting.

    From a pathophysiological perspective, compelling evidence for the inhibitory functions of this pathway derives from the exacerbation of colitis observed in mice bearing an inactive MC1 receptor (the recessive yellow e/e mouse colony) (Maaser et al., 2006). On the other hand, MC3 receptor null mice present a higher degree of vascular inflammation following an ischaemia–reperfusion (IR) insult (Leoni et al., 2008). This response is associated with higher levels of pro-inflammatory cytokines as measured in injured tissues. The same holds true in MC3 null mice after 3 months of high-fat diet, where augmented tissue expression of pro-inflammatory chemokines occurs during development of an obese-like status (Trevaskis et al., 2007).

    Natural and synthetic MC peptides bring about homeostatic and anti-inflammatory actions by activating either MC1 or MC3 receptors. Utilization of agonists with different degrees of selectivity for these receptors produces remarkable tissue-protective and anti-inflammatory effects (Brzoska et al., 2008). Three decades of research into the biology of MC peptides and their receptors on their effect on innate immunity presents an opportunity to exploit this immunomodulatory system for therapeutic development (Catania et al., 2004Getting, 2006Brzoska et al., 2008). Modification of short sequences of natural MCs is a viable way forward in drug development (Grieco et al., 2000Brzoska et al., 2008Doi et al., 2008). Another way forward would lie in the identification and development of novel chemical entities that would activate, selectively, either MC1 or MC3 receptors, and this goal has recently been achieved for MC1 receptors. The compound, BMS-470539, binds to human MC1 receptors in the low nanomolar range, and, in mice, inhibits lipopolysaccharide (LPS)-induced systemic tumour necrosis factor (TNF) release and LPS-induced leucocyte migration into the lung (Kang et al., 2006).

    Our recent study performed with MC3 receptor null mice demonstrated expression of MC1 receptor mRNA and protein in the post-ischaemic tissue (Leoni et al., 2008); we tested here whether BMS-470539 would exert anti-inflammatory actions on the vascular inflammation in the mesentery that follows an IR procedure. These data have been extended to another protocol for intravital microscopy using a distinct microvascular bed (cremasteric microcirculation) and inflammatory stimulus [topically applied platelet-activating factor (PAF)]. Finally, we determined whether these pharmacological effects of BMS-470539 were mediated by activation of endogenous MC1 receptors using mice bearing a mutant and inactive receptor.

    Materials and methodsAnimals

    All animal care and experimental protocols complied with the guidelines laid down by the Ethical Committee for the Use of Animals, Barts and The London School of Medicine and the Home Office regulations (Guidance on the Operation of Animals, Scientific Procedures Act, 1986). Male mice (2–3 weeks old, ∼20 g body weight) were maintained on a standard chow pellet diet and had free access to water, with a 12 h light/dark cycles. Wild-type (WT) animals (strain C57BL/6J; B & K, Hull, UK) were used 7 days after arrival. The MC1 receptor recessive yellow (e/e) mouse colony bearing a frameshift mutation in the MC1 receptor gene (Robbins et al., 1993) were originally a gift from Dr Nancy Levin (Trega Bioscience, San Diego, CA, USA).

    In vivo models of vascular inflammation

    Intravital microscopy in the mesenteric microcirculation.  Intravital microscopy was performed as previously reported (Leoni et al., 2008). The mice were anaesthetized with a mixture of xylazine (7.5 mg·kg−1) and ketamine (150 mg·kg−1), and kept warm at 37°C with a heating pad. A polyethlylene catheter (PE-10 with an internal diameter of 0.28 mm) was placed into the internal jugular vein for administration of drugs. Mesenteric ischaemia was induced with a micro-aneurysm clip (Harvard Apparatus, Kent, UK), clamping the superior mesenteric artery for 35 min. The clip was then removed, and reperfusion was allowed for 90 min (for evaluation of white blood cell reactivity). Sham-operated animals underwent the same surgical procedure except clamping of the superior mesenteric artery.

    The mesenteric vascular bed was exteriorized; after positioning the microcirculation under the microscope, a 5 min equilibration period preceded the recording of quantitative measurements. Analyses of leucocyte–endothelium interactions were made in three to four randomly selected post-capillary venules (diameter between 20 and 40 µm; visible length of at least 100 µm) for each mouse.

    Quantification of microcirculatory parameters was performed off-line by frame-to-frame analysis of the videotaped images. White blood cell rolling velocity (VWBC) was determined from the time required for a leucocyte to roll a given distance along the length of the venule, and is reported in·µm·s−1. Rolling cell flux was determined by counting the number of leucocytes passing a reference point in the venule per minute, and expressed as cells per minute (cell·min−1). Leucocyte adhesion was measured by counting clearly visible cells on the vessel wall in a 100 µm stretch. An adherent cell was defined as a cell that had remained stationary for 30 s or longer. Leucocyte emigration from the microcirculation into the tissue was calculated by counting the number of cells in a 100 × 50 µm2 area on both sides of the 100 µm vessel segment. Red blood cell centreline velocity was measured in venules with an optical Doppler velocimeter (Microcirculation Research Institute, Texas A&M University, Dallas, TX, USA), and venular wall shear rate was determined based on the Newtonian definition: wall shear rate = 8000 [(red blood cell velocity/1.6)/venular diameter].

    Drug treatment.  The selective MC1 receptor agonist BMS-470539 (Herpin et al., 2003) was used both in WT and MC1 receptor recessive e/e mice. The compound (MW = 559.697) was given in a dose range and route of administration, shown to be inhibitory in three distinct models of inflammation (Kang et al., 2006). Therefore, doses of 18.47, 6.16 and 2.05 mg·kg−1 (corresponding to 33, 11 and 2.9 µmol·kg−1, respectively) were given i.v. (via jugular vein) in a fresh solution of PBS (100 µL per mouse) before inducing ischaemia.

    Intravital microscopy in the cremasteric microcirculation.  Intravital microscopy was used to observe PAF-induced leucocyte responses within the cremasteric microcirculation, adopting a protocol used to monitor events in the microcirculation in real time (Chatterjee et al., 2005). Briefly, the cremaster was dissected free of skin and fascia, opened and superfused with bicarbonate-buffered saline (in mM: 131.92, NaCl; 3.35, KCl; 1.16, MgSO4; 17.97, NaHCO3; and 1.98, CaCl2, pH 7.4, 37°C) at a rate of 2 mL·min−1. During the 30 min stabilization period, a post-capillary venule (diameter between 20 and 40 µm; length > 100 µm) was selected; then, 100 nM PAF (C16 form: C26H54NO7P; Sigma-Aldrich, Poole, UK) was added to the superfusion buffer. One minute recordings were made with a Hamamatsu C9300 digital camera (Intelligent Imaging Innovations, Göttingen, Germany) every 15 min up to 120 min. In some experiments, 60 min after PAF stimulation, BMS-470539 was administered i.v. at dose 33 µmol·kg−1. Leucocyte cell rolling, firm adhesion and transmigration in post-capillary venules with a wall shear rate ≥ 500·s–1 were quantified as previously described.

    Ex-vivo analyses

    elisa measurements.  At the end of the intravital microscopy procedure, mesentery tissues were harvested and stored at −80°C. Mesenteric tissue fragments of sham-operated animals and mice subjected to IR were homogenized in 1 mL of PBS containing anti-proteases (0.1 mM phenylmethyl sulphonyl fluoride, 0.1 mM benzethonium chloride, 10 mM EDTA and 20 IU aprotinin A) and 0.05% Tween 20. Quantitative elisa to monitor tissue content of mouse CCL2 (MCP-1) and CXCL1 (KC) was run according to the manufacturer's instructions (R&D System Europe, Oxford, UK).

    Tissue myeloperoxidase (MPO) activity.  Leucocyte MPO activity was assessed by measuring the H2O2-dependent oxidation of 3,3′,5,5′-tetramethylbenzidine (TMB) following a well-validated protocol (Cuzzocrea et al., 1997Gavins et al., 2005Leoni et al., 2008). Briefly, mesenteric tissue samples from sham- and I/R-treated mice were homogenized in PBS containing 0.5% hexadecyl trimethylammonium bromide (HTAB) detergent. The homogenate was centrifuged at 13 000×g for 5 min prior to adding 20 µL supernatant volumes to 160 µL of 2.8 mM of TMB, and 20 µL of 0.1 mM of H2O2 in 96-well plates. The plates were incubated for 5 min at room temperature, and optical density was read at 620 nm using GENios (TECAN, Reading, UK). Assays were performed in duplicate and normalized for protein content (BCA protein assay, Pierce, UK).

    Confocal analyses.  Whole-mount immunostaining of tissues was performed as previously described with few modifications (Voisin et al., 2010). Briefly, the mice were humanely killed, and tissues of interest (cremaster muscle and mesenteric tissue) were dissected and immediately fixed by placing into PBS plus 4% paraformaldehyde for 30 min at 4°C. Following fixation, whole-mounted tissues were blocked and permeabilized in PBS containing 10% normal goat serum, 10% FCS, 5% normal mouse serum and 0.5% Triton X-100 for 2 h at room temperature. The tissues were then immunostained with antibodies against the leucocyte marker CD45 (APC-conjugated anti-CD45, Cambridge Bioscience, Cambridge, UK), the α-smooth muscle actin (α-SMA) to detect the pericytes, and thus the vasculature (cy3-conjugated anti-α-SMA, Sigma-Aldrich) and the anti-MC1 receptor (Sigma) in PBS + 10% FCS at 4°C for 3 days. Following three washes in PBS, the tissues were incubated with a 488-conjugated anti-rabbit secondary antibody, for 3–4 h at 4°C in PBS + 10% FCS. The samples were then viewed using a Leica SP5 confocal (Leica Microsystems, Milton Keynes, UK) incorporating a ×20 water-dipping objective (NA: 1.0) at 20–24°C. Z-stack images acquired with sequential scanning of the different channels were used for 3D reconstruction of whole vessels (200 µm length; four to six vessels per tissue) with the image-processing software IMARIS (Bitplane, Zurich, Switzerland).

    Data analysis

    All data are reported as mean ± SEM of n observations, using at least five mice per group. Statistical evaluation was performed using anova (Prism GraphPad software) with Bonferroni test for post hoc analyses, taking a P value < 0.05 as significant.

    Materials

    Ketamine hydrochloride was from Hoffman-La Roche, Basel Switzerland, and xylazine was from Janssen Pharmaceutica, Beerse, Belgium. The components of the MPO assay [TMB, H202 (30%), HTAB and MPO from human leucocytes] were all from Sigma Aldrich. BMS-470539 was a generous gift from Dr Timothy Herpin (Bristol-Meyers Squibb).

    ResultsEffects of BMS-470539 on the mesenteric microcirculation

    Application of the 35 + 90 min IR procedure to the mouse mesentery elicited the expected high degree of vascular inflammation in post-capillary venules (Figure 1). A sharp reduction in rolling velocity, associated with ∼3-fold increase in cell adhesion and emigration, could be consistently measured in IR tissues compared to sham-operated tissues.

    Anti-inflammatory properties of BMS-470539 in the post-ischaemic mesenteric microcirculation. The mice were subjected to occlusion of the superior mesenteric artery (35 min) followed by 90 min reperfusion. A sham group (laparotomy but no occlusion of the artery) was also analysed. Vehicle or BMS-470539 was given i.v. (prior to inducing ischaemia). Cellular responses in the inflamed post-capillary venule were determined 90 min post-reperfusion, monitoring cell rolling as VWBC (A), cell adhesion (B) and cell emigration (C). Data are mean ± SEM of six mice per group. ***P < 0.001, PBS I/R versus respective sham group; #P < 0.05, ##P < 0.01, ###P < 0.001 versus respective vehicle I/R group.

    Treatment of mice with BMS-470539 did not modify the IR-induced reduction in VWBC of rolling leucocytes (Figure 1A). In contrast, a dose-dependent inhibition of the extent of IR-induced leucocyte adhesion (Figure 1B) and emigration (Figure 1C) was observed, with significant reduction at doses of 6.16 and 18.47 mg·kg−1. The top dose of BMS-470539 (18.47 mg·kg−1; 660 nmol per mouse) brought IR-induced values of cell adhesion and emigration back to those measured in sham-operated mice, whereas the intermediate dose of 6.16 mg·kg−1 (corresponding to 123 nmol per mouse) significantly and selectively affected cell adhesion (∼50% reduction; P < 0.05) (Figure 1B). The lowest dose tested of 2.05 mg·kg−1 was ineffective on all parameters under observation.

    These inhibitory properties displayed by BMS-470539 prompted us to determine other parameters of mesenteric tissue inflammation, focusing on the most effective dose of 18.47 mg·kg−1. Figure 2 reports these data displaying the reduction in tissue levels of CCL2 (Figure 2A) and CXCL1 (Figure 2B) upon BMS-470539 treatment. For both chemokines, tissue expression of these chemokines was reduced to levels similar to those measured in sham-operated tissue samples (Figure 2A,B). MPO activity was increased after the IR procedure, and although not statistically significant, treatment with BMS-470539 resulted in a trend towards normalization of MPO activity (Figure 2C).

    BMS-470539 reduces IR-induced tissue chemokine expression. WT mice were treated as in Figure 1, with BMS-470539 being given at the highest dose of 18.57 mg·kg−1. A sham group (laparotomy but no occlusion of the artery) was also analysed. At the end of the IR protocol, mesenteries were homogenized and protein extracts used for the elisa assays to determine tissue content of CCL2 (A), CXCL1 (B) and MPO activity (C). Data are mean ± SEM of six mice per group. *P < 0.05 versus respective sham group; #P < 0.05 versus respective vehicle I/R group.

    In recessive yellow e/e mice, the IR procedure produced a high degree of vascular inflammation, with marked attenuation in VWBC and increments in the extent of cell adhesion and emigration (Figure 3). When statistical comparisons were made for each variable, no significant difference between WT and recessive yellow e/e mice emerged for either cell rolling, adhesion or emigration (compare Figure 3 with Figure 1).

    Lack of effect of BMS-470539 in the recessive yellow e/e mouse mesentery. Recessive yellow e/e (bearing an inactive mutant MC1 receptor) mice were subjected to occlusion of the superior mesenteric artery for 35 min, followed by reperfusion. A sham group (laparotomy but no occlusion of the artery) was also analysed. Cellular responses in the inflamed post-capillary venule were determined 90 min post-reperfusion, monitoring cell rolling as VWBC (A), cell adhesion (B) and emigration (C). Data are mean ± SEM of six mice per group. *P < 0.05, **P < 0.01 versus respective sham group.

    Treatment of recessive yellow e/e mice with BMS-470539, given i.v. at the top dose of 18.47 mg·kg−1, did not affect any of the IR-induced vascular responses, with no effect on VWBC (Figure 3A), cell adhesion (Figure 3B) or cell emigration (Figure 3C).

    To analyse which cell could be the target of the MC receptor inhibition, immunostaining of whole-mount mesentery subjected to IR injury was performed and viewed by confocal microscopy. Specifically, following inflammation, tissues were collected, fixed and immunostained for the pan-leucocyte marker CD45 and α-SMA to detect the pericytes of the venular wall, together with an anti-MC1 receptor or isotype control antibody. The 3D reconstructed images of the inflamed tissues showed specific immuno-staining of transmigrated leucocytes for MC1 receptors as compared with isotype control treated tissues (Figure 4A). Of note, MC1 receptors were highly expressed inside, but also, at a lower extent on the surface of the transmigrated and adherent leucocytes (Figure 4B,C). The immunostaining of the tissues also demonstrated specific staining for MC1 receptors on the luminal side of the venular wall (Figure 4C).

    MC1 receptor immunoreactivity in the inflamed mesentery. Confocal analyses of mesenteric tissue samples of WT mice. Tissues were obtained 90 min post-reperfusion, as detailed in Figure 1. There is an association between MC1 receptor immunoreactivity and CD45-positive leucocytes. (A) Staining was performed with an irrelevant control Ab (top panel) or anti-MC1 receptor Ab (bottom panel) in inflamed post-capillary venules. Images in the right panels are greater magnification of the region of interest showing expression of MC1 receptors by leucocytes. (B). Longitudinal cross section (2 µm) of a vessel showing luminal leucocytes expressing MC1 receptors. (C) Latitudinal cross section (1 µm) showing some degree of MC1 receptor staining within the vessel wall (below the pericyte layer; dotted arrow). In some images, an opacity filter was used reducing the colour intensity in one channel (either for CD45 or α-SMA immunostaining) to highlight expression of MC1 receptors within the leucocyte (open arrowhead), on the surface of the leucocyte (closed arrows) and on the luminal side of the vessel wall (dotted arrow) respectively. Data are representative of images obtained from tissues acquired from three mice. isoCTL, isotype control; αSMA, alpha-smooth muscle actin; MC1, anti-MC1 Ab; CD45, anti-CD45 Ab (se Methods for more details). Bar = 10 µm.

    The pharmacological effects produced by administration of compound BMS-470539 on the inflamed vasculature were not secondary to changes in the haemodynamic parameters of the vessels under investigation. This is shown in Table 1, where values of cell flux and wall shear rate were modified by 35 + 90 min IR, but not further modified by application of BMS-470539.

    Table 1. Haemodynamic parameters in the mesenteric microcirculation of WT and inactive MC1 e/e mice
    Mouse genotype (procedure)Diameter (µm)Cell flux (cells·min1)Wall shear rate (s −1 )
    WT (sham)
    25.3 ± 1.7
    9.5 ± 1.5
    400.5 ± 10.5
    WT (35 + 90 IR)
    27.2 ± 1.8
    19.4 ± 0.9
    280 ± 12.5
    WT (35 + 90 IR) + BMS-470539
    25.0 ± 1.6
    20.4 ± 0.4
    305 ± 10.5
    Mutant MC1 e/e (sham)
    26.7 ± 1.2
    8 ± 0.6
    386.2 ± 32.0
    Mutant MC1 e/e (35 + 90 IR)
    25.6 ± 3.8
    20.5 ± 5.1
    280.1 ± 18.2
    Mutant MC1 e/e (35 + 90 IR) + BMS-470539
    28.6 ± 2.8
    18.5 ± 3.1
    300 ± 10.4
    • The diameter of the mesenteric vessels analysed in 13 are summarized here, along with values for wall shear rate and cell flux. The mice were exposed to IR (35 min of ischaemia and 90 min of reperfusion). As indicated, BMS-470539 was given at a dose of 18.47 mg·kg−1 i.v. immediately before ischaemia. Data are mean ± SEM from six animals per group. For cell flux and wall shear rate, all IR values are significantly different from respective sham (P < 0.01).
    Effects of BMS-470539 on the cremasteric microcirculation

    To further elucidate the pharmacological potential of BMS-470539, as well as to determine the pathophysiological relevance of endogenous MC1 receptors, the next set of experiments was conducted within a different vascular bed, the mouse cremaster muscle microcirculation. The cremaster is a skeletal muscle widely used to study mechanisms of white blood cell interactions with the post-capillary venules (Dangerfield et al., 2002Young et al., 2004). It offers a higher degree of stability and so it is suitable to be inflamed over time, allowing the temporal monitoring of the cascade of events within the vasculature that characterizes the early phase of inflammation.

    Firstly, we determined expression of MC1 receptors in vascular cells also when these experimental conditions were applied. Supporting Information Figure S1 shows the MC1 receptor immunoreactivity detected in the inflamed vessels, with a marked signal deriving from intravascular (adherent), as well as extravasated leucocytes (Supporting Information Figure S1B). Co-staining with CD45, a pan-leucocyte marker, validated this observation, so that a high (>95%) degree of co-localization between CD45 and MC1 positivity was evident (Supporting Information Figure S1D). Controls for the immunoreaction and subsequent confocal analyses are shown in Supporting Information Figure S1A,C.

    PAF superfusion of the cremasteric microcirculation produced a time-dependent inflammatory response with reduction in VWBC (not shown), and a time-dependent increase in cell adhesion (Figure 5A) and emigration (Figure 5B). At 60 min post-PAF superfusion, the extent of cell adhesion and emigration was approximately 50–70% of the response measured at the 2 h time-point (Figure 5). At this juncture, the mice were split into two groups, receiving either an intravenous bolus of vehicle or of BMS-470539. Treatment with this MC1 receptor agonist, using this therapeutic protocol, did not affect cell adhesion (Figure 5A), but produced a marked blockade of cell emigration (Figure 5B). Table 2 reports haemodynamic parameters in the cremaster.

    BMS-470539 inhibits cell emigration in the cremasteric microcirculation activated by PAF superfusion. WT mouse cremasteric microcirculation was superfused with buffer containing PAF (100 nM), and 1 min recordings were made every 15 min up to 120 min. After 60 min, buffer (100 µL) or BMS-470539 (18.57 mg·kg−1) was given i.v. and cellular responses in the inflamed post-capillary venule determined after further 60 min. Cellular reactivity was monitored as cell adhesion (A) and emigration (B). Data are mean ± SEM of six mice per group. *P < 0.05, **P < 0.01 versus respective buffer value.

    Table 2. Haemodynamic parameters in the mouse cremasteric microcirculation
    Mouse (treatment)Cell flux (cells·min1)Wall shear rate (s −1 )
    WT (PAF 30 min)
    12.80 ± 2.9
    426.66 ± 59.2
    WT (PAF 60 min)
    19.20 ± 2.4
    446.66 ± 57.6
    WT (PAF + buffer 90 min)
    23.00 ± 5.0
    465.55 ± 63.2
    WT (PAF + buffer 120 min)
    20.80 ± 4.5
    553.33 ± 84.7
    WT (PAF + BMS-470539 90 min)
    17.60 ± 4.9
    536.66 ± 84.1
    WT (PAF + BMS-470539 120 min)
    18.00 ± 4.8
    549.99 ± 56.3
    • Values for wall shear rate and cell flux of experiments shown in Figure 5 are summarized here. Diameters of post-capillary venules (20–30 µm) are not shown, as they did not change over time. The mouse cremaster was superfused with 100 nM PAF (0–60 min), then either buffer (100 µL) or BMS-470539 (18.57 mg·kg−1) was given i.v., and parameters monitored for another 60 min (120 min post-PAF superfusion). Data are mean ± SEM of six WT animals per group.

    In line with the results obtained with the mesentery protocol, there was no difference between WT and the recessive yellow e/e mouse with respect to the cellular responses promoted by PAF (Supporting Information Figure S2). Importantly, BMS-470539 was ineffective in altering the degree of cell emigration when administered to recessive yellow e/e mice (Supporting Information Figure S3) supporting, again, the active involvement of MC1 receptors in transducing the in vivo anti-inflammatory properties of this compound.

    Discussion

    In this study, we have determined the inhibitory properties of a selective MC1 receptor agonist, BMS-470539, on the early phases of the inflammatory response, namely the interaction between circulating white blood cells and post-capillary venules. The data produced indicate that activation of mouse MC1 receptors by BMS-470539 exerts potent inhibition on the processes of cell adhesion and, in particular, emigration. Of interest, a significant expression of MC1 receptor expression in recruited leucocytes was noted; however, this receptor did not seem to play a pathophysiological role per se in these experimental conditions.

    The interest in MCs has grown over the years, so that three decades of research into the biology of these natural – and synthetic – peptides may become fruitful in the near future (Gonzalez-Rey et al., 2007). A wealth of evidence indicates that α-MSH, a pan-agonist to all MC receptors, except MC2, produces potent tissue-protective and anti-inflammatory effects in rodents, as well as in systems with human cells and samples (Catania et al., 2004Getting, 2006Brzoska et al., 2008). In line with the potential exploitation of other endogenous anti-inflammatory pathways and targets for the development of novel anti-inflammatory drugs (Gilroy et al., 2004Gonzalez-Rey et al., 2007Serhan et al., 2007), it is possible that activation of MC receptors would have a lower burden of side effects as it would be mimicking the mechanisms employed endogenously to terminate inflammatory events.

    In the area of MCs and MC receptors in inflammation, attention has been focused on two members of this subfamily of G-protein-coupled receptors, namely MC1 and MC3 receptors. Initial pharmacological studies have implied a strong involvement of MC1 receptors in the anti-inflammatory properties of α-MSH, ACTH and other MCs (Lipton et al., 1999Catania et al., 2000). Subsequently, MC3 receptors were shown to be expressed on resident macrophages, and be activated to elicit inhibition in several settings of acute inflammation (Getting et al., 1999; 2002). Therefore, from a drug development perspective, there is a dual opportunity of developing either MC1 or MC3 receptor-selective agonists. Very few studies have assessed the pathophysiological roles of either MC1 or MC3 receptors, for instance, studying the phenotype of transgenic mice.

    The recessive yellow e/e mouse, which bears inactive MC1 receptors (Robbins et al., 1993), did not display differences in the acute inflammatory reaction to zymosan or other inflammogens, both for leucocyte recruitment and cytokine production (Getting et al., 2003; 2006). On the other hand, using two distinct models of colitis, disease exacerbation was shown in this mouse colony, favouring the possibility that MC1 receptors might be activated, or its endogenous agonists produced, in more chronic inflammatory conditions (Maaser et al., 2006). This conclusion is supported by the data presented here, where the recessive yellow e/e mouse was able to mount a leucocytic response in the vasculature, very similar to that noted in WT controls. These findings obtained from studies in different microvascular beds and stimulated by two different stimuli, in which cell adhesion and emigration were promoted by an IR procedure or PAF superfusion. Lack of involvement of MC1 receptors in these events may be due to the lack of generation of its endogenous selective ligands. Of importance, the receptor was highly expressed in inflamed tissues most notably by adherent and emigrated (or resident) leucocytes.

    The scenario, and ensuing conclusions, are quite different for MC3 receptors. Vascular inflammation is exacerbated in MC3 receptor null mice, as recently reported (Leoni et al., 2008). Application of the IR procedure, identical to that used in the present study, leads to marked cell adhesion and emigration with values >50% augmented with respect to WT mice. This increased vascular reactivity in MC3 receptor null mice is associated with, or is consequent to, an augmented tissue generation of pro-inflammatory chemokines, probably produced by tissue resident mast cells and macrophages (Ajuebor et al., 1999Tailor et al., 1999). In line with the above hypothesis, it is possible that under these inflammatory conditions, endogenous selective MC3 receptor ligands are produced and active. Peripheral generation of the pro-opiomelanocortin gene product is now an accepted finding (Gonzalez-Rey et al., 2007Brzoska et al., 2008); however, the possibility that this polypeptide might be processed in a tissue-specific manner is yet to be tested and proven. Another theoretical explanation for the engagement of MC3, and not MC1 receptors, in the early (from 0 to 4 h) tissue inflammatory response could lie in the fact that post-translational modifications may occur, changing the affinity or the susceptibility to activation of one or the other MC receptor. Future studies will address these possibilities, which clearly are not mutually exclusive.

    Our observation that MC1 receptor expression is detectable on inflammatory cells is of importance, as such a phenomenon has often been indicated using molecular approaches, but rarely in whole tissues, and in such a clear-cut manner. Our confocal analyses allowed prompt detection of MC1 receptor on CD45+ cells, likely to be associated with cells adherent to the vascular wall, as well as with cells that had migrated into the tissue. In our previous study, we employed immunohistochemistry to detect MC1 and MC3 receptor immunoreactivity in extravasated neutrophils and macrophages within the post-IR mesenteric tissue (Leoni et al., 2008). Here, we demonstrated that adherent leucocytes are MC1 receptor positive. In line with previous reports (Scholzen et al., 2003), a weak expression of MC1 receptor on vascular endothelium could be observed; this is congruent with the ability of MC peptides to down-regulate endothelial cell expression of cell adhesion molecules (Scholzen et al., 2003). Here, we have not evaluated the effects of BMS-470539 on endothelial cells, and therefore cannot exclude a contributing role on modulation of endothelial cell adhesion molecules. It is possible that in addition to the effects observed on circulating leucocytes, an effect on the endothelium might occur in our experimental settings, which would aid in eliciting a reduction in the extent of leucocyte emigration.

    Use of the recessive yellow e/e mouse indicated that activation of MC1 receptors mediates, on its own, the anti-inflammatory effects of BMS-470539. In the mesenteric post-IR tissue, this selective MC1 receptor agonist prevented not only cell emigration, but also tissue generation of CCL2 and CXL1. These two chemokines are major effectors in recruiting neutrophils and monocytes in the early phases of the inflammatory response, being promptly produced by tissue mast cells and macrophages (Ajuebor et al., 1999). It is likely that their role is to promote adhesion of rolling leucocytes, a pre-requisite to subsequent emigration. With the IR protocol, we could not discriminate between a direct effect of BMS-470539 on cell adhesion and emigration, or whether the latter was secondary to a lowered tissue generation of pro-inflammatory chemokines. To address this further, we had to apply a protocol that could allow monitoring of the development of leucocyte reactivity in the vasculature. The data generated here highlight that inhibition of chemokine expression leads to the reduction in leucocyte recruitment observed within these models. Previous studies have shown that MC peptides can down-regulate the expression of pro-inflammatory cytokines, including interleukin (IL)-1β, IL-6 and TNF-α, as well as chemokines including IL-8 (Luger et al., 1997Brzoska et al., 2008). Moreover, it is also established that following this initial inhibition of pro-inflammatory chemokine and cytokine release, MC receptor agonists activate a delayed induction of anti-inflammatory pathways provoking an increase in IL-10 and haem oxygenase 1 expression (Lam et al., 2005; 2006).

    Superfusion of PAF onto the microvasculature is an established protocol (Kubes et al., 1990Zimmerman et al., 1994Chatterjee et al., 2005) suitable to study alterations in the microcirculation of stable preparations of intravital microscopy. The cremaster preparation satisfies this requisite (Gavins and Chatterjee, 2004). PAF application is known to produce direct activation of the intravascular leucocytes and the endothelium, provoking selectin-mediated rolling, followed by cell adhesion and emigration, along the established model for leucocyte recruitment (Ley et al., 2007). Besides testing the effects of BMS-470539 against a different stimulus and in another vasculature, we chose to apply the compound with a therapeutic protocol. Given at the anti-inflammatory dose of 18.47 mg·kg−1 i.v., BMS-470539 provoked rapid inhibition of the process of cell emigration, with no particular efficacy on the mounting of the cell adhesion response. This effect was remarkable because no further increase of the number of emigrated leucocytes was evident as early as 10 min after compound administration.

    Altogether, these data indicate that MC1 receptor activation in an inflamed microvasculature, as specifically achieved here with BMS-470539, can produce at least two distinct outcomes: (i) inhibition of cell adhesion, possibly as a consequence of a marked attenuation of the generation of pro-inflammatory chemotactic factors; and (ii) inhibition of cell emigration along a mechanism that can be distinct from the actions on cell adhesion, most likely a consequence of MC1 receptor activation on the adherent leucocytes (as we have shown for the first time). In both models used, and in contrast to the above, activation of MC1 receptors did not influence the process of leucocyte rolling.

    In conclusion, this study corroborates the validity of developing selective MC1 receptor ligands, peptides or new chemical entities like BMS-470539, to counteract aberrant inflammatory responses, including those characteristic of an IR pathological scenario, such as those observed after thrombus-provoked stroke or organ transplantation.


    Uhohinc

    unread,
    Oct 12, 2021, 8:27:59 AM10/12/21
    to Clinuvel Afamelanotide SCENESSE senescence CUV ASX.CUV CLVLY ur9

    Melanocortin-1 Receptor Positively Regulates Human Artery Endothelial Cell Migration

     

    Federica Saporitia    Luca Piacentinia    Valentina Alfieria,b    Elisa Bonoa    

    Fabrizio Ferraria    Mattia Chiesaa    Gualtiero I. Colomboa

     

    aUnit of Immunology and Functional Genomics, Centro Cardiologico Monzino IRCCS, Milan, Italy, bDepartment of Pharmacological and Biomolecular Sciences, Università degli Studi di Milano, Milan, Italy

     

     

     

     

    Key Words

    Melanocortin receptors • α-MSH • Human artery endothelial cells • Cell migration

     

    Abstract

    Background/Aims: Melanocortin receptors (MCRs) belong to a hormonal signalling pathway with multiple homeostatic and protective actions. Microvascular and umbilical vein endothelial cells (ECs) express components of the melanocortin system, including the type 1 receptor (MC1R), playing a role in modulating inflammation and vascular tone. Since ECs exhibit a remarkable heterogeneity, we investigated whether human artery ECs express any functional MCR and whether its activation affects cell migration. Methods: We used reverse transcription real-time PCR to examine the expression of melanocortin system components in primary human artery ECs. We assessed MC1R protein expression and activity by western blot, immunohistochemistry, cAMP production, and intracellular Ca2+ mobilization assays. We performed gap closure and scratch tests to examine cell migration after stimulation with alpha-melanocyte-stimulating hormone (α-MSH), the receptor highest-affinity natural ligand. We assessed differential time-dependent transcriptional changes in migrating cells by microarray analysis. Results: We showed that human aortic ECs (HAoECs) express a functionally active MC1R. Unlike microvascular ECs, arterial cells did not express the α-MSH precursor proopiomelanocortin, nor produced the hormone. MC1R engagement with a single pulse of α-MSH accelerated HAoEC migration both in the directional migration assay and in the scratch wound healing test. This was associated with an enhancement in Ca2+ signalling and inhibition of cAMP elevation. Time-course genome-wide expression analysis in HAoECs undergoing directional migration allowed identifying dynamic co-regulation of genes involved in extracellular matrix-receptor interaction, vesicle-mediated trafficking, and metal sensing – which have all well-established influences on EC motility –, without affecting the balance between pro- and anticoagulant genes. Conclusion: Our work broadens the knowledge on peripherally expressed MC1R. These results indicate that the receptor is constitutively expressed by arterial ECs and provide evidence of a novel homeostatic function for MC1R, whose activation may participate in preventing/healing endothelial dysfunction or denudation in macrovascular arteries.

     

     

    Introduction

     

    The melanocortin receptors (MCRs) are a family of rhodopsin-like G protein-coupled receptors (GPCRs) that are activated by different melanocortin peptide ligands, derived from the tissue-specific cleavage of a common preprohormone precursor, the proopiomelanocortin (POMC) [1]. These molecules, together with a number of endogenous antagonists and accessory proteins, constitutes the so-called melanocortin system [2]. To date, five MCRs have been identified, with different tissue distribution and a diverse affinity for their natural ligands. MCRs mainly signal through intracellular cAMP increase or, alternatively, transient intracellular elevation of cytosolic free Ca2+ [3]. The melanocortin system has been studied for its ability to regulate several physiological processes, including pigmentation, adrenocortical steroidogenesis, energy homeostasis, and exocrine gland secretion. In particular, the prototypical melanocortin peptide, the alpha-melanocyte stimulating hormone (α-MSH), possesses a wide spectrum of anti-inflammatory [4], immunoregulatory [5], and cytoprotective activities, including protection and repair after organ damage (i.e. cerebral and myocardial ischemia/reperfusion injury, nephrotoxicity, and acute lung injury) [6]. As a consequence, targeting melanocortin system is considered a promising strategy for new therapeutic approaches in various inflammatory conditions [7].

    The melanocortin system has been involved in the modulation of oxidative stress [8] and vascular endothelial damage [9]. A local melanocortin system has been described in endothelial cells (ECs) of the cutaneous microcirculation [10]. Moreover, the MC1R (and no other MCR) has been detected both on murine brain microvascular ECs [11], and on human dermal microvascular ECs (HDMECs) [10, 12] and umbilical vein ECs (HUVECs) [13], with possible modulatory effects on endothelium homeostasis. In particular, α-MSH has been shown to modulate blood vessel tone by enhancing nitric oxide-cyclic guanosine monophosphate dependent relaxation responses through endothelial MC1R [13]. Nonetheless, a formal demonstration that human artery ECs of the macrovasculature express functional MCR(s) is currently missing. This is substantial because ECs exhibit a remarkable heterogeneity and show specific structure and functions associated with the blood vessel they belong to, i.e. large and medium arteries, veins, or capillaries [14, 15]. At the molecular level, ECs display phenotype markers that are cell type-restricted, and exhaustive genome-wide expression studies have shown unique gene expression patterns in ECs derived from different tissues [16, 17]. This heterogeneity accounts for many human vascular diseases restricted to specific types of vessels. Nevertheless, our knowledge of EC biology has been mostly inferred by studies on HUVECs, which are cells that originate from a vessel type that is rarely affected by vascular disorders [18]. HDMECs and HUVECs do not recapitulate the physiology of all the vascular ECs and, most importantly, their ability to activate specific cell functions in response to MCR ligands may not overlap those of artery ECs.

    A recent report showed that treatment with MCR agonists was able to prevent the development of vascular dysfunction and attenuate plaque inflammation in a mouse model of pre-established atherosclerosis [19]. Artery endothelial dysfunction and/or injury are prominently linked to the pathogenesis of atherosclerosis, thrombosis, or surgery procedure complications [20]. An essential biological process involved in endothelial healing upon vascular injury is EC migration. When a blood vessel is damaged, the restoration of endothelium and vessel integrity is achieved through migration of healthy ECs to the site of the lesion and subsequent proliferation. Hence, EC migration has a key role, besides angiogenesis, in vascular repair and tissue regeneration [21]. In this work, we investigated whether human artery ECs express any functional MCR and whether MCRs activation through α-MSH can affect artery EC migration.

     

     

    Materials and Methods

     

    Primary human artery endothelial cells

    We purchased primary human artery ECs from the European Collection of Authenticated Cell Cultures (ECACC, Salisbury, UK), Lonza (Allendale, NJ), and Promocell (Heidelberg, Germany). We obtained three adult human aortic ECs (HAoECs) and recoded them as c1c2 and c3, namely: (c1) HAoEC (304-05a) from ECACC (catalogue no. 06090729), (c2) HAoEC from Lonza (catalogue no. CC-2535), and (c3) HAoEC from Promocell (catalogue no. C-12271). We also obtained three adult human coronary artery ECs (HCAECs) and recoded them as c4c5 and c6, namely: (c4) HCAEC (300-05a) from ECACC (catalogue no. 06090727), (c5) HCAEC from Lonza (catalogue no. CC-2585), and (c6) HCAEC from Promocell (catalogue no. C-12221). Primary ECs were tested for cell-type specific markers by the manufactures. Cells were positive for Factor VIII-related antigen or von Willebrand factor and CD31 expression, positive for acetylated low-density lipoprotein uptake, and negative for α-actin expression. Cells were seeded in 75 mL plastic flasks (Corning, Tewksbury, MA) at a density of 2.5 × 103 cells/cm2 and cultured following manufactures’ instructions. We performed all experiments at cell passages 4–8. We tested cell cultures for mycoplasma contamination before any experiments, using the PCR-based Mycoplasma detection kit Venor GeM OneStep (Minerva Biolabs, Berlin, Germany).

     

    Chemicals

    The α-MSH peptide was obtained from Phoenix Pharmaceuticals (Burlingame, CA); the peptide 153N-6 (H-[Met5,Pro6,D-Phe7,D-Trp9,Phe10]-MSH(5-13)) from Bachem (Bubendorf, Switzerland); isobutyl methylxanthine (IBMX), forskolin, PD0332991 isethionate, and thapsigargin from Sigma-Aldrich (St. Louis, MO); 1, 2-Bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid tetrakis(acetoxymethyl ester) (BAPTA-AM) and 1-[6-[[(17β)-3-Methoxyestra-1, 3,5(10)-trien-17-yl]amino]hexyl]-1H-pyrrole-2, 5-dione (U-73122) from Tocris Bioscience (Bristol, UK). The peptides α-MSH and 153N-6 were dissolved in water. IBMX, forskolin, PD0332991, thapsigargin, BAPTA-AM, and U-73122 were dissolved in dimethyl sulfoxide (DMSO).

     

    Reverse transcription quantitative PCR (RT-qPCR) for melanocortin system components

    Total RNA was extracted from ECs grown to confluence, adding TRIzol Reagent (Invitrogen, Carlsbad, CA) directly to the culture dishes. Given that some MCRs are single-exon intronless genes (i.e., MC3R and MC4R), while others are multi-exon genes with several splice variants (e.g., MC1R [22]), we treated RNA samples with RNase-free DNase-I to eliminate genomic contamination and prevent amplification of genomic DNA. This allowed us to use a single-exon probe qPCR design to detect the canonical primary transcripts of the MCR genes. RNA quantification and purity assessment were performed by micro-volume spectrophotometry on an Infinite M200 PRO multimode microplate reader (Tecan, Männedorf, Switzerland). RNA quality and integrity were checked by microfluidics electrophoresis with the RNA 6000 Nano Assay Kit on a 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA). Complementary DNA (cDNA) for single target gene expression analysis was synthesized from 2 μg of total RNA for each sample using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA). TaqMan Array Human Endogenous Controls 96-Well Plate PCR assay (Applied Biosystems) was preliminarily employed to identify the most appropriate endogenous control gene. Analysis of gene expression stability and selection of the best reference gene was performed using the NormFinder v0.953 Excel Add-In [23]. We used single tube TaqMan Gene Expression Assays (Applied Biosystems) for evaluating mRNA expression of the melanocortin receptors (MCRs), proopiomelanocortin (POMC), prohormone convertases, and the endogenous constitutive gene (see details Supplemental Methods – for all supplemental material see www.cellphysiolbiochem.com). Assays IDs for the melanocortin system components and the reference gene were Hs00267168_s1 (MC1R), Hs00265039_s1 (MC2R), Hs00252036_s1 (MC3R), Hs00271877_s1 (MC4R), Hs00271882_s1 (MC5R), Hs01596743_m1 (POMC), Hs01026107_m1 (proprotein convertase subtilisin/kexin type 1, PCSK1), Hs01037347_m1 (PCSK2), Hs00159829_m1 (furin, PCSK3), Hs00159844_m1 (PCSK6), Hs00161638_m1 (secretogranin V, SCG5), and Hs99999902_m1 (ribosomal protein large P0, RPLP0). We run three replicates of each assay for each sample (20 ng/well of cDNA) on a ViiA 7 Real-time PCR System (Applied Biosystems). Experimental threshold and baseline were imputed by algorithms implemented in the ViiA 7 software v1.2 (Applied Biosystems), and data were analysed by the Pfaffl’s corrected ΔΔCt method [24].

     

    α-MSH assay

    Quantification of α-MSH release by primary HAoECs and HCAECs was performed using an ultrasensitive fluorescent enzyme immunoassay (EIA) kit (Phoenix Pharmaceuticals), following manufacture’s instruction. The EIA sensitivity, i.e. the minimum detectable concentration, was 8.9 pg/mL. Cross-reactivity with the adrenocorticotropic hormone (ACTH) was zero: α-MSH shares the sequence of ACTH (1–13), but α-MSH is acetylated at the N-terminus and amidated at the C-terminus [7]. Cells were seeded to confluence in 96-well culture plates, in complete endothelial growth medium (EGM2; Lonza), and supernatants were collected and stored at -80 °C until measurement.

     

    Genomic DNA sequencing for MC1R

    We used a 3500 Genetic Analyzer (Applied Biosystems) to perform DNA sequencing of the MC1R gene open reading frame (ORF) for all HCAECs and HAoECs. Genomic DNA amplicons of the MC1R ORF were produced by PCR with the following primers: MC1R_Forward(1) (-25) 5’-TCCTTCCTGCTTCCTGGACA-3’, MC1R_Reverse(1) (+980) 5’-CACACTTAAAGCCGCGTGCAC-3’The amplified fragments were purified using the Agencourt AMPure XP kit (Beckman Coulter). Sequencing reactions were carried out using the BigDye Terminator v3.1 Kit (Applied Biosystems) in both strand directions to allow the production of four overlapping fragments. Sequencing primers used were the MC1R_Forward(1), the MC1R_Reverse(1) and: the inner MC1R_Forward(2) (+449) 5’-TGCGCTACCACAGCATCGTG-3’, and the inner MC1R_Reverse(2) (+510) 5’-CACCCAGATGGCCGCAAC-3’. Unincorporated fluorescent dideoxynucleotides and salts were removed with the BigDye XTerminator Purification Kit (Applied Biosystems). The purified sequencing reaction products were electrokinetically injected into a 50 cm Capillary Array filled with the POP-7 Polymer (Applied Biosystems). Electropherograms were analysed by the Variant Reporter software v1.1 (Applied Biosystems).

     

    Antibodies

    Primary antibodies used were: anti-MC1R rabbit polyclonal antibody, supplied with the specific control peptide antigen (Alomone Labs, Jerusalem, Israel); anti-ATPase Na+/K+ transporting subunit alpha 1 (ATP1A1) rabbit polyclonal antibody (Cell Signaling Technology, Danvers, MA); anti-β-actin mouse monoclonal IgG1 (Novus Biologicals, Littleton, CO); and anti-Ki67 rabbit polyclonal IgG (Abcam, Cambridge, UK). Secondary antibodies were: donkey anti-rabbit or anti-mouse IgG conjugated, respectively, to IRDye 800CW and IRDye 680RD infrared dyes (LI-COR Biosciences, Lincoln, NE), for immunoblotting; donkey anti-rabbit IgG conjugated to the DyLight 488 fluorochrome (Jackson ImmunoResearch Laboratories, West Grove, PA), for immunocytochemistry.

     

    Western blotting

    HAoECs and HCAECs (1.2 × 106) were lysed in Milliplex MAP Lysis buffer (Millipore, Billerica, MA) with a complete protease inhibitor cocktail (Roche, Mannheim, Germany) to obtain whole extracts, or with the FractionPREP Cell Fractionation Kit (BioVision, Milpitas, CA) to obtain plasma membrane extracts. Proteins were quantified using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific). Thirty μg of each protein extract were mixed with the Novex Tris-Glycine SDS sample buffer 2× and the Novex sample reducing agent 10× (Invitrogen). Samples were loaded onto 4-12% gradient Novex WedgeWell precast Tris-Glycine polyacrylamide gels (Invitrogen) and run in Novex Tris-Glycine SDS running buffer for 40 min at 200 V. Samples were blotted on nitrocellulose membranes using an iBlot system (Invitrogen). Membranes were blocked in the Odyssey blocking buffer (LI-COR Biosciences) for 1 h. Pre-absorption was performed by incubating the anti-MC1R antibody for 30 min at room temperature with the inhibitory MC1R peptide (two-fold excess of the peptide by weight). Primary or the pre-absorbed antibodies were diluted (1:1000) in the Odyssey blocking buffer (LI-COR Biosciences), and membranes were incubated overnight at 4°C. Anti-β-actin and anti-ATP1A1 antibodies (1:5000) were used as reference controls for whole or membrane extracts, respectively. Membranes were incubated with IRDye secondary antibodies (1:10000) for 20 min at room temperature. Immunoreactive bands were detected by an Odyssey Infrared Imaging System (LI-COR Biosciences).

     

    Anti-MC1R antibody specificity testing

    The anti-MC1R antibody was raised against an epitope corresponding to amino acid residues 217-232 in the 3rd intracellular loop of human MC1R. To test the specific binding of the anti-MC1R antibody to the MC1R protein, we generated a positive control for subsequent analyses by transiently transfecting human HEK293 cells with the MC1R full-length cDNA by a C-terminal fusion of tGFP tag in a pCMV6 vector (Origene, Rockville, MD). Cells were grown in RPMI 1640 with 10% foetal bovine serum (FBS), penicillin 100 U/mL and streptomycin 10 μg/mL (Sigma-Aldrich) to approximately 50% confluence, and then transfected by incubation with the TransIT-LT1 Transfection Reagent (Mirus Bio, Madison, WI) for 48 h. Specificity of the MC1R antibody was demonstrated by pre-absorption with the specific blocking peptide supplied with the primary antibody, which abolished MC1R signal in Western immunoblot (see Supplementary Fig. S1).

     

    Intracellular cAMP assay

    Quantification of intracellular cAMP levels was performed using the cAMP Biotrak enzyme immunoassay (GE Healthcare Life Sciences, Piscataway, NJ). HAoECs were seeded to confluence in 96-well plates or 24-well plates with IBIDI culture inserts (Martinsried, Germany). Cells, prior to 5-min stimulation with α-MSH 10-8 M, were pre-treated for 30 min with IBMX 0.1 mM, to inhibit cAMP degradation by phosphodiesterases (PDEs). Cells treated with IBMX alone were used as negative controls, whereas cells stimulated with the activator of eukaryotic adenylyl cyclase forskolin (10 μM) served as positive controls. As control for receptor-binding specificity, cells were pre-treated with the MC1R-selective competitive α-MSH antagonist 153N-6 (10-5 M) [25, 26] for 15 min in separate experiments. The abovementioned concentration of α-MSH was selected for all functional assays based on previous publications on HDMECs [10, 12] and on pilot experiments with 100-fold scalar concentrations of peptide (10-6 M, 10-8 M, and 10-10 M) that showed its effectiveness (see Results below).

     

    Immunohistochemistry for MC1R

    Formaldehyde-fixed paraffin sections of a normal human aorta were incubated with the primary anti-MC1R antibody overnight at 4°C. As control of the staining specificity, the anti-MC1R antibody was pre-incubated 30 min with its specific blocking peptide. Slides were incubated with a biotinylated goat anti-rabbit IgG secondary antibody (1:200; Vector Laboratories, Burlingame, CA) and signals were revealed using the VECTASTAIN Elite ABC-HRP kit combined with the ImmPACT DAB EqV peroxidase (HRP) substrate (Vector Laboratories). Images were recorded using an AxioSkop microscope equipped with an AxioCam camera (Carl Zeiss).

     

    Directional cell migration assay

    The live-cell staining, lipophilic, near-infrared fluorescent membrane probe 1, 1'-dioctadecyl-3, 3,3',3'-tetramethylindotricarbocyanine iodide (DiR) was used for imaging of gap closure in a cell migration assay [27]. HAoECs were treated with a solution of 2.5 μM DiR (Biotium, Hayward, CA) in complete EGM2 medium for 20 min at 37°C, washed and seeded onto 24-well plates with culture inserts (IBIDI, Martinsried, Germany). Inserts were removed to create a cell-free gap of approximately 500 µm, and HAoECs were allowed to migrate for 12h at 37°C and 5% CO2 in the presence of 10-8 M α-MSH or in medium alone. As control for receptor-binding specificity, cells were pre-treated with the MC1R-selective antagonist 153N-6 (10-5 M) for 15 min. In addition, to dissect the calcium-dependency of the α-MSH-induced cell migration, experiments were repeated pre-treating cells for 15 min with either the intracellular Ca2+ chelator BAPTA-AM (10-5 M) or the phospholipase C (PLC) inhibitor U-73122 (5 × 10-5 M). Plates were scanned with the Odyssey imaging system (LI-COR Biosciences) at 0, 3, 9, and 12 h, at 84 μm resolution and high quality setting (emission, 800 nm). Scans were converted to 8-bit images and analysed with the NIH ImageJ software v1.38x. For time-course gene-expression analysis, 2 × 104 HAoECs were plated in high 35-mm dishes with culture inserts (IBIDI) and treated with α-MSH 10-8 M.

     

    Scratch wound healing assay

    HAoEC migration was also assessed using a scratch migration assay. Briefly, HAoECs were seeded onto 6-well tissue culture plates at a density of 2.5 × 103 cells/cm2 and grown to confluence. A gap of approximately 1 mm was created in the adherent layer of confluent ECs by using a sterile 0.1-mL pipette tip. After treatment with medium alone or α-MSH 10-8 M, with or without 15-min pre-treatment with the MC1R antagonist 153N-6 (10-5 M), the closure extent of the cell-free gap was detected by confocal microscope imaging (Zeiss, Jena, Germany) at 6 and 24h and measured using the NIH ImageJ software v1.38x.

     

    Immunostaining for Ki67

    HAoECs were plated in 8-chamber μ-slides (IBIDI) at a density of 1.0 × 103 cells/cm2, treated with medium alone, α-MSH 10-8 M, or α-MSH plus 153N-6, and allowed to migrate for 24 h. Cells were then fixed for 20 min in 4% paraformaldehyde solution in PBS and permeabilised with 0.1% Triton X-100 (Sigma-Aldrich). Non-specific antibody binding was prevented by using a blocking solution of 10% normal donkey serum (Jackson ImmunoResearch Laboratories) for 1h. Cells were incubated with the anti-Ki-67 primary antibody (1:100) overnight at 4°C and, then, with the DyLight-conjugated species-specific secondary antibody (1:500) for 2h at room temperature. Slides were finally incubated with DAPI (Sigma-Aldrich; 1:1000) for 5 min to stain cell nuclei, mounted in a fluorescence mounting medium (Dako, Glostrup, Denmark), and examined with an ApoTome fluorescence microscope (Carl Zeiss, Jena, Germany). Images were acquired using the ZEN software v.5.0 SP1.1 (Carl Zeiss) and analysed with the ImageJ software, counting the percentage of Ki-67 positive cells over the total number of nuclei in 10 different fields for each treatment conditions in 4 independent experiments.

     

    Cell morphology assessment

    HAoECs were plated in 8-chamber μ-slides (IBIDI) at a density of 1.0 × 103 cells/cm2, incubated with α-MSH 10-8 M or medium alone for 6h, fixed for 10 min in 4% paraformaldehyde solution, and permeabilised with 0.1% Triton X-100 for 1h. Non-specific binding was prevented using a blocking solution of 5% bovine serum albumin. Cells were stained for 1h at room temperature with phalloidin, a high-affinity probe for polymeric F-actin, conjugated to the red-orange fluorescent dye tetramethylrhodamine B isothiocyanate (TRITC) (Sigma-Aldrich). Slides were then stained with DAPI and images were acquired with an ApoTome fluorescence microscope (Carl Zeiss). Images were then analysed using the ZEN software and cell shape and stress fibres alignment were assessed. Changes in cell morphology were assessed by the ImageJ software measuring the major and minor cellular axis. Cells with axial ratios (long axis/short axis) larger than 3 were counted in randomly selected fields in 3 separate experiments and expressed as percentages of the total cells counted (250 cells on average).

     

    Intracellular Ca2+ mobilization assay

    Intracellular Ca2+ levels were measured using the Fluo-4 NW Calcium Assay Kit (Invitrogen). HAoECs, seeded onto a 24-well plate with IBIDI culture inserts in a calcium free medium, were loaded with 400 μL of Fluo-4 NW for 30 min at 37°C and 5% CO2. Fluorescence was measured for 300 sec after treatment with α-MSH 10-8 M using the Infinite M200 PRO plate reader (excitation, 494 nm; emission, 516 nm). Thapsigargin (10-8 M), an inhibitor of sarco/endoplasmic reticulum Ca2+-ATPases that causes a rapid raise of cytosolic Ca2+ by depleting endoplasmic reticulum stores [28],  was used as positive control for Ca2+i release, treating HAoECs for 120 sec before stimulation with α-MSH (10-8 M). MC1R specific activation was assessed pre-treating cells with the MC1R-selective antagonist 153N-6 (10-5 M) for 15 min. Ca2+i changes were calculated as the difference between the area under the curve (AUC) before (resting levels) and after addition of stimuli.

     

    Time-course gene expression analysis by microarray

    To isolate RNA from cells undergoing directional migration assay, we used the Agencourt RNAdvance cell v2 kit (Beckman Coulter, Beverly, MA), following manufacturer’s instructions. RNA extracted from migrating HAoECs at 0.5, 3, 6, and 12h was used for microarray analysis. Labelled, linearly amplified complementary RNA (cRNA) was generated by Illumina Total Prep RNA Amplification Kit (Life Technologies), according to manufacturer’s manual. Briefly, 200 ng of total RNA was reverse-transcribed to cDNA using an oligo(dT) primer containing a T7 promoter sequence. Second-strand cDNA was subsequently synthesized, and then in vitro transcribed adding biotin-dNTPs. After column-based purification and ammonium acetate/ethanol precipitation, cRNA was quantified by the Infinite M200 PRO plate reader. cRNA profile of all samples was checked by the RNA 6000 Nano Assay kit in an Agilent 2100 Bioanalyzer. cRNA (750 ng per sample) was hybridized at 58°C for 18h on HumanHT-12 v4 Expression BeadChips (Illumina, San Diego, CA), followed by detection signal reaction with the fluorolink streptavidin-Cy3 (GE Healthcare Life Sciences) as recommended by manufacturer’s instructions. Each array on the BeadChips was scanned using an iSCAN System (Illumina). Array data export and quality control analysis were performed with the GenomeStudio Software v2011.1 (Illumina). Pre-processing of raw data was done by importing and analysing them with the lumi package [29], in the R software environment v2.15.2. Data variance stabilization was performed by variance stabilizing transformation (VST). Transformed data were normalized by robust spline normalization (RSN) algorithm, which combines the features of quantile and loess normalization. For subsequent analysis, we retained probes with a detection p-value < 0.01 in at least 10% samples.

    Raw and normalized, MIAME compliant microarray data are available in the NCBI’s GEO repository under the accession number GSE49348 (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE49348).

    Microarray data were validated investigating mRNA expression of 84 wound healing related genes at different time points by RT-qPCR, using the Human Wound Healing RT² Profiler PCR Arrays (Qiagen Sciences, Frederick, MD) following manufacturers’ recommendations. The concordance of microarray hybridization intensities (log2 transformed) with PCR data (Ct) was measured computing the Pearson correlation coefficient and assessing its statistical significance.

     

    Statistical analysis and bioinformatics

    Data from functional assays passed the Shapiro-Wilk test for normality. Differences among groups were assessed by one-way ANOVA followed by Tukey’s multiple comparisons test, or two-way ANOVA followed by Bonferroni post-hoc test, as appropriate. P-values<0.05 were considered statistically significant.

    To analyse the time-course microarray gene-expression experiments, we used the Short Time-series Expression Miner (STEM) v1.3.8 algorithm [30] (see online suppl. material, Table S1 for analysis parameters). STEM implements a clustering method that lines up two steps. First, it selects a set of unique representative temporal profiles that, independently of the data, cover every possible expression profiles that can be generated in the experiment for a given set of parameters; second, it assigns to one of these temporal profiles only those gene profiles that pass the filtering criteria, as determined by a correlation coefficient. A permutation test was used to identify which profiles had a statistically significant enriched number of genes (for a false discovery rate, FDR < 0.05), and significant profiles were grouped into larger clusters by their correlation degree (≥ 0.7). As data input for STEM we used the log2 ratio of the α-MSH-treated to non-treated HAoEC gene-expression values at each time point. Data were from three independent experiments, and each input derived from the average expression values of two technical hybridization replicates. The extent of the regulation is calculated as the maximum-to-minimum fold-change showed by the gene during the time-course.

    Hierarchical clustering was performed using the GENE-E software v3.0.206 (https://software.broadinstitute.org/GENE-E). Unsupervised analysis of the average gene expression ratios of α-MSH stimulated cells to non-stimulated cells, at the four time points considered, was performed using one minus Pearson correlation distance and the average linkage method.

    Analysis of functional relations among regulated genes was made using the DAVID Bioinformatics Resources v6.7 (http://david.abcc.ncifcrf.gov/home.jsp) [31], testing for multiple annotations, i.e. Gene Ontology (GO) terms, KEGG pathways, and the Swiss Prot (SP)-Protein Information Resource (PIR) keywords. Redundant GO terms were removed using the web-based tool REViGO [32]. A network map of the enrichment analysis was produced by the Cytoscape program v2.8.2 [33], using the Enrichment Map app [34], a network-based visualization method for gene-set enrichment results.

     

     

    Results

     

    Human macrovascular endothelial cells constitutively express a functional MC1R, but not POMC

    To determine which elements of the melanocortin system are expressed in human ECs from large vessels, we first performed real-time PCR analysis for detecting specific mRNAs in six human primary cells grown to confluence, i.e. three aortic ECs (HAoECs) and three coronary artery ECs (HCAECs). All the macrovascular ECs clearly expressed MC1R, but no other known MCRs (Table 1). Cell lines expressed the receptor mRNA at comparable levels, with the exception of one HCAEC which showed levels twice as high as the other HCAECs. At variance with human dermal microvascular EC [10], POMC was undetectable in HAoECs and HCAECs. We detected the prohormone convertases (PCSK1PCSK6FURIN, and SCG5) [35] that process POMC into most of the derived peptides, but not PCSK2, which is needed to produce α-MSH. Consistently, α-MSH was undetectable in culture supernatants of all six macrovascular ECs (see Supplementary Fig. S2).

     

    Table 1. Expression of the MCRs, POMC, and prohormone convertases in primary human macrovascular endothelial cells. HAoEC: human aortic endothelial cells; HCAEC: human coronary artery endothelial cells; HA: human astrocytes (positive control). Three different primary lines for each type of EC were analysed by RT-qPCR: from c1,c4ECACC, c2,c5Lonza, and c3,c6Promocell. In the upper panel, detection levels are reported as: -, undetected; +, <35 Ct; and ++, <30 Ct. In the lower panel, MC1R expression levels in each cell line are shown as means ± SEM of triplicate technical replicates

     

    To verify whether the three HAoECs express the MC1R protein, we performed immunoblot analysis. Specific immunoreactive bands, corresponding to the molecular weight of the canonical fully active receptor [36], were detected both in total cell lysates (see Supplementary Fig. S3A) and in membrane extracts (Fig. 1A and S3A), showing that the MC1R receptor was expressed on the plasma membrane of the HAoECs. Bands consistent with the MC1R dimeric forms were also detected (see Supplementary Fig. S1 and S3A). The level of expression of the MC1R monomer in total cell lysates was very similar among the three primary cell lines, whereas the HAoEC no. c3 appeared to express half the quantity of the other two lines (see Supplementary Fig. S3B and S3C). Finally, the canonical monomeric form of the receptor was detected in all three HCAECs as well (see Supplementary Fig. S4).

     

    Fig. 1. HAoECs express a functional MC1R. (A) Immunoblot analysis of membrane extracts showed that all three studied primary cells express MC1R on the plasma membrane. An anti-ATPase Na+/K+ transporting subunit alpha 1 (ATP1A1) antibody was used as membrane-specific loading control (upper light grey arrow). Absence of a β-actin immunoreactive band (lower light grey arrow) excluded contamination with cytoplasmic proteins in this preparation. The 37 kDa MC1R-specific immunoreactive band is indicated by a grey arrow. Lanes are: M, molecular weight marker; C+, HEK293 cells transiently transfected with the MC1R full-length cDNA (positive control); c1, c2, c3, primary HAoECs from ECACC, Lonza, and Promocell, respectively. (B) Intracellular cAMP concentrations were measured in confluent HAoECs after treatment with α-MSH for 5 min, with or without the MC1R-selective α-MSH antagonist 153N-6. Results are shown as scatter dot plots with mean ± SD (n = 5-6 per treatment group). Statistical significance of differences was assessed by one-way ANOVA [F(3,18) = 7.900, p=0.0014] followed by Tukey's post-hoc test (*p<0.05, **p<0.01). (C) Immunohistochemical detection of MC1R in a normal human aorta specimen (10×) confirmed that HAoECs express the receptor in vivo. To control for staining specificity, we used secondary antibody alone (left), anti-MC1R antibody pre-adsorbed with the specific blocking peptide and secondary antibody (centre), and anti-MC1R antibody with secondary antibody (right): only the latter showed an intense staining.

     

    Given that MC1R is a highly polymorphic gene and that many variants are known to affect its signal transduction [37], we sequenced the MC1R ORF of the six primary human artery ECs to identify and exclude from subsequent functional analysis those cells with gene variants that may interfere with the cellular response to MC1R ligands. All the three HCAECs bear a variant allele, whereas two HAoECs did not present any polymorphism (see online suppl. material, Table S2). The variant alleles found have been associated with a decrease in cAMP production in response to α-MSH stimulation [38-40]. For functional testing, we elected to use the HAoEC no. c2, which carried the wild-type receptor, due to its shorter doubling time.

    We measured the changes in intracellular cAMP levels after treatment with α-MSH, to test whether confluent HAoECs express a functionally active MC1R. Indeed, 5-min stimulation with α-MSH 10-8 M induced a significant increase of intracellular cAMP in cells grown to confluence (Fig. 1B); cAMP elevation occurred in a concentration-dependent manner, showing a typical inverted U-shaped dose-response curve (see Supplementary Fig. S5A) [41, 42]. Co-incubation with the receptor antagonist 153N-6 (10-5 M) abolished the elevation of cAMP, indicating that MC1R is specifically activated by α-MSH (Fig. 1B).

    Finally, to test whether HAoECs express MC1R in vivo, we performed immunohistochemistry staining for the receptor in formaldehyde-fixed paraffin sections of a normal human aorta. We observed a positive staining of endothelial cells, confirming the in vitro observations (Fig. 1C).

     

    α-MSH promotes migration of HAoEC via MC1R activation

    To determine whether MC1R activation has any influence on HAoEC migration and/or proliferation, we used a directional cell migration assay. Stimulation with α-MSH 10-8 M enhanced HAoEC migration (Fig. 2A), and this effect too occurred in a concentration-dependent manner (see Supplementary Fig. S5B): in comparison with cells cultured in growth medium only, migration speed appeared to accelerate after 3h of treatment and became significantly higher at 9 and 12h in α-MSH-treated cells. Consistently, concomitant use of 153N-6 10-5 M was able to abolish the pro-migratory effect of α-MSH, whereas treatment with 153N-6 alone did not alter EC migration speed (also see representative images in Supplementary Fig. S6). Gap closure assays were then performed in the presence of the proliferation inhibitor PD0332991: as expected, blocking cell proliferation increased gap closure time, but the higher speed in α-MSH-treated cells confirmed the enhancement in cell migration after MC1R activation, which was still significant at 9 and 12h (Fig. 2B and representative images in Supplementary Fig. S7A). To prove the generalizability of the pro-migratory effect of MC1R stimulation on macrovascular ECs, we showed that treatment with α-MSH 10-8 M significantly enhanced cell migration also in the other HAoEC line (no. c1) bearing the wild-type receptor, although at a lower speed (Fig. 2C and Supplementary Fig. S7B). Finally, to ascertain whether the observed responses were specifically dependent on the MC1R receptor subtype, we performed the same directional cell migration assay with the HAoEC line that was found to carry a loss-of-function allele in the MC1R gene (no. c3): interestingly, these cells showed an attenuated response to α-MSH (10-8 M), with a slight non-significant acceleration in cell migration (Fig. 2D and Supplementary Fig. S7C). Of note, accelerated HAoEC migration upon activation of MC1R was confirmed in in vitro scratch wound healing assays (see Supplementary Fig. S8A and S8B): again, pre-treatment with the receptor antagonist 153N-6 (10-5 M) abolished the effect. Conversely, there was no clear-cut effect on cell proliferation following MC1R activation, as documented by the number of Ki-67 positive cells, which was not significantly different between treated and untreated HAoECs (see Supplementary Fig. S9A and S9B). MC1R expression did not significantly change over time during cell migration (not shown).

     

    Fig. 2. MC1R activation enhances HAoEC migration. (A) After insert removal, HAoEC (no. c2) monolayers were treated with α-MSH 10-8 M, with or without the MC1R-antagonist 153N-6 10-5 M, and allowed to migrate for 3, 9, and 12h: gap closure was quantified using DiR cell staining and near-infrared fluorescence scanning. Results are shown as mean ± SEM (n = 6). Statistical significance of differences was assessed by two-way ANOVA [F(9,80) = 2.957, p=0.0044, interaction time × treatment; F(3,80) = 10.85, p<0.0001, treatment effect] with Bonferroni post-hoc test [**p<0.01, ***p<0.001, α-MSH vs. medium alone (C)]. (B) Directional migration assay was repeated in the presence of the proliferation inhibitor PD0332991. Results are shown as mean ± SEM (n = 10). Statistical significance of differences was assessed by two-way ANOVA [F(3,72) = 3.018, p=0.0353, for interaction; F(1,72) = 9.074, p=0.0036, treatment effect] with Bonferroni post-hoc test (*p<0.05, **p<0.01). (C) The migration assay was repeated with HAoECs no. c1, the other cell line bearing wild-type MC1R alleles. Results are shown as mean ± SEM (n = 4). Statistical significance was assessed by two-way ANOVA [F(1,24) = 6.016, p=0.0218, for treatment effect] with Bonferroni post-hoc test (**p<0.01). (D) The migration assay was finally repeated with HAoECs no. c3, carrying a loss-of-function mutation in the MC1R gene. Results are shown as mean ± SEM (n = 5). Two-way ANOVA with Bonferroni post-hoc test showed no statistically significant differences.

     

    As cell migration is preceded by changes in cell morphology and actin filament remodelling, we evaluated whether these modifications occurred in HAoECs after 6h from stimulation with α-MSH 10-8 M. Indeed, we observed that MC1R activation through α-MSH induced an accelerated shift from a "cobblestone", polygonal shape to an elongated shape in these ECs, with rearrangement of actin filaments (Fig. 3A). Phalloidin-TRITC staining showed formation of aligned stress fibres in α-MSH-treated cells compared to untreated cells, whose actin filaments were mostly organized in short, unaligned stress fibres. HAoECs were then quantified for cell elongation, and cells stimulated with α-MSH showed a significantly higher number of elongated cells in comparison with control cells (Fig. 3B).

     

    Fig. 3. MC1R activation enhances actin filament remodelling and cell elongation in migrating HAoECs. (A) Non-confluent ECs were stimulated with α-MSH for 6 h, then fixed and stained with TRITC-labelled phalloidin for actin filament visualization, using DAPI for nuclear counterstain (40×). Aligned stress fibres and cellular elongation are pronounced in treated vs. untreated HAoECs. (B) Quantification of cell elongation. Cells with axial ratios > 3 were counted in randomly selected fields and expressed as percentages of the total cells counted. Results are shown as scatter dot plots with mean ± SD (n = 3 per group). Statistical significance of differences was assessed by two-tailed unpaired t test (*p=0.0356).

     

    Since MC1R may signal through either cAMP increase or intracellular elevation of free cytosolic Ca2+ [43], we tested which signal transduction pathway was active in the enhancement of the HAoEC migration. Stimulation with α-MSH 10-8 M did not lead to an increase of intracellular cAMP in migrating HAoECs compared to control cells (see Supplementary Fig. S10). On the contrary, MC1R activation resulted in a significant, rapid, and sustained increase in intracellular Ca2+ levels over the control, early after the removal of the insert in the cell migration assay (Fig. 4A). This rise was completely abolished when HAoECs were pre-treated with the α-MSH antagonist 153N-6 10-5 M, which in turn alone did not affect Ca2+ signalling. Comparisons of the AUCs confirmed that the α-MSH-induced rise in Ca2+ levels was highly significant (Fig. 4B). Incubation with thapsigargin (10-8 M), a non-competitive inhibitor of sarco/endoplasmic reticulum Ca2+-ATPases (SERCAs) that causes a rapid raise of cytosolic Ca2+ by depleting endoplasmic reticulum stores [28], did not prevent a further significant rise of Ca2+ in response to a subsequent stimulus with α-MSH (Fig. 4C and 4D). This was almost completely inhibited by pre-treating HAoECs with the α-MSH antagonist 153N-6 10-5 M. Intriguingly, α-MSH 10-8 M was able to induce Ca2+ mobilization also in confluent HAoECs, to levels comparable to those produced by thapsigargin (see Supplementary Fig. S11). In this case, thapsigargin almost completely hindered a further rise of Ca2+ in response to a subsequent stimulus with α-MSH.

     

    Fig. 4. MC1R activation increases intracellular calcium levels in migrating HAoECs. (A) Treatment with α-MSH after insert removal in the cell migration assay induced a prompt increase in intracellular Ca2+ levels (as detected by Fluo-4 NW fluorescent calcium indicator), which was completely abolished by pre-treatment with the MC1R-antagonist 153N-6. (C) Rise of intracellular Ca2+ in response to the stimulus with α-MSH was not prevented by prior stimulation with thapsigargin (THAPS). This was inhibited by pre-treating HAoECs with 153N-6. Arrows indicate thapsigargin or α-MSH stimulation. Curves present the mean ± SEM of n = 5-6 independent experiments. RFU, relative fluorescence unit. (B, D) The areas under the curve (AUC) were used to compare α-MSH-induced effects with control treatments. Results are shown as scatter dot plots and mean ± SD Statistical significance of differences was assessed by one-way ANOVA [(B) F(3,17) = 14.56, p<0.0001; (D) F(3,16) = 12.50, p=0.0001] with Tukey's post-hoc test (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001).

     

    To further explore the Ca2+-dependency of the α-MSH-induced cell migration, we repeated the directional cell migration assay in the presence of the membrane-permeant Ca2+ chelator BAPTA-AM, which is widely used as an intracellular Ca2+ sponge to control intracellular calcium ion concentration ([Ca2+]i) [44]. The pro-migratory effect of α-MSH 10-8 M, once more significant at 9 and 12 h, was indeed completely inhibited by pre-treating HAoECs (no. c2) with BAPTA-AM 10-5 M (Fig. 5A), confirming that Ca2+ mobilization via MC1R activation was involved in modulating cell migration. Finally, since α-MSH-stimulation of MC1R may induce [Ca2+]i elevation via activation of the PLCβ pathway [45, 46], which in turn has a key role in mediating EC functions and angiogenesis [47], we carried out the directional cell migration assay also in the presence of the PLCβ inhibitor U-73122. Again, the pro-migratory effect of α-MSH 10-8 M was inhibited by pre-treating HAoECs with U-73122 5 × 10-5 M (Fig. 5B), suggesting that α-MSH evoked calcium mobilization/cell migration was dependent on the activation of PLCβ.

     

    Fig. 5. Calcium chelation or PLC inhibition prevent MC1R-mediated enhancement of HAoEC migration. (A) After insert removal, HAoEC (no. c2) monolayers were treated with α-MSH 10-8 M, with or without pre-treatment with the intracellular Ca2+ chelator BAPTA-AM 10-5 M, and allowed to migrate for 3, 9, and 12h: gap closure was quantified using DiR cell staining and near-infrared fluorescence scanning. Results are shown as mean ± SEM (n = 5-6 per group). Statistical significance was assessed by two-way ANOVA [F(9,68) = 2.337, p=0.0233, interaction time × treatment; F(3,68) = 5.493, p=0.0019, treatment effect] with Bonferroni post-hoc test [*p<0.05, **p<0.01, α-MSH vs. medium alone (C)]. (B) Directional migration assay was carried out also pre-treating cells with the PLC inhibitor U-73122. Results are shown as mean ± SEM (n = 5-6). Statistical significance was assessed by two-way ANOVA [F(9,68) = 2.607, p=0.0120, for interaction; F(3,68) = 7.102, p=0.0003, treatment effect] with Bonferroni post-hoc test (*p<0.05).

     

    Time-course expression analysis revealed several gene modules dynamically regulated by MC1R activation

    To evaluate the effects of MC1R activation at the transcriptional level, we assessed genome-wide gene expression profiles at 0.5, 3, 6, and 12h after stimulation with α-MSH 10-8 M vs. control in HAoECs cultured in the directional cell migration assay. Applying stringent filtering parameters, we deemed expressed 18936 of the 47231 measured transcripts (40%). Comparative time-course analysis, using the STEM algorithm [30], identified 637 genes whose expression consistently showed a median change ≥ 30% over time as an effect of stimulation with α-MSH. These genes fitted 57 of the 625 possible model profiles computed by the clustering algorithm (see Supplementary Fig. S12). Five hundred and six transcripts were associated with 15 distinct temporal profiles that showed a statistically significant enriched number of genes at a FDR<0.05 (see Supplementary Fig. S12 and Table S3a). The remaining 131 genes were associated with model profiles that had a FDR>0.05 (see online suppl. material, Table S3b) and, thus, were deemed as potentially arising from noise by random chance and excluded from subsequent analysis. Interestingly, we did not observe any significant change in MC1R expression level in migrating ECs after stimulation with α-MSH at any time point. The 15 significant temporal profiles of differential expression were grouped, based on their similarity by a correlation coefficient ≥ 0.7, to form 6 different clusters (Fig. 6A and 6B). Overall, genes belonging to clusters 1 and 4 showed a marked increase in expression at 6h in treated vs. untreated cells, whereas genes in clusters 2 and 3 displayed a marked decrease at the same time point; conversely, genes in clusters 5 and 6 appeared to be upregulated at 3h.

     

    Fig. 6. Significant temporal expression profiles of genes modulated by MC1R activation in migrating HAoECs. (A) List of significantly enriched temporal expression patterns identified by STEM analysis. Expression profiles are grouped into six clusters based on their similarity (r ≥ 0.7) and ordered by p-value significance within each cluster profile. The number of genes belonging to a profile is reported. (B) Heatmap depicting temporal expression of genes within each cluster. Genes hierarchically clustered into 6 groups using one minus Pearson correlation distance and the average linkage method. Data are the average log2 gene expression ratio of α-MSH stimulated cells to non-stimulated cells (n = 3 independent experiments, with two technical replicates each). Normalized expression ratios are shown as a gradient colour ranging from lower (blue) to higher (gold) values.

     

    Time-course expression data of control and α-MSH stimulated cells at 3 and 6h were validated using PCR-based arrays profiling key genes involved in wound healing. Forty-eight genes were detected by both microarray and real-time PCR (see Supplementary Fig. S13), with a strong positive correlation between their average signal intensities (r ≥ 0.8, p<0.0001 for all pairwise correlations).

    To uncover the biological meaning beneath these transcriptional effects, we performed a functional enrichment analysis of the 506 regulated genes (see online suppl. material, Table S4). Forty-four terms were significantly enriched at p<0.01 and FDR<0.20 and were used to draw a network to visually interpret biological data (Fig. 7). The most significant gene sets included the phosphoprotein class (FDR<0.00002), the endomembrane system (FDR<0.015), and the ECM-receptor interaction (FDR<0.025). Notably, 197 of the 506 regulated genes encode for phosphoproteins, 188 produce variant proteins by alternative splicing, and 65 are transcription factors or regulators. Importantly, 11 genes, i.e. AGRNCOL1A1COL1A2COL4A5COL5A1DAG1ITGA2ITGA10LAMB1LAMC1, and SPN, belonged to either the ECM-receptor interaction pathway or the extracellular matrix cellular component.

     

    Fig. 7. Modules of co-regulated genes in migrating HAoECs upon MC1R activation. The enrichment map of modulated genes was drawn as a network of the most significant functionally annotated gene sets (p<0.01 and Benjamini FDR<0.20). Nodes represent gene sets. Node colour intensity is relative to enrichment significance, from lower (light) to higher (dark red). Node size is proportional to the gene set size. Gene sets are connected by green edges based on their similarity. Edge thickness measures the degree of the overlap between two gene sets (using a cut-off of the Jaccard plus Overlap combined coefficient = 0.375). Clusters of tightly, functionally related gene sets are circled and assigned an overall label. Heat maps of temporal expression patterns of relevant gene sets and pathways are displayed. Hierarchical clustering of genes was performed using one minus Pearson correlation distance and the average linkage method. Row normalized expression values are shown as a gradient colour ranging from lower (blue) to higher (gold) values.

     

    To further analyse gene expression changes in a structured fashion, functionally enrichment analysis was performed associating annotated gene sets with the 6 different clusters of temporal profiles (see online suppl. material, Table S5). Co-expressed gene subsets were visualized as temporal clustered profiles sharing functional annotations (Fig. 8). Coupling time-course gene expression analysis to enrichment analysis allowed identifying significantly regulated genes that have never been associated with MC1R signalling before, including genes involved in ECM-receptor interaction, vesicle-mediated transport, SNARE protein complex formation, and metal ion binding through metal-thiolate cluster structures (metallothioneins, MTs).

     

    Fig. 8. Time-course gene cluster profiles. The 6 different expression profiles represent time-dependent dynamic gene modulation as the mean of significant temporal profiles grouped on the basis of their similarity. Each cluster profile is associated with gene sets and pathways (coloured rectangles) significant at the enrichment analysis. For cluster 5, a gene set with a nominal p<0.05 is indicated. On the y-axes is the log2 mean fold change (FC) relative to control cells, i.e. the log2 gene expression ratio of α-MSH stimulated cells to non-stimulated cells; on the x-axis is the experimental time scale (hours).

     

     

    Discussion

     

    In this work, we provide the first formal demonstration that human artery ECs express constitutively a functional MC1R and present evidence that activation of this melanocortin receptor drives faster EC migration and wound closure. Besides, time-course gene expression analysis allowed us identifying downstream molecular pathways associated with the enhanced cell motility following α-MSH engagement of the MC1R. This observation adds to the known functions of the melanocortin system, which is known to regulate homeostasis and possess cellular and tissue protective effects [2]. It is worth mentioning that our data are apparently in contrast with the notion that α-MSH inhibits migration of several cell types, such as immune/inflammatory [6, 7] or melanoma cells [48]: our findings pinpoint that the spectrum of action of MC1R signalling is wider and more diversified than previously thought, possibly depending on the cell type and pathophysiological context. Similarly, α-MSH binding to the MC1R stimulates or inhibits the proliferation respectively of cultured human melanocytes [49] and mesothelioma cell lines [50].

    We detected both the MC1R mRNA and protein and demonstrated that it was functionally active, since resting confluent HAoECs were able to produce cAMP in response to exogenous α-MSH. No other component of the melanocortin system was detectable in HAoECs. Consistently, we did not detect α-MSH in cell culture supernatants. Thus, HAoECs are not a source of melanocortin peptides, but may be targeted by endocrine secretion (by the pituitary gland) or paracrine release of endogenous agonists (e.g. by immune cells at injured sites) [6, 7]. These findings represent a peculiar difference between macrovascular and microvascular ECs, as it has been reported that HDMECs express POMC and release melanocortin peptides upon stimulation [10]. In addition, unlike the microvascular ECs [12], MC1R expression did not significantly changed upon exposure of the HAoECs to α-MSH. This finding suggests that in macrovascular ECs MC1R expression levels are not influenced by pathways that depend on its activation and that HAoEC migration is not dependent on MC1R upregulation.

    These results underline that artery ECs present cell type-restricted gene expression, which may account for a specific physiological function for MC1R, other than anti-inflammatory actions. This hypothesis led us to investigate whether MC1R activation could affect macrovascular EC migration after injury. EC migration is a fundamental process primed by damage and involved in vascular homeostasis and repair. Our data revealed that MC1R activation by α-MSH increased the rate of HAoEC migration, both in gap-closure and in injury-induced wound-healing assays, without significantly affecting cell proliferation. This effect was specifically induced by MC1R activation, since the 153N-6 peptide antagonist at MC1R [25] abolished the α-MSH-driven migration of HAoECs, reverting it to the same rate of control cells. Consistently, ECs carrying a loss-of-function mutation in the MC1R gene did not show a significant acceleration in cell motility upon challenge with α-MSH. In seeming contrast to what we observed, it has been recently reported that α-MSH inhibits in vitro migration of HUVECs [51]; but this reinforces our idea that the pro-migratory effect of α-MSH via MC1R activation is restricted to arterial ECs of the macrovasculature. Accordingly, we observed a prompt elevation of intracellular free Ca2+ after α-MSH stimulation in migrating cells, but not of cAMP, suggesting that MC1R activation enhances EC migration through the Ca2+ signalling cascade. Indeed, artificial intracellular calcium buffering by pre-treating cells with the cell-permeant Ca2+ chelator BAPTA-AM completely abolished the α-MSH-evoked acceleration in EC migration. Increase of calcium levels in the cytosol is an evolutionary conserved signal involved in the regulation of EC motility. Ca2+ mobilization can both stabilize and weaken cell-ECM interactions responsible for the asymmetry between cell front and rear adhesions, which finally results in cellular directed movement [52-54].

    Intriguingly, our experiments showed that HAoEC MC1R might signal by increasing cAMP and/or intracellular Ca2+ depending on the cellular state: resting confluent HAoECs responded to MC1R engagement with α-MSH through cAMP and [Ca2+]i increase, while migrating cells responded through Ca2+ mobilization without any cAMP increase. To date, only a few reports support an involvement of calcium as a second messenger in MC1R signalling, besides cAMP. Ca2+ responses has been reported in HEK 293 cells transfected with mouse Mc1r [55] and in human melanoma cell lines [48], keratinocytes [56], and basophils [57] expressing MC1R. No elevation in cAMP was detected in keratinocytes and basophils in response to α-MSH [56, 57], whereas in melanoma cells and keratinocytes intracellular Ca2+ release was observed only in the presence of a pharmacological adenosine agonist that inhibits the cAMP pathway [48, 56]. Conversely, our findings provide evidence that MC1R couples to both cAMP and Ca2+ signalling systems in HAoECs and suggest that different functional states may direct alternative signalling pathways in macrovascular ECs. This is remarkable: MC1R appears to be one of those GPCRs that may simultaneously couple to distinct unrelated G-proteins and alternatively activate multiple intracellular effectors [58] depending on cell type, physiological condition, and the availability of G-protein (Gαs or Gαq) adaptors [59]. Of note, in the MCR family, alternative G-protein coupling has been reported for MC4R [60].

    In HEK 293 cells transfected with Mc1r, complete depletion of intracellular Ca2+ stores following pre-treatment with thapsigargin 10-8 M abolished a further rise in [Ca2+]i in response to α-MSH, suggesting that the thapsigargin-sensitive endoplasmic reticulum Ca2+ stores were the source of [Ca2+]i increase [55]. This appears to be the case also for confluent HAoECs. On the contrary, in migrating HAoECs this concentration of thapsigargin was not able to inhibit a further rise in [Ca2+]i in response to α-MSH, suggesting that either SERCAs were only partially inhibited or α-MSH may increase intracellular Ca2+ from other sources. Indeed, angiogenic factors induce cytosolic calcium rises through either entry from extracellular space, by opening Ca2+ permeable channels in the plasma membrane, or release from intracellular organelles [61]. On the other hand, it has been shown that thapsigargin 1 µM may activate Ca2+ entry both by store-dependent and store-independent pathways in the HUVEC line EA.hy926 [62]. Here, we provide mechanistic insight showing that α-MSH-induced intracellular Ca2+ mobilization and accelerated migration are dependent on the activation of the PLC signalling pathway: in fact, the blockage of PLC by the specific inhibitor U-73122 completely abrogated the increase in HAoEC migration rate via MC1R activation. GPCR-mediated PLCβ activation cleaves membrane-bound phosphatidylinositol 4, 5 bisphosphate (PIP2) into inositol (1, 4,5) trisphosphate (IP3) and diacylglycerol; IP3 binding to IP3 receptor (IP3R) channels promotes Ca2+ release from the endoplasmic reticulum [63]. Consistent with our observation, MC1R has been recently shown to transduce through the PIP2-PLCβ pathway in sebocytes [45] and B16-F10 melanoma cells [46].

    Time-series genome-wide gene-expression analysis on migrating HAoECs showed that large gene sets were significantly affected by α-MSH treatment: i.e., genes involved in the regulation of RNA transcription, encoding for proteins for which isoforms exist due to pre-mRNA splicing events (alternative splicing), and genes belonging to the phosphoprotein category. This indicates that MC1R activation has a wide influence on pathways playing a prominent role in regulating cellular activity. MC1R activation also modulated genes associated with the endomembrane system and intracellular organelle lumen, suggesting a role in controlling cellular trafficking and molecule mobilization. Remarkably, MC1R engagement with α-MSH affected the ECM-receptor interaction pathway, which is known to be critical for the directional haptotactic EC migration [64]. Conversely, MC1R activation did not affect the expression of cell cycle-related genes, which was consistent with the apparent lack of effect on HAoEC proliferation in the gap closure assay. Our findings suggest that the regulation of the ECM components, i.e. collagens and laminins, and of their receptors, i.e. integrins and dystroglycans, through MC1R may drive higher HAoEC motility. α-MSH appears to boost HAoEC migration regulating the interaction between the cellular receptor integrins (ITGA2 and ITGA10) and DAG1 to their ECM counterpart collagens (COL1A1COL1A2COL4A5, and COL5A1), laminins (LAMB1 and LAMC1) and AGRN. The directed motility of ECs is strictly dependent on cell adhesion to ECM [64, 65]. Integrins and interstitial collagen mediate haptotactic cell migration, which is of primary importance in driving EC migration during large vessel repair [21, 66]. Furthermore, time-course analysis evidenced that 9 genes of the ECM-receptor interaction pathway had a similar temporal expression profile, with a peak induction at 3h followed by a reversion at 6h, suggesting that common factor(s) may control their co-expression. Conversely, ITGA2 and SPN showed a specular temporal profile, with a later peak expression at 6h, which is suggestive of a sequential upregulation of ECM-receptor interaction genes [67]. Remarkably, we showed that α-MSH enhances EC migration along with actin filament remodelling and changes in cell architecture. Binding of integrins to type-I collagen suppresses cAMP production and the activity of cAMP-dependent protein kinase A: consequently, actin polymerization is induced, contributing to the formation of stress fibres and to EC contractility, which finally generates the directional movement [68]. This is consistent with the idea that the fine-tuning of integrins and their binding molecules promoted by MC1R activation plays a key role in conditioning HAoEC migration rate. In addition, MC1R stimulation induced an early upregulation of SNARE proteins (which mediate vesicle-membrane fusion) and cytoplasmic vesicle genes, followed by a later overexpression of metal-binding proteins. Importantly, trafficking and delivery/fusion vesicle proteins are essential for the regulation of front-rear polarity during directional cell migration [69, 70]. Likewise, MTs enhance EC motility [71] and angiogenesis [72] through transcriptional regulation of various vascular growth-factors, and their modulation drove suppression of reactive oxygen species production in ECs exposed to elevated laminar shear stress [73]. Such a pattern of temporal dynamics in gene expression (i.e. ECM-receptor interaction, SNARE, or MT genes) is expected as an "impulse response" to a transient signal, namely a single pulse of α-MSH [74]. This typical oscillating wave of co-expressed genes may reflect a highly ordered temporal organization in gene transcription, which ultimately results in the subsequent, coordinated translation into the corresponding effector proteins that drive the α-MSH-mediated increase in EC migration speed. Consistently, the peaks in gene expression were followed at 6-12 hours by a transition to the steady state.

    In summary, MC1R activation via α-MSH appears to accelerate directional HAoEC migration through the following steps: (a) binding of melanocortin hormones to MC1R induces (b) an increase in cytosolic Ca2+ while preventing a rise in cAMP biosynthesis, through a putative alternative G-protein coupling and PLC-pathway activation, and subsequently (c) the coordinate modulation of genes of the ECM-receptor interaction, vesicle- and SNARE-mediated trafficking pathways, and metal sensing proteins, (d) possibly regulating the cell front-rear polarity. These responses reflect an unrecognized protective function of the melanocortin system, which is fostered by previously unreported α-MSH-activated, MC1R-mediated signalling and molecular pathways.

    MC1R tonic signalling and pro-migratory action may be relevant for the homeostatic functions of the arterial endothelium. The endothelium monolayer lining in the luminal side of blood vessels plays a pivotal role in the regulation of the haemostatic balance, prevention of vascular inflammation, and protection against vascular injury [75]. Normal ECs express a number of inhibitors of platelet and leukocyte activation, vasodilators, and anticoagulant and procoagulant molecules. Damage to these cells is associated with a shift in the haemostatic balance to the procoagulant side [15], loss of protective molecules and expression of adhesive, inflammatory and mitogenic factors, leading to the development of thrombosis, pathologic remodelling, and atherosclerosis [75]. Endothelial dysfunction is characterized by an imbalance between procoagulant and anticoagulant mediators and regenerated arterial endothelium may be functionally incompetent with reduced expression of antithrombotic molecules [15, 76]. EC migration is a key event in wound healing and tissue regeneration, including reendothelialisation after stent implantation [76]. Remarkably, MC1R activation in migrating HAoEC did not alter the balance between pro- and anticoagulant genes, i.e. expression of procoagulant (such as VWFF2R, and F3) and anticoagulant genes (THBDHSPGEPCR, and TFPI) was not affected by α-MSH. Thus, MC1R activation may have beneficial effects both ameliorating HAoEC motility properties and maintaining the equilibrium between pro- and anticoagulant signals.

     

     

    Conclusion

     

    Our work broadens the knowledge on MCR regulatory roles and supports the concept of a novel function for peripherally expressed MC1R, whose signalling may participate in preventing/healing of artery endothelial dysfunction, vascular repair, and reendothelialisation. Endothelial artery MC1R could represent a target for original therapeutic strategies aimed at preventing/repairing endothelial injury in a variety of cardiovascular pathological conditions associated with endothelial denudation [20].

     

     

    Acknowledgements

     

    We thank Dr Chiara Speroni for help and excellent technical assistance. We thank Fondazione Banca di Treviso ONLUS for kindly providing us with the human aorta specimen. This study was supported by Institutional Research Funds (Italian Ministry of Health, Funds 5‰ 2009-11; to G.I.C.).

     

     

    Disclosure Statement

     

    The authors declare no conflict of interests.

    Uhohinc

    unread,
    Oct 13, 2021, 10:53:10 AM10/13/21
    to Clinuvel Afamelanotide SCENESSE senescence CUV ASX.CUV CLVLY ur9
    The just above post, has, had no date of publication as I recall. It is an abstract that opens not just one door to previously not knowns, but several that transformative in understanding of MCR1 and pathways in alot of ways, not just endothelial cells which line the vascular.

    Uhohinc

    unread,
    Oct 27, 2021, 7:39:41 AM10/27/21
    to Clinuvel Afamelanotide SCENESSE senescence CUV ASX.CUV CLVLY ur9
    cardiovascular

    Uhohinc

    unread,
    Nov 17, 2021, 1:37:10 PM11/17/21
    to Clinuvel Afamelanotide SCENESSE senescence CUV ASX.CUV CLVLY ur9
    Plasma α-Melanocyte Stimulating Hormone Predicts Outcome in Ischemic Stroke
    Originally published29 Sep 2011https://doi.org/10.1161/STROKEAHA.111.627331Stroke. 2011;42:3415–3420

    Abstract
    Background and Purpose—

    α-Melanocyte stimulating hormone (α-MSH) is an endogenously produced neuropeptide derived from the same precursor as adrenocorticotropic hormone. α-MSH has profound immunomodulatory properties and may also be neuroprotective. Nothing is known about α-MSH and changes in its plasma concentrations in patients with acute ischemic stroke.

    Methods—

    In this prospective observational study, plasma concentrations of α-MSH, adrenocorticotropic hormone, cortisol, and interleukin 6 were assessed longitudinally over the course of 1 year after stroke onset in 111 patients. Logistic regression was used to the effect of initial plasma α-MSH, adrenocorticotropic hormone, cortisol, and interleukin 6 on long-term outcome.

    Results—

    There was an early decrease in plasma α-MSH in patients with severe stroke (National Institutes of Health Stroke Scale ≥17) that normalized over the course of the year; these same patients evidenced elevations in plasma cortisol and interleukin 6. Higher initial plasma α-MSH, but not adrenocorticotropic hormone, cortisol, or interleukin 6, was independently predictive of good long-term outcome.

    Conclusions—

    This research is the first to study endogenous changes in plasma α-MSH after stroke. The independent effect of early plasma α-MSH on stroke outcome, as well as a growing body of experimental data demonstrating improved stroke outcome with exogenous α-MSH administration, suggests a potential therapeutic role for α-MSH in the treatment of stroke.

    Introduction

    Alpha-melanocyte stimulating hormone (α-MSH) is a 13 amino acid neuropeptide derived from proopiomelanocortin (POMC), a prohormone polypeptide expressed in the brain, the pituitary gland, and in peripheral tissues, such as the immune system and skin.1 The processing of POMC depends on a series of prohormone convertases (PCs), and the tissue in which POMC is processed determines its eventual end products. In brain, POMC is expressed in the arcuate nucleus of the hypothalamus. Cleavage by PC1 leads to the production of adrenocorticotrophic hormone (ACTH) and β-lipotropin; further processing by PC2 leads to production of smaller peptides, including α-MSH and β-endorphin.1,2 α-MSH production is, thus, more robust in tissues that highly express PC2.

    As part of the acute phase/stress response in stroke, cortisol is elevated, and these elevations correlate with both stroke severity and outcome.35 Cortisol production depends largely on the expression of ACTH, and given the common origin of ACTH and α-MSH, we hypothesized that there might be stroke-induced alterations in α-MSH. In patients with traumatic brain injury, for instance, decreases in plasma α-MSH occur and are associated with worse outcome.6 To our knowledge, no studies have evaluated endogenous changes in α-MSH after stroke. Based on experimental data, however, a decrease similar to that seen in patients with traumatic brain injury is anticipated.7 We, thus, sought to describe the time course of changes in plasma α-MSH after ischemic stroke in relation to ACTH and cortisol. Because not all cortisol production depends on ACTH, however, we also assessed plasma interleukin (IL) 6, a cytokine that activates the hypothalamic-pituitary-adrenal axis and can directly stimulate cortisol production by the adrenal gland.8

    MethodsResearch Subjects

    This study was part of a larger prospective study that followed immune responses over the course of the year after stroke onset.9,10 The study was approved by the institutional review board, and all of the patients or their surrogates provided informed consent. Patients with ischemic stroke admitted to either Harborview Medical Center or the University of Washington Medical Center from September 2005 through May 2009 who were ≥18 years of age could be enrolled within 72 hours of symptom onset and were felt not likely to die from their stroke were eligible. Patients with ongoing therapy for malignancy, known history of HIV or hepatitis B or C, history of brain tumor, anemia (hematocrit <35 on admission), and those taking immunomodulatory drugs were excluded. Blood was drawn as soon as possible after stroke onset and at 3, 7, 30, 90, 180, and 365 days after stroke onset. Plasma was frozen at −80° until use.

    Clinical Data

    Demographic and clinical data were collected on all of the patients. Stroke severity was determined by the National Institutes of Health Stroke Scale score and outcome by the modified Rankin Scale. Total infarct volume on initial diffusion-weighted MRI was calculated by the ABC/2 method by a single radiologist trained in the Cardiovascular Health Study and Atherosclerosis Risk in Communities protocols for infarct scoring.11 Information about therapeutic interventions for the treatment of stroke and stroke-related complications, such as infection, was collected. Infection was defined as clinical symptoms of an infection (fever and/or pyuria for urinary tract infection and fever and/or productive cough and radiographic evidence of consolidation for pneumonia) and positive culture data (for both pneumonia and urinary tract infection).10

    Laboratory Studies

    Leukocyte counts, plasma cortisol, and ACTH concentrations were determined by the clinical laboratory. Plasma α-MSH concentrations were determined using a commercially available enzyme immunoassay kit (Phoenix Pharmaceuticals, Belmont, CA). Briefly, peptides were eluted from 0.5 mL of acidified plasma using C18-SEP columns containing 200 mg of C18 (Phoenix Pharmaceuticals, Belmont CA); the samples were evaporated by centrifugal vacuum concentration and reconstituted in 125 μL of buffered saline before enzyme immunoassay. The concentration of circulating IL-6 was measured with a cytometric bead-based system (Fluorokine MAP, R&D Systems); the lower limit of detection was 1.11 pg/mL. Values below the limit of detection are referred to as not detected and assigned the lowest limit of detection for statistical testing.

    Statistics

    Descriptive data are presented as median and interquartile range. Group comparisons were performed using the Mann-Whitney U test or Kruskal-Wallis H test. Data were normalized and associations tested using the Pearson correlation. Logistic regression was used to estimate the odds ratio and 95% CI for the effect of the highest initial α-MSH concentration (within 72 hours of stroke onset) on neurological outcome at 1, 3, 6, and 12 months after stroke onset. Given the relatively severe strokes seen in this study, good outcome was defined as independent ambulation (modified Rankin Scale ≤3). Significance was set at P≤0.05.

    Results

    A total of 114 patients were enrolled in the parent study; plasma α-MSH concentrations were determined in 111 of these patients, who are the subject of this article. The characteristics of the overall study population have been described elsewhere.9,10 For the 111 patients in whom α-MSH was assessed early (by 72 hours), the median age was 57 years (range: 44–66 years), the median National Institutes of Health Stroke Scale score was 11 (range: 4–19), the median infarct volume was 12 mL (range: 1–80 mL), and 35% of the patients were women. As in other publications related to this study population, we divided patients into tertiles based on stroke severity to assess changes in plasma α-MSH over the course of time.9,10 Patients with the most severe strokes (National Institutes of Health Stroke Scale ≥17) had lower concentrations of plasma α-MSH than patients with the least severe strokes at both 24 hours and 72 hours after stroke onset (Figure A). There was still a trend toward decreased α-MSH at 1 week after stroke onset in these severely affected patients, but the differences normalized over the course of time. At 1 year after stroke, the median α-MSH concentration among all of the patients was 12.8 pg/mL (range: 6.4–21.1 pg/mL), which is similar to that reported in the literature for healthy adults.12 Stroke severity appeared to have little impact on plasma ACTH (Figure B), but patients with more severe strokes evidenced increases in cortisol and IL-6 that persisted for ≥1 month after stroke onset (Figure C and D).

    Figure. Plasma concentrations of α-melanocyte stimulating hormone (α-MSH; A), adrenocorticotrophic hormone (ACTH; B), cortisol (C), and interleukin (IL) 6 (D) over the course of 1 year after stroke. Box plots depict the median and interquartile range. Data are depicted by tertile of stroke severity, differs from the lowest tertile by *P≤0.05 or †P≤0.001.

    Early relationships among α-MSH, ACTH, cortisol, and IL-6, as well as the relationships of α-MSH, ACTH, cortisol, and IL-6 with infarct volume and stroke severity, are displayed in Table 1Table 2 depicts the differences in the highest α-MSH concentration within the first 72 hours after stroke as a function of clinical and demographic differences between patients, none of which are significant after controlling for stroke severity. Initial plasma α-MSH was not predictive of early poststroke infection in either univariate analyses or analyses controlling for covariates (data not shown).

    Table 1. Correlations Among α-MSH, ACT, Cortisol, Infarct Volume, and Stroke Severity at 24 Hours and 72 Hours After Stroke Onset

    VariableInfarct Volume*UncorrectedCorrected for NIHSSNIHSSACTHCortisolIL-6ACTHCortisolIL-6
    a-MSH








        24 h
    −0.148, NS
    −0.479, P=0.010
    −0.127, NS
    −0.501, P=0.025
    −0.238, NS
    −0.181, NS
    −0.256, NS
    0.281, NS
        72 h
    −0.247, P=0.014
    −0.241, P=0.016
    −0.139, P=0.181
    −0.115, NS
    −0.209, P=0.042
    −0.102, NS
    0.042, NS
    −0.068, NS
    Cortisol








        24 h
    0.498, P=0.007
    0.728, P<0.001
    0.304, P=0.132

    0.378, P=0.100
    0.496, P=0.014

    −0.237, NS
        72 h
    0.420, P<0.001
    0.616, P<0.001
    0.346, P<0.001

    0.535, P<0.001
    0.358, P<0.001

    0.325, P=0.002
    ACTH








        24 h
    0.069, NS
    −0.068, NS


    −0.124, NS


    −0.118, NS
        72 h
    0.138, P=0.161
    0.127, P=0.193


    0.133, P=0.197


    0.057, NS
    IL-6








        24 h
    0.517, P=0.006
    0.700, P<0.001






        72 h
    0.393, P<0.001
    0.566, P<0.001





    Given the significant relationship between stroke severity and α-MSH, cortisol, and IL-6, correlations corrected for stroke severity (using the NIHSS score as a continuous variable) are also presented. Data are normalized and presented as Pearson's r.

    MSH indicates melanocyte stimulating hormone; ACTH, adrenocorticotrophic hormone; IL, interleukin; NIHSS, National Institutes of Health Stroke Scale; NS, not significant (P≥0.200).

    *Infarct volume is not available for 3 persons.

    Table 2. Differences Between Initial Plasma α-MSH Concentrations (pg/mL) Based on Clinical and Demographic Variables

    Patient CharacteristicsVariablesUnadjusted PAdjusted for Stroke Severity P
    Sex
    Yes
    No


        Female
    12.2 (6.1–20.5), N=39
    11.6 (1.8–17.6), N=72
    NS
    NS
    Ethnicity
    Yes
    No


        White
    11.6 (1.9–17.9), N=100
    13.3 (10.5–45.8), N=11
    0.140
    0.076
    Medical history
    Yes
    No


        AF
    16.1 (9.9–27.9), N=16
    11.5 (1.9–15.8), N=95
    0.080
    0.165
        CHD
    12.3 (4.7–23.5), N=26
    11.4 (2.0–17.0), N=85
    NS
    NS
        DM
    13.5 (0.6–22.8), N=27
    11.6 (4.3–15.5), N=84
    NS
    0.154
        HTN
    12.5 (0.5–21.4), N=59
    11.0 (6.1–17.1), N=52
    NS
    NS
        Smoker
    10.2 (0.6–14.3), N=43
    12.6 (4.7–18.7), N=68
    0.123
    NS
        Previous stroke (on imaging)*
    13.0 (0.2–22.3), N=26
    11.6 (3.7–18.0), N=82
    NS
    NS
    Oxfordshire Stroke Classification
    Yes



        TACS (N=17)
    7.4 (0.3–11.4)

    0.050
    0.072
        PACS (N=62)
    11.8 (3.7–19.3)



        LACS (N=10)
    12.5 (6.6–13.7)



        POCS (N=22)
    15.4 (6.6–30.2)



    Stroke therapy
    Yes
    No


        IV tPA
    10.5 (3.7–17.3), N=26
    11.8 (2.0–18.2), N=85
    NS
    NS
        Endovascular intervention
    12.4 (0.5–29.7), N=15
    11.8 (2.6–17.4), N=96
    NS
    0.075
        Hemicraniectomy
    7.4 (0.2–10.8), N=9
    12.3 (4.3–19.3), N=102
    0.015
    NS
    Stroke complications
    Yes
    No


        Infection within 15 d
    10.7 (0.4–13.9), N=26
    12.5 (4.3–19.7), N=85
    0.112
    NS
        PNA within 15 d
    9.8 (0.3–16.7), N=12
    11.8 (4.4–18.4), N=99
    0.198
    NS

    Statistics are by Mann-Whitney U test or Kruskal-Wallis H test and are either unadjusted or adjusted for stroke severity (using the NIHSS score as a continuous variable).

    AF indicates atrial fibrillation; CHD, coronary heart disease; DM, diabetes mellitus; HTN, hypertension; TACS, total anterior circulation stroke; PACS, partial anterior circulation stroke; LACS, lacunar stroke; POCS, posterior circulation stroke; PNA, pneumonia; NIHSS, National Institutes of Health Stroke Scale; NS, not significant; IV tPA, intravenous tissue-type plasminogen activator; MSH, melanocyte stimulating hormone. α-MSH values indicate the highest α-MSH concentration within the first 72 h after stroke onset.

    *Three patients did not have MRI imaging and are not included in this analysis (P≥0.200).

    The effect of α-MSH, ACTH, cortisol, and IL-6 on early and long-term outcomes is shown in Table 3. Univariate associations between initial IL-6 and worse outcomes are seen early after stroke (1 and 3 months), but this effect seems to be related solely to stroke severity. Higher plasma cortisol is independently associated with worse outcomes at 1 month after stroke onset, but this relationship attenuates over the course of time and is lost after controlling for stroke severity and other important predictors of outcome. The effect of early plasma α-MSH concentrations on outcome was not apparent until later time points after stroke and was independent of initial stroke severity, patient age, and infection status.

    Table 3. Likelihood for a Good Outcome at Given Time Points Based on Initial Plasma α-MSH or Cortisol

    VariableModelα-MSHACTHCortisolIL-6mRS ≤3PmRS ≤3PmRS ≤3PmRS ≤3P
    1 mo, N=102
    Unadjusted
    1.355 (0.938–1.957)
    0.105
    0.852 (0.676–1.075)
    0.176
    0.169 (0.075–0.381)
    <0.001
    0.583 (0.389–0.874)
    0.009

    NIHSS
    1.031 (0.694–1.531)
    NS
    0.921 (0.688–1.232)
    NS
    0.394 (0.158–0.986)
    0.047
    0.896 (0.633–1,269)
    NS

    NIHSS+age
    1.000 (0.667–1.499)
    NS
    0.931 (0.698–1.241)
    NS
    0.389 (0.153–0.988)
    0.047
    0.915 (0.643–1.302)
    NS

    NIHSS+age+infection
    0.991 (0.657–1.494)
    NS
    0.940 (0.693–1.274)
    NS
    0.392 (0.154–0.998)
    0.049
    0.940 (0.661–1.337)
    NS
    3 mo, N=100
    Unadjusted
    2.147 (1.159–3.978)
    0.015
    0.840 (0.659–1.070)
    0.157
    0.299 (0.154–0.581)
    <0.001
    0.556 (0.375–0.825)
    0.004

    NIHSS
    1.639 (0.883–3.043)
    0.118
    0.880 (0.657–1.180)
    NS
    0.657 (0.307–1.405)
    NS
    0.755 (0.518–1.102)
    0.145

    NIHSS+age
    1.568 (0.844–2.911)
    0.154
    0.896 (0.678–1.183)
    NS
    0.664 (0.300–1.467)
    NS
    0.752 (0.503–1.123)
    0.163

    NIHSS+age+infection
    1.688 (0.859–3.319)
    0.129
    0.923 (0.682–1.248)
    NS
    0.721 (0.311–1.669)
    NS
    0.792 (0.530–1.183)
    NS
    6 mo, N=97
    Unadjusted
    5.212 (1.614–16.834)
    0.006
    0.736 (0.560–0.969)
    0.029
    0.368 (0.178–0.759)
    0.007
    0.877 (0.738–1.042)
    0.136

    NIHSS
    4.219 (1.225–14.530)
    0.023
    0.741 (0.533–1.032)
    0.076
    0.724 (0.300–1.747)
    NS
    1.033 (0.855–1.248)
    NS

    NIHSS+age
    4.236 (1.191–15.063)
    0.026
    0.729 (0.534–0.996)
    0.047
    0.662 (0.254–1.727)
    NS
    1.030 (0.852–1.246)
    NS

    NIHSS+age+infection
    5.763 (1.350–24.591)
    0.018
    0.737 (0.537–1.011)
    0.059
    0.677 (0.257–1.784)
    NS
    1.050 (0.863–1.278)
    NS
    12 mo, N=96
    Unadjusted
    4.444 (1.322–14.943)
    0.016
    0.874 (0.657–1.163)
    NS
    0.464 (0.215–1.000)
    0.050
    0.873 (0.734–1.039)
    0.125

    NIHSS
    3.551 (1.034–12.201)
    0.044
    0.922 (0.683–1.245)
    NS
    0.937 (0.355–2.473)
    NS
    1.006 (0.831–1.218)
    NS

    NIHSS+age
    3.502 (0.991–12.370)
    0.052
    0.920 (0.625–1.354)
    NS
    0.859 (0.288–2.563)
    NS
    0.998 (0.820–1.215)
    NS

    NIHSS+age+infection
    4.612 (1.087–19.572)
    0.038
    0.933 (0.630–1.381)
    NS
    0.933 (0.294–2.955)
    NS
    1.012 (0.826–1.240)
    NS

    Data are presented as the odds ratio (95% CI) per 10-pg/mL increase in plasma α-MSH, ACTH, and IL-6 concentrations or 10-μg/dL increase in cortisol concentration.

    Data show the highest plasma α-MSH, ACTH, cortisol, or IL-6 within the first 72 h after stroke.

    MSH indicates melanocyte stimulating hormone; ACTH, adrenocorticotrophic hormone; IL, interleukin; NIHSS, National Institutes of Health Stroke Scale; NS, not significant (P≥0.200); CI, confidence interval.

    Discussion

    In this study we found early and sustained elevations in both plasma cortisol (to 1 month) and IL-6 (to 6 months) among patients with severe stroke, whereas ACTH concentrations were largely unchanged and α-MSH concentrations decreased early after stroke. That elevated plasma cortisol is seen in patients with severe strokes and is associated with worse outcome is well documented.3,5,1315 Increased cortisol is considered to be a marker of the acute phase/stress response in stroke and is variably attributed to increased ACTH and/or IL-6.16,17 We found both plasma cortisol and IL-6 to be highly correlated with stroke severity and infarct volume. As might be expected, there was a correlation between plasma ACTH and cortisol, and this correlation was essentially unchanged after controlling for stroke severity. Also, similar to previous studies, we saw a correlation between IL-6 and plasma cortisol. This correlation was slightly attenuated but not lost after controlling for stroke severity, suggesting that IL-6 may drive some cortisol production independent of stroke severity and ACTH expression. Despite the common origin of α-MSH and ACTH from POMC, the plasma concentrations of these neuropeptides were not correlated after stroke, and the association between plasma α-MSH and stroke severity/infarct volume was not nearly as robust as that seen for cortisol and IL-6. Given that the half-life of α-MSH in circulation is on the order of minutes, it is possible that more significant associations between α-MSH and stroke severity were missed because of timing of blood draws.

    Despite the limitations of this study with regard to timing of blood draws, we were still able to demonstrate a decrease in plasma α-MSH among patients with severe strokes (National Institutes of Health Stroke Scale ≥17) early after stroke onset. To our knowledge, this is the first study that addresses endogenous changes in plasma α-MSH after ischemic stroke, although we did find a similar decrease in plasma α-MSH in an animal study of severe stroke.7 Further, we found that higher plasma α-MSH was associated with an increased likelihood of experiencing a good clinical outcome, an effect that was most apparent at later time points after stroke and independent of stroke severity, patient age, and infection status. In contrast, the associations between cortisol and IL-6 on outcome were most robust at early time points after stroke and explained almost entirely by the fact that cortisol and IL-6 are markers of stroke severity. The lack of an independent association among cortisol, IL-6, and stroke outcome has been documented previously.5,18

    Both the independent association of α-MSH with stroke outcome and the delay in this observed association suggest that the effect of early plasma α-MSH on outcome is more than a reflection of the stress response related to stroke severity and that maintenance of plasma α-MSH after stroke onset may be protective. Furthermore, a growing body of experimental data shows that exogenous administration of α-MSH decreases infarct volume and improves stroke outcome.7,1922 There are numerous mechanisms by which α-MSH (and related neuropeptides) could improve stroke outcome, and these effects are mediated through 5 different melanocortin receptors (MCRs). Potent antipyretic properties of α-MSH, which could potentially be capitalized on in the treatment of stroke, are mediated through the MCR3/MCR4 receptor complex in the brain.23 MCR1 is expressed by cells of the immune system and is responsible for mediating the robust anti-inflammatory and immunomodulatory properties of α-MSH, which include the prevention of T-helper 1 responses and the induction of T regulatory responses to selected antigens.2427 Given the effect of α-MSH on the immune response, it is not surprising that it has been shown to improve outcome in animal models of experimental allergic encephalomyelitis.28,29 We also found that α-MSH administration decreased infarct volume and improved neurological outcome 24 hours after transient middle cerebral artery occlusion in an animal model of stroke.7 Consistent with the known effects of α-MSH on the immune response, we found that splenocytes harvested from α-MSH–treated animals responded less well to phytohemagglutinin (a lymphocyte mitogen) than splenocytes harvested from saline-treated animals. Furthermore, the animals treated with α-MSH in this study were less likely to develop autoimmune responses to myelin basic protein, a response associated with worse stroke outcome.30,31 Finally, α-MSH has neurotrophic properties that could aid in stroke recovery.3237 At least some of these neurotrophic effects appear to be mediated by MCR4.36,37 These effects of α-MSH, along with the immunomodulatory effects, may help to explain why delayed administration of α-MSH can improve outcome and why the association between early α-MSH and stroke outcome is not apparent until later time points.20,3739

    α-MSH is an attractive candidate for stroke therapy given its multiplicity of actions and the possibility that delayed administration may still be of therapeutic value. The attractiveness of α-MSH as a therapeutic agent is further enhanced by its potential ease of administration; MSH-related neuropeptides are absorbed through the nasal mucosa rapidly after inhalation.40 In addition to exogenous administration of the neuropeptide, plasma α-MSH concentrations could be augmented by strategies that favor α-MSH processing from POMC/ACTH (ie, enhancing PC2 activity). The potent immunomodulatory properties of α-MSH, however, suggest the possibility that this peptide could predispose to infection, a complication that was seen in an animal model of stroke.41 In the current study, however, we did not find an independent association between α-MSH and infection risk. Furthermore, we did not see infectious complications related to α-MSH administration in our animal model of stroke.7

    Limitations of this study include the lack of tightly controlled timing of blood draws early after stroke onset. The median time from stroke onset to the “24-hour” blood draw was 28 hours (N=30), whereas the median time from stroke onset to the “72-hour” blood draw was 68 hours (N=101). It is certainly possible that rapid changes in plasma α-MSH were missed by this sampling protocol. For the logistic regression, we chose to use the highest α-MSH (ACTH, cortisol, and IL-6) in the first 72 hours of stroke onset to increase statistical power (if only the 72-hour values are used, the results are similar but not quite as robust). To better address dynamic changes in α-MSH after stroke, future studies will need to enroll patients as soon as possible after stroke onset and perform frequent assays for both α-MSH and related neuropeptide. Another limitation of this study is the fact that the statistics were not corrected for multiple comparisons; results should, therefore, be interpreted as hypothesis generating.

    In summary, decreased plasma α-MSH is seen early after stroke onset in patients with severe stroke. In addition, higher concentrations of plasma α-MSH are independently associated with better stroke outcome. These data, along with a robust body of experimental data, suggest that strategies to increase α-MSH may be a viable therapeutic intervention for the treatment of acute ischemic stroke and should be further investigated.

    Sources of Funding

    This work was supported in part by NINDSR01NS049197.

    Disclosures

    None.

    Footnotes
    Correspondence to Kyra Becker,
    Box 359775, Harborview Medical Center, 325 9th Ave, Seattle, WA 98104-2499
    . E-mail k...@uw.edu


    Uhohinc

    unread,
    Nov 19, 2021, 9:52:22 PM11/19/21
    to Clinuvel Afamelanotide SCENESSE senescence CUV ASX.CUV CLVLY ur9
    Excuse me, but IMHO all this discussion about N=3 and 2 out of three is kind of idle. N always gives the size of the statistical universe of the sample you draw. Whether 2 out of three or three out of three patients or 3 out of 6 patients not really has any statistical significance and shoud be called anything else but clinical trial. It is an experiment following the "fail early" philosophy in drug development. The "endpoints" for success of this are that no patient has been killed by the treatment. If really some show slight improvment (as to my understanding this is the case here), this is the basis to get ethical approval for starting a real clinical trial with a way larger population. And this will cost money and time.

    Uhohinc

    unread,
    Mar 24, 2022, 1:30:50 PM3/24/22
    to Clinuvel Afamelanotide SCENESSE senescence CUV ASX.CUV CLVLY ur9
    Supporting data for Neuroprotective role of α-Melanocyte-stimulating hormone on ischemia/reperfusion-induced brain and retinal damage in type 1 diabetic mouse
    CiteDownload all (3.31 GB)ShareEmbed+ Collect
    Persons with type 1 diabetes have an increased risk of stroke compared with the general population. Because vision loss is frequently connected with stroke, it is essential to find a strategy that effectively preserves vision by protecting retina in addition to the brain. α-Melanocyte-stimulating hormone (α-MSH) is a neuropeptide that has protective effects against ischemia/reperfusion (I/R) induced organ damages. In this study, we aimed to investigate the neuroprotective role of α-MSH on I/R-induced brain and retinal damages after experimental stroke associated with hyperglycemia using C57BL/6J Ins2Akita/+ mice. Experimental stroke was induced by blocking the right middle cerebral artery (MCA) for 2 h with reperfusion for 2 h and 22 h, respectively using the intraluminal method. Since the opening of ophthalmic artery is proximal to the origin of the MCA, blood supply to the retina was also blocked by the filament. Animals were treated intraperitoneally with or without α-MSH at 1 h after ischemia and 1 h after reperfusion. Significantly higher percent survival and lower neurological scores were recorded in animals injected with α-MSH. Similarly, neuron death, glial cells activation as well as oxidative and nitrosative stress were significantly decreased in the α-MSH-treated brains. Relative intensities of matrix metallopeptidases 9, cyclooxygenase 2 and nuclear factor-κB were significantly decreased while intensities of Akt, heme oxygenase (HO) 1, HO-2 and B-cell lymphoma 2 were significantly increased in α-MSH treated brain. In addition, gene expressions of monocarboxylate transporter (MCT) 1, MCT-2 and activity-regulated cytoskeleton-associated protein were significantly higher in brain samples treated with α-MSH, suggesting an involvement of lactate metabolism in α-MSH neuroprotective effects. In the retina, α-MSH significantly increased the amplitude of b-wave as well as oscillatory potentials in electroretinogram, a measure of retinal function. α-MSH also prevented I/R-induced histological alterations and inhibited the development of retinal swelling. Loss of retinal ganglion cells as well as oxidative stress were significantly attenuated in α-MSH-treated diabetic retina after I/R injury. Expression of interleukin 10 was significantly increased in the retina after α-MSH treatment. In addition, gene expression of MCT-1, MCT-2 and glutamate aspartate transporter 1 were significantly higher after α-MSH administration. In conclusion, α-MSH is neuroprotective under hyperglycemic condition against I/R-induced brain and retinal damage by its anti-inflammatory, anti-oxidative and anti-apoptotic properties. These effects of α-MSH may have important therapeutic implication against cerebral and retinal I/R injury under hyperglycemic condition.
    HISTORY
    23.03.2022 - First online date, Posted date

    Uhohinc

    unread,
    May 4, 2022, 3:15:46 AM5/4/22
    to Clinuvel Afamelanotide SCENESSE senescence CUV ASX.CUV CLVLY ur9
    Executive Summary
    • afamelanotide evaluated as safe in mild to moderate arterial ischaemic stroke (NIHSS 1–15, n=6)
    • NIHSS1 scores improved in five patients
    • brain scans (MRI-FLAIR2) in all patients show reduction of affected tissue
    • strong functional recovery in all five surviving patients

    CLINUVEL today released positive final results of the open label pilot study (CUV801) in arterial ischemic stroke (AIS), evaluating multiple doses of CLINUVEL’s drug afamelanotide in six adult patients. Afamelanotide was shown to be well tolerated, with five of the six patients showing considerable clinical and functional recovery up to 42 days after treatment.

    Final analyses from the CUV801 study show that surviving patients who received treatment with afamelanotide all seemed to have recovered well in the six weeks following their brain injury,” CLINUVEL’s Head of Clinical Operations, Dr Pilar Bilbao said. “Our clinical team often publicly emphasise the significance of afamelanotide as a safe drug in patients, and in this study, we obtained further data that patients with longstanding cardiovascular disease seem to tolerate afamelanotide well. The significance of these findings is of benefit to all our current and future programs.”

    Study Results CUV801

    CUV801 is the first clinical study assessing afamelanotide as a treatment for a life-threatening brain injury.

    All six patients enrolled in the study carried an increased risk of stroke due to their history of cardiovascular disease, elevated blood pressure or diabetes type II, and all suffered a stroke (blood clot) in the left half of the brain. The study was conducted at the specialist stroke unit of the Alfred Hospital in Melbourne, Australia.

    Safety was the primary endpoint of the pilot study with afamelanotide administered up to four times over ten days following the stroke. This frequency of dosing seemed not to affect patient safety, with no drug-related adverse events reported during or after the study completion. One patient with a complex cardiovascular history passed away following a second stroke on day 5, which was assessed as unrelated to afamelanotide treatment.

    Treatment efficacy was measured using computer imaging to assess the volume of the area affected by the stroke, and validated clinical assessments of function, neurological impairment, and disability.

    Analyses of the brain scans (MRI-FLAIR2) performed at days 3 and 9 showed a reduction in size of the affected area in five of the six patients.

    Figure 1 Individual patient data of brain scans (MRI-FLAIR) showing a reduction of the affected area in five of the six patients treated in CUV801.

    Analyses of the NIHSS scores1 up to day 42 indicated that all five surviving patients showed an improvement in neurological functions and reduction in overall impairment (p=0.0625). Four out of five surviving patients showed an improvement of 4 points or more on the scale, regarded as significant, and all five patients reported a clinically meaningful reduction of 3 points. Two patients were symptom free at day 42.

    The modified Rankin Scale, a non-stroke specific tool used to determine global disability, proved not sensitive enough as an instrument for the short study period.

    Figure 2 Individual NIHSS scores in five of six patients treated in the CUV801 study showed improvement in neurological functions. Two patients were symptom free at day 42.
    Addressing Unmet Medical Need in Stroke

    Ischaemic strokes account for around 85% of the estimated 15 million strokes suffered worldwide each year. Stroke is the leading cause of serious, long-term disability in the United States. Considering the staggering prevalence of stroke, the burden of post-stroke recovery and ongoing disability is of primary public health importance.

    Despite the considerable impact of strokes on individuals and society, the treatment options available, even at specialist stroke units, are tragically limited,” Dr Bilbao said. “We are seeking to prove that afamelanotide can provide a safe, effective treatment option which can improve the overall prognosis post-stroke and reduce patient disability long-term.

    The first steps are to gain comfort that the intervention with afamelanotide poses no harm to patients, while obtaining objective measures of impact of treatment on the course of the patients’ disease. With CUV801 we have achieved both these outcomes and can now pursue further studies and regulatory interactions with a degree of confidence that the drug performs as expected.

    The gain for stroke patients, but also for society as a whole, lies in the improvement in neurological functions, since the ability to resume independent living saves high costs to our healthcare systems,” Dr Bilbao said.

    - End -
    1. The National Institutes of Health Stroke Scale (NIHSS) consists of 15 tests to evaluate neurologic functioning and impairment caused by acute cerebral infarction (stroke). A clinical assessment is made on the basis of consciousness, language, neglect, visual-field loss, extraocular movement, motor strength, muscle control, speech, and sensory loss. A trained clinician assesses the patient’s ability to answer questions and perform specific activities. In general, the evaluation is made in less than 10 minutes.
    2. The standard diagnosis of stroke patients is made upon hospital admission through computed tomography perfusion (CTP) images to assess the brain damage caused by the clot. The CTP holds some predictive value to assess whether further brain damage will occur if the clot persists. However, days after the stroke, brain scans are made by magnetic resonance (MRI-FLAIR) providing actual information on the extent of brain damage and recovery.
    Appendix I: CUV801 Study Design and Endpoints

    The primary objective of the study CUV801 was to evaluate the safety of patients, who were first time administered afamelanotide within 24 hours of suffering a stroke, while a secondary assessment was made of the recovery of brain tissue calculated from the volume of area affected, neurological function assessments and of the overall disability over 42 days.

    Validated evaluations were made using:

    • National Institutes of Health Stroke Scale (NIHSS)
      Evaluation of the patients’ condition through functional assessment on days 0, 1, 2, 3, 4, 7, 8 and 42.
    • Brain scans
      Brain scans (CTP and MRI-FLAIR) were made at various time intervals (day 0, 3, 9) to assess dead brain tissue and areas at risk of irreversible damage, due to an arterial clot.
    • Evaluation of disability was made using the modified Rankin Scale (mRS) (pre-stroke assessment on day 0, post-stroke assessment on days 7 and 42).
    Appendix II: Afamelanotide in Stroke

    Scientific progress has demonstrated melanocortins, including afamelanotide, provide a positive effect on the central nervous system (CNS). Afamelanotide is known to offer neuroprotection and act as a potent anti-oxidative hormone. The drug possesses further therapeutic benefits, activating vessels, reducing fluid formation, protecting critical nerve and brain tissue, and restoring the blood brain barrier (BBB: a critical defence mechanism protecting the brain). The drug therapy is thought to improve blood flow and increase the delivery of oxygen and nutrients to deprived brain tissue.

    About CLINUVEL PHARMACEUTICALS LIMITED

    CLINUVEL (ASX: CUV; ADR LEVEL 1: CLVLY; XETRA-DAX: UR9) is a global specialty pharmaceutical group focused on developing and commercialising treatments for patients with genetic, metabolic, systemic, and life-threatening, acute disorders, as well as healthcare solutions for the general population. As pioneers in photomedicine and the family of melanocortin peptides, CLINUVEL’s research and development has led to innovative treatments for patient populations with a clinical need for systemic photoprotection, DNA repair, repigmentation and acute or life-threatening conditions who lack alternatives.

    CLINUVEL’s lead therapy, SCENESSE® (afamelanotide 16mg), is approved for commercial distribution in Europe, the USA, Israel and Australia as the world’s first systemic photoprotective drug for the prevention of phototoxicity (anaphylactoid reactions and burns) in adult patients with erythropoietic protoporphyria (EPP). Headquartered in Melbourne, Australia, CLINUVEL has operations in Europe, Singapore and the USA. For more information, please go to https://www.clinuvel.com.

    SCENESSE®, PRÉNUMBRA®, and NEURACTHEL® are registered trademarks of CLINUVEL.

    Authorised for ASX release by the Board of Directors of CLINUVEL PHARMACEUTICALS LTD

    Media Enquiries

    Monsoon Communications
    Mr Rudi Michelson, 61 411 402 737, ru...@monsoon.com.au

    Head of Investor Relations

    Mr Malcolm Bull, CLINUVEL PHARMACEUTICALS LTD

    Investor Enquiries

    https://www.clinuvel.com/investors/contact-us


    Message has been deleted

    Uhohinc

    unread,
    Jul 28, 2023, 2:08:25 AM7/28/23
    to Clinuvel Afamelanotide SCENESSE senescence CUV ASX.CUV CLVLY ur9

    A feasibility and safety study of afamelanotide in acute stroke patients –
    an open label, proof of concept, phase iia clinical trial

    - Vimal Stanislaus
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#auth-Vimal-Stanislaus-Aff1-Aff2>
    ,
    - Anthony Kam
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#auth-Anthony-Kam-Aff2>
    ,
    - Lily Murphy
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#auth-Lily-Murphy-Aff2>
    ,
    - Philippe Wolgen
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#auth-Philippe-Wolgen-Aff3>
    ,
    - Gill Walker
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#auth-Gill-Walker-Aff3>
    ,
    - Pilar Bilbao
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#auth-Pilar-Bilbao-Aff3>
    &
    - Geoffrey C Cloud
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#auth-Geoffrey_C-Cloud-Aff1-Aff2>


    *BMC Neurology* <https://bmcneurol.biomedcentral.com/> volume 23,
    Article number: 281 (2023) Cite this article
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#citeas>

    -

    15 Accesses
    -

    3 Altmetric
    -

    Metricsdetails
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9/metrics>

    Abstract
    Background

    Neuroprotective agents have the potential to improve the outcomes of
    revascularisation therapies in acute ischemic stroke patients (AIS) and in
    those unable to receive revascularisation. Afamelanotide, a synthetic
    α-melanocyte stimulating hormone analogue, is a potential novel
    neuroprotective agent. We set out to assess the feasibility and safety of
    afamelanotide for the first time in AIS patients.
    Methods

    AIS patients within 24 h of onset, with perfusion abnormality on imaging
    (Tmax) and otherwise ineligible for revascularisation therapies were
    enrolled. Afamelanotide 16 mg implants were administered subcutaneously on
    Day 0 (D0, day of recruitment), D1 and repeated on D7 and D8, if not well
    recovered. Treatment emergent adverse events (TEAEs) and neurological
    assessments were recorded regularly up to D42. Magnetic resonance imaging
    (MRI) with FLAIR sequences were also performed on D3 and D9.
    Results

    Six patients (5 women, median age 81, median NIHSS 6) were recruited. Two
    patients received 4 doses and four patients received 2. One patient (who
    received 2 doses), suffered a fatal recurrent stroke on D9 due to a known
    complete acute internal carotid artery occlusion, assessed as unrelated to
    the study drug. There were no other local or major systemic TEAEs recorded.
    In all surviving patients, the median NIHSS improved from 6 to 2 on D7. The
    median Tmax volume on D0 was 23 mL which was reduced to a FLAIR volume of
    10 mL on D3 and 4 mL on D9.
    Conclusions

    Afamelanotide was well tolerated and safe in our small sample of AIS
    patients. It also appears to be associated with good recovery and
    radiological improvement of salvageable tissue which needs to be tested in
    randomized studies.
    ClinicalTrials.gov Identifier

    NCT04962503, First posted 15/07/2021.

    Peer Review reports
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9/peer-review>
    Introduction

    Stroke is a leading cause of mortality and morbidity worldwide [1
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR1>].
    Acute ischemic stroke (AIS) accounts for 85% of all strokes and is commonly
    associated with thrombotic obstruction in cerebral blood vessels causing
    reduced blood flow to the affected part of the brain and cerebral ischemia.
    Ischemia disrupts the blood brain barrier (BBB) by activating proteinases
    such as matrix metalloproteinases (MMPs) and altering proteins in the BBB
    tight junction such as integrins. This triggers a cascade of inflammatory
    reactions causing further damage to the ischemic tissue.

    Current revascularisation therapies in AIS include thrombolysis and
    endovascular clot retrieval. They are aimed at removing the thrombotic
    obstruction and retaining blood flow to the ischemic tissue but cannot
    prevent injury to the BBB or inflammatory reactions. They are also
    restricted by several limitations. Both are time dependent, limited by
    patient selection, need specially trained professional and available only
    in selected centres. Only about 10–20% of AIS patients would qualify for
    these therapies and of those only 30–40% of patients will achieve
    functional independence [2
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR2>
    ].

    Neuroprotective agents reduce inflammation, may repair or minimise the
    damage to the BBB and thus can protect neurons. They also have the
    potential not only to improve the eligibility but also the outcomes of
    stroke revascularisation therapies and in those unable to receive
    revascularisation. However, despite more than 1000 pre-clinical studies and
    over 200 clinical trials, no effective neuroprotective agent has been found
    [3
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR3>
    ,4
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR4>
    ,5
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR5>
    ,6
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR6>].
    Animals used in most of these studies lack the heterogeneity seen in stroke
    patients. In addition to that, only few of these agents were tested in
    acute stroke.

    The neuropeptide hormones α-melanocyte stimulating hormone (α-MSH) and
    melanocortin are favourably implicated in AIS for their neuroprotective
    effects and strong anti-inflammatory properties [7
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR7>
    ,8
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR8>
    ,9
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR9>
    ,10
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR10>].
    Animal studies have shown that α-MSH levels rapidly decrease following
    arterial occlusion in AIS [11
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR11>].
    Patients with acute brain injuries including AIS and traumatic brain injury
    have also been found to have decreased α-MSH levels [12
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR12>].
    Lower α-MSH levels post AIS were associated with severe stroke and worse
    outcomes while higher α-MSH levels were associated with good long term
    outcomes [10
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR10>
    , 12
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR12>].
    Multiple animal studies have shown that exogenous α-MSH provides long
    lasting protection against ischemia, decreases infarct volume and improves
    stroke outcomes [11
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR11>
    , 13
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR13>
    ,14
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR14>
    ,15
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR15>
    ,16
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR16>
    ,17
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR17>
    ].

    Afamelanotide is a synthetic, highly potent, non-selective agonist of α-MSH
    analogue, currently licenced for erythropoietic protoporphyria (EPP). Ample
    evidence is available from clinical studies that it is generally safe and
    well tolerated [18
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR18>
    , 19
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR19>].
    Existing animal studies on administration of α-MSH analogue post AIS
    suggests that the anti-inflammatory and neuroprotective responses of
    melanocortins are dose dependent. Improvement in functional recovery and
    decrease in infarct volume were seen when α-MSH was given early post stroke
    and at higher doses [11
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR11>
    , 14
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR14>
    , 15
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR15>].
    Due to the short half life of α-MSH, repeating the dose in the initial days
    following AIS has also been suggested [11
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR11>].
    However, its safety in AIS patients has never been tested before and thus
    its potential neuroprotective effects in AIS patients is currently not
    known.

    The aim of this study was to assess the feasibility and safety of
    afamelanotide for the first time in AIS patients. The hypothesis was that
    afamelanotide would positively affect the infarcted area (core) and the
    ischaemic zone of tissue (penumbra) in patients with AIS, with no major
    adverse effects. Validating the safety of afamelanotide in AIS patients
    would set the course for larger trials to test its neuroprotective
    properties in AIS patients.
    Materials and methods
    Study design and patient population

    This was a single centre, industry sponsored (CLINUVEL Pharmaceuticals),
    open label, non-randomised, prospective design, phase IIa trial of
    afamelanotide. The study was reviewed and approved by our Institutional
    Review Board (HREC/68,070/Alfred-2020). Eligible patients were older than
    18 with limited functional disability at baseline (premorbid modified
    Rankin scale (mRS) < 4); had a diagnosis of first AIS; presented within
    24 h of onset of symptoms; had a distal arterial vessel occlusion and
    relevant perfusion mismatch confirmed on imaging. Patients who underwent
    acute revascularisation therapies, pregnant, lactating, allergic to
    melanocortins, with severe hepatic or renal impairment or inability to
    undergo CT or MRI scans were excluded.
    Study drug

    Afamelanotide 16 mg, controlled release, sterile formulation contained in a
    poly D,L-lactide-co-glycolide implant (SCENESSE®) was administered
    subcutaneously via an injection into the fat above the anterior portion of
    the iliac crest. First dose was administered on the day of recruitment (D0)
    and second dose was administered 24 h later (D1). The drug was administered
    again on D7 and D8, when the patient’s neurological deficits still
    persisted.
    Imaging assessments

    Computed tomography (CT) of the brain followed by CT angiography from
    aortic arch to the vertex and CT perfusion was performed on D0. Automated
    perfusion maps (RAPID) were used to measure the core and penumbra (Tmax).
    Magnetic resonance imaging (MRI) with DWI and FLAIR sequences was performed
    on D3 and D9. The volume of hyperintense lesion on FLAIR sequences was
    measured by a prediction algorithm using an open source toolbox which has
    high reproducibility compared to expert manual lesion marking [20
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR20>
    ].
    Outcome measures

    The primary outcome was the safety of afamelanotide in AIS patients as
    assessed by monitoring and recording of treatment-emergent adverse events
    (TEAEs), recorded regularly up to D42. The secondary outcome was the signal
    of efficacy as assessed clinically by using the standardised National
    Institutes of Health Stroke Scale (NIHSS) up to D42 and radiologically by
    measuring the changes in the volumes of Tmax and FLAIR lesions.
    Results

    Five women and one man, with a median age of 81, all with pre-morbid mRS < 
    2, were recruited for the study over a period of ten months (Fig. 1
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#Fig1>).
    All patients had distal vessel occlusion in the middle cerebral artery and
    one patient also had a further occlusion in the distal posterior cerebral
    artery. The median NIHSS was 6 at point of study entry. The aetiology was
    cardioembolic in three patients, and embolic stroke of undetermined source
    in one patient. Two patients had internal carotid artery atherosclerosis,
    one with severe stenosis and one with complete occlusion. All patients
    received single doses of study drug on D0 and D1 and two patients had
    further doses on D7 and D8. The median time to treatment from stroke onset
    was 20 h.
    Fig. 1
    [image: figure 1]
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9/figures/1>

    Consort diagram depicting the recruitment process
    Full size image
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9/figures/1>
    Safety

    None had immediate local or major systemic TEAEs (Table 1
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#Tab1>).
    One patient had an asymptomatic, haemorrhagic transformation within the
    infarcted tissue which was assessed as Class 1c, and type PH1 (parenchymal
    haematoma) as per Heidelberg classification. Other TEAEs included urinary
    tract infection and constipation. All TEAEs were assessed as unrelated to
    afamelanotide and treated accordingly.
    Table 1 Baseline demographics and adverse outcomes
    Full size table
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9/tables/1>

    One patient who had complete carotid occlusion and NIHSS of 1 on D0
    suffered a recurrent ischemic stroke on D5 with an increase in NIHSS to 13.
    Repeated imaging showed propagation of distal M2 thrombus proximally to M1,
    resulting in long segment MCA occlusion and associated new infarction, with
    subsequent fatal haemorrhagic transformation (Class 2, PH2) on D9. This
    patient received only two doses of study drug, on D0 and D1. The recurrent
    stroke was assessed as unrelated to the study drug.
    Efficacy Signal

    The median NIHSS of all surviving patients was improved from 6 on D0 to 2
    on D7 and to 1 on D42 (Table 2
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#Tab2>).
    On D42, all patients were living at home and functionally independent with
    an mRS < 3.
    Table 2 Stroke deficits as assessed by NIHSS
    Full size table
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9/tables/2>

    Single slice samples of Tmax images on D0 and FLAIR sequences on D3 and D9
    for 2 patients, showing progressive reduction in acute lesions, is shown in
    Fig. 2
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#Fig2>.
    Overall, four patients showed a reduction in FLAIR volume on D3 compared to
    the Tmax volume on D0 while two patients had increased FLAIR volume on D3
    (Fig. 3
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#Fig3>).
    The median Tmax volume on D0 was 23 mL which was reduced to a FLAIR volume
    of 10 mL on D3 and 4 mL on D9.
    Fig. 2
    [image: figure 2]
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9/figures/2>

    Tmax images on D0 (a) with relevant DWI (b) and FLAIR lesions on D3 (c) and
    FLAIR lesions on D9 (d) from patients 1 and 5
    Full size image
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9/figures/2>
    Fig. 3
    [image: figure 3]
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9/figures/3>

    Comparison of Tmax and FLAIR volumes for all patients
    Full size image
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9/figures/3>
    Discussion

    Our phase IIa clinical trial shows that administration of afamelanotide
    16 mg implant in AIS patients is safe and well tolerated. This is the first
    time afamelanotide has been evaluated in AIS patients. Afamelanotide also
    appears to be associated with meaningful neurological recovery and
    radiological improvement of salvageable tissue.

    None of our patients had any serious adverse drug reactions. Minor,
    transient adverse events where present, were considered to be likely
    unrelated to afamelanotide. The minor adverse events were also very
    different between patients, suggesting afamelanotide was an unlikely cause.
    Afamelanotide is currently licenced in United States, Europe and Australia
    for treatment of EPP. Post marketing surveillance over several years has
    confirmed the positive safety profile of afamelanotide with no significant
    drug related adverse effects [18
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR18>
    , 21
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR21>
    , 22
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR22>].
    Implant site reaction and nausea were the most common side effects with
    incidence rate of up to 21% [23
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR23>
    ].

    Four of six patients showed reduction in the radiological measurements of
    infarct core on D3 and all surviving patients showed improvement in NIHSS
    at 42 days. Although the measurements of CT perfusion on D0 and MRI-FLAIR
    on D3 are not directly comparable, the direction and magnitude of reduction
    in infarct core volume was clearly evident. A repeat CT perfusion on D3
    would risk unnecessary radiation and contrast related adverse effects while
    an MRI on D0 is not always practical. The reduction in core volume was also
    despite of a median time to treatment from stroke onset of 20 h.
    Neuroprotective agents are likely to result in better outcomes when given
    early in the process of ischemic damage and inflammation. However our data
    suggest that even at a median of 20 h, afamelanotide may provide benefit. A
    broad therapeutic window and longer lasting treatment effect with α-MSH
    hormone on AIS had been demonstrated in animal studies [15
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR15>
    , 24
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR24>
    ].

    The benefit of afamelanotide in AIS is likely due to its neuroprotective
    properties on the BBB. Neuroprotective agents, targeting tight junctions of
    BBB may confer vascular protection during AIS and other brain injuries [16
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR16>
    , 25
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR25>
    , 26
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR26>].
    Administration of α-MSH has been shown to restore the integrity of BBB in
    neuroinflammatory disorders [27
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR27>].
    The neuroprotective benefits of afamelanotide in AIS have also been tested
    in animal studies previously and showed reduction in final infarct volume [
    13
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR13>
    , 24
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR24>
    ].

    Afamelanotide may also have positive effects on AIS and other brain
    injuries through a direct neuromodulatory and neurotropic effect on
    melanocortin receptors [11
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR11>
    , 28
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR28>
    ] giving it an unique multi-modal action in AIS. Current evidence shows
    that plasma α-MSH levels decrease following severe AIS and other acute
    brain injuries [10
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR10>
    ,11
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR11>
    ,12
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR12>]
    and that exogenous administration of α-MSH following AIS improve stroke
    outcomes [11
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR11>].
    Maintenance of plasma α-MSH after stroke may therefore not only be
    protective to the penumbra and BBB but can also enhance neuroplasticity
    mechanisms, and thus can extend the time window for treatment effect [11
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR11>
    , 16
    <https://bmcneurol.biomedcentral.com/articles/10.1186/s12883-023-03338-9#ref-CR16>
    ].
    Strengths and limitations

    Our study is the first ever that applied afamelanotide in AIS patients. The
    patient population was highly characterised based on strict inclusion
    criteria and multimodal CT imaging. All the patients were treated under
    24 h.

    Limitations in this study include a small study population with gender
    disproportion. Although no serious adverse reactions were encountered in
    this small phase IIa feasibility study, a larger sample size is required to
    draw reliable conclusions regarding afamelanotide’s safety and signal of
    efficacy. All our patients had NIHSS less than 9, suggesting mild to
    moderate stroke. It can be argued that the changes seen in NIHSS with time
    was likely due to the natural recovery from stroke, however this may not
    explain the radiological changes and randomized placebo controlled trials
    are warranted.

    In summary, afamelanotide was safe, well tolerated and showed possible
    reduction in infarct core volume in our safety and feasibility study
    involving small sample of AIS patients. Potent MSH analogues such as
    afamelanotide have high therapeutic potential in AIS. Further large,
    randomized studies are required.
    Data Availability

    All data generated or analysed during this study are included in this
    published article.
    References

    1.

    Feigin VL, Stark BA, Johnson CO, Roth GA, Bisignano C, Abady GG, et al.
    Global, regional, and national burden of stroke and its risk factors,
    1990–2019: a systematic analysis for the global burden of Disease Study
    2019. Lancet Neurol. 2021;20(10):795–820.

    Article <https://doi.org/10.1016%2FS1474-4422%2821%2900252-0> CAS
    <https://bmcneurol.biomedcentral.com/articles/cas-redirect/1:CAS:528:DC%2BB3MXisVClsb3F>
    Google Scholar
    <http://scholar.google.com/scholar_lookup?&title=Global%2C%20regional%2C%20and%20national%20burden%20of%20stroke%20and%20its%20risk%20factors%2C%201990%E2%80%932019%3A%20a%20systematic%20analysis%20for%20the%20global%20burden%20of%20Disease%20Study%202019&journal=Lancet%20Neurol&doi=10.1016%2FS1474-4422%2821%2900252-0&volume=20&issue=10&pages=795-820&publication_year=2021&author=Feigin%2CVL&author=Stark%2CBA&author=Johnson%2CCO&author=Roth%2CGA&author=Bisignano%2CC&author=Abady%2CGG>

    2.

    Michel P, Diepers M, Mordasini P, Schubert T, Bervini D, Rouvé JD, et
    al. Acute revascularization in ischemic stroke: updated swiss guidelines.
    Clin Translational Neurosci. 2021;5(1):1–11.

    Article <https://doi.org/10.1177%2F2514183X21999228> Google Scholar
    <http://scholar.google.com/scholar_lookup?&title=Acute%20revascularization%20in%20ischemic%20stroke%3A%20updated%20swiss%20guidelines&journal=Clin%20Translational%20Neurosci&doi=10.1177%2F2514183X21999228&volume=5&issue=1&pages=1-11&publication_year=2021&author=Michel%2CP&author=Diepers%2CM&author=Mordasini%2CP&author=Schubert%2CT&author=Bervini%2CD&author=Rouv%C3%A9%2CJD>

    3.

    O’Collins VE, Macleod MR, Donnan GA, Horky LL, van der Worp BH, Howells
    DW. 1,026 experimental treatments in acute stroke. Ann Neurol.
    2006;59(3):467–77.

    Article <https://doi.org/10.1002%2Fana.20741> PubMed
    <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=16453316>
    Google Scholar
    <http://scholar.google.com/scholar_lookup?&title=1%2C026%20experimental%20treatments%20in%20acute%20stroke&journal=Ann%20Neurol&doi=10.1002%2Fana.20741&volume=59&issue=3&pages=467-77&publication_year=2006&author=O%E2%80%99Collins%2CVE&author=Macleod%2CMR&author=Donnan%2CGA&author=Horky%2CLL&author=Worp%2CBH&author=Howells%2CDW>

    4.

    Goenka L, Uppugunduri Satyanarayana CR, George SSK. Neuroprotective
    agents in Acute ischemic Stroke—A reality check. Biomed Pharmacother.
    2019;109:2539–47.

    Article <https://doi.org/10.1016%2Fj.biopha.2018.11.041> PubMed
    <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=30551514>
    Google Scholar
    <http://scholar.google.com/scholar_lookup?&title=Neuroprotective%20agents%20in%20Acute%20ischemic%20Stroke%E2%80%94A%20reality%20check&journal=Biomed%20Pharmacother&doi=10.1016%2Fj.biopha.2018.11.041&volume=109&pages=2539-47&publication_year=2019&author=Goenka%2CL&author=Uppugunduri%20Satyanarayana%2CCR&author=George%2CSSK>

    5.

    Green AR. Pharmacological approaches to acute ischaemic stroke:
    reperfusion certainly, neuroprotection possibly: pharmacological approaches
    to acute ischaemic stroke. Br J Pharmacol. 2008;153(S1):325–38.

    Article <https://doi.org/10.1038%2Fsj.bjp.0707594> Google Scholar
    <http://scholar.google.com/scholar_lookup?&title=Pharmacological%20approaches%20to%20acute%20ischaemic%20stroke%3A%20reperfusion%20certainly%2C%20neuroprotection%20possibly%3A%20pharmacological%20approaches%20to%20acute%20ischaemic%20stroke&journal=Br%20J%20Pharmacol&doi=10.1038%2Fsj.bjp.0707594&volume=153&issue=S1&pages=325-38&publication_year=2008&author=Green%2CAR>

    6.

    Ginsberg MD. Neuroprotection for ischemic stroke: past, present and
    future. Neuropharmacology. 2008;55(3):363–89.

    Article <https://doi.org/10.1016%2Fj.neuropharm.2007.12.007> CAS
    <https://bmcneurol.biomedcentral.com/articles/cas-redirect/1:CAS:528:DC%2BD1cXhtVSit7%2FO>
    PubMed
    <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=18308347>
    PubMed Central <http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2631228> Google
    Scholar
    <http://scholar.google.com/scholar_lookup?&title=Neuroprotection%20for%20ischemic%20stroke%3A%20past%2C%20present%20and%20future&journal=Neuropharmacology&doi=10.1016%2Fj.neuropharm.2007.12.007&volume=55&issue=3&pages=363-89&publication_year=2008&author=Ginsberg%2CMD>

    7.

    Holloway PM, Durrenberger PF, Trutschl M, Cvek U, Cooper D, Orr AW, et
    al. Both MC 1 and MC 3 receptors provide Protection from Cerebral
    Ischemia-Reperfusion–Induced Neutrophil Recruitment. ATVB.
    2015;35(9):1936–44.

    Article <https://doi.org/10.1161%2FATVBAHA.115.305348> CAS
    <https://bmcneurol.biomedcentral.com/articles/cas-redirect/1:CAS:528:DC%2BC2MXhsVSmu73N>
    Google Scholar
    <http://scholar.google.com/scholar_lookup?&title=Both%20MC%201%20and%20MC%203%20receptors%20provide%20Protection%20from%20Cerebral%20Ischemia-Reperfusion%E2%80%93Induced%20Neutrophil%20Recruitment&journal=ATVB&doi=10.1161%2FATVBAHA.115.305348&volume=35&issue=9&pages=1936-44&publication_year=2015&author=Holloway%2CPM&author=Durrenberger%2CPF&author=Trutschl%2CM&author=Cvek%2CU&author=Cooper%2CD&author=Orr%2CAW>

    8.

    Holloway PM, Smith HK, Renshaw D, Flower RJ, Getting SJ, Gavins FNE. Targeting
    the melanocortin receptor system for anti-stroke therapy. Trends Pharmacol
    Sci. 2011;32(2):90–8.

    Article <https://doi.org/10.1016%2Fj.tips.2010.11.010> CAS
    <https://bmcneurol.biomedcentral.com/articles/cas-redirect/1:CAS:528:DC%2BC3MXhsFyhu74%3D>
    PubMed
    <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=21185610>
    Google Scholar
    <http://scholar.google.com/scholar_lookup?&title=Targeting%20the%20melanocortin%20receptor%20system%20for%20anti-stroke%20therapy&journal=Trends%20Pharmacol%20Sci&doi=10.1016%2Fj.tips.2010.11.010&volume=32&issue=2&pages=90-8&publication_year=2011&author=Holloway%2CPM&author=Smith%2CHK&author=Renshaw%2CD&author=Flower%2CRJ&author=Getting%2CSJ&author=Gavins%2CFNE>

    9.

    Tatro JB. Melanocortins defend their Territory: multifaceted
    neuroprotection in cerebral ischemia. Endocrinology. 2006;147(3):1122–5.

    Article <https://doi.org/10.1210%2Fen.2005-1573> CAS
    <https://bmcneurol.biomedcentral.com/articles/cas-redirect/1:CAS:528:DC%2BD28XhvFygsbs%3D>
    PubMed
    <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=16481482>
    Google Scholar
    <http://scholar.google.com/scholar_lookup?&title=Melanocortins%20defend%20their%20Territory%3A%20multifaceted%20neuroprotection%20in%20cerebral%20ischemia&journal=Endocrinology&doi=10.1210%2Fen.2005-1573&volume=147&issue=3&pages=1122-5&publication_year=2006&author=Tatro%2CJB>

    10.

    Zierath D, Tanzi P, Cain K, Shibata D, Becker K. Plasma α-melanocyte
    stimulating hormone predicts outcome in ischemic stroke. Stroke.
    2011;42(12):3415–20.

    Article <https://doi.org/10.1161%2FSTROKEAHA.111.627331> CAS
    <https://bmcneurol.biomedcentral.com/articles/cas-redirect/1:CAS:528:DC%2BC3MXhsFCisLrO>
    PubMed
    <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=21960572>
    PubMed Central <http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4133930> Google
    Scholar
    <http://scholar.google.com/scholar_lookup?&title=Plasma%20%CE%B1-melanocyte%20stimulating%20hormone%20predicts%20outcome%20in%20ischemic%20stroke&journal=Stroke&doi=10.1161%2FSTROKEAHA.111.627331&volume=42&issue=12&pages=3415-20&publication_year=2011&author=Zierath%2CD&author=Tanzi%2CP&author=Cain%2CK&author=Shibata%2CD&author=Becker%2CK>

    11.

    Savos AV, Gee JM, Zierath D, Becker KJ. α-MSH: a potential
    neuroprotective and immunomodulatory agent for the treatment of stroke. J
    Cereb Blood Flow Metab. 2011;31(2):606–13.

    Article <https://doi.org/10.1038%2Fjcbfm.2010.130> CAS
    <https://bmcneurol.biomedcentral.com/articles/cas-redirect/1:CAS:528:DC%2BC3MXhsVOmtrs%3D>
    PubMed
    <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=20700130>
    Google Scholar
    <http://scholar.google.com/scholar_lookup?&title=%CE%B1-MSH%3A%20a%20potential%20neuroprotective%20and%20immunomodulatory%20agent%20for%20the%20treatment%20of%20stroke&journal=J%20Cereb%20Blood%20Flow%20Metab&doi=10.1038%2Fjcbfm.2010.130&volume=31&issue=2&pages=606-13&publication_year=2011&author=Savos%2CAV&author=Gee%2CJM&author=Zierath%2CD&author=Becker%2CKJ>

    12.

    Magnoni S, Stocchetti N, Colombo G, Carlin A, Colombo A, Lipton JM, et
    al. α-Melanocyte-stimulating hormone is decreased in plasma of patients
    with Acute Brain Injury. J Neurotrauma. 2003;20(3):251–60.

    Article <https://doi.org/10.1089%2F089771503321532833> PubMed
    <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=12820679>
    Google Scholar
    <http://scholar.google.com/scholar_lookup?&title=%CE%B1-Melanocyte-stimulating%20hormone%20is%20decreased%20in%20plasma%20of%20patients%20with%20Acute%20Brain%20Injury&journal=J%20Neurotrauma&doi=10.1089%2F089771503321532833&volume=20&issue=3&pages=251-60&publication_year=2003&author=Magnoni%2CS&author=Stocchetti%2CN&author=Colombo%2CG&author=Carlin%2CA&author=Colombo%2CA&author=Lipton%2CJM>

    13.

    Chen G, Frøkiær J, Pedersen M, Nielsen S, Si Z, Pang Q, et al. Reduction
    of ischemic stroke in rat brain by alpha melanocyte stimulating hormone.
    Neuropeptides. 2008;42(3):331–8.

    Article <https://doi.org/10.1016%2Fj.npep.2008.01.004> CAS
    <https://bmcneurol.biomedcentral.com/articles/cas-redirect/1:CAS:528:DC%2BD1cXmvFSrsbc%3D>
    PubMed
    <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=18359516>
    Google Scholar
    <http://scholar.google.com/scholar_lookup?&title=Reduction%20of%20ischemic%20stroke%20in%20rat%20brain%20by%20alpha%20melanocyte%20stimulating%20hormone&journal=Neuropeptides&doi=10.1016%2Fj.npep.2008.01.004&volume=42&issue=3&pages=331-8&publication_year=2008&author=Chen%2CG&author=Fr%C3%B8ki%C3%A6r%2CJ&author=Pedersen%2CM&author=Nielsen%2CS&author=Si%2CZ&author=Pang%2CQ>

    14.

    Giuliani D, Leone S, Mioni C, Bazzani C, Zaffe D, Botticelli AR, et al.
    Broad therapeutic treatment window of [Nle4,
    D-Phe7]α-melanocyte-stimulating hormone for long-lasting protection against
    ischemic stroke, in mongolian gerbils. Eur J Pharmacol. 2006;538(1–3):48–56.

    Article <https://doi.org/10.1016%2Fj.ejphar.2006.03.038> CAS
    <https://bmcneurol.biomedcentral.com/articles/cas-redirect/1:CAS:528:DC%2BD28XkvVynsr0%3D>
    PubMed
    <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=16647700>
    Google Scholar
    <http://scholar.google.com/scholar_lookup?&title=Broad%20therapeutic%20treatment%20window%20of%20%5BNle4%2C%20D-Phe7%5D%CE%B1-melanocyte-stimulating%20hormone%20for%20long-lasting%20protection%20against%20ischemic%20stroke%2C%20in%20mongolian%20gerbils&journal=Eur%20J%20Pharmacol&doi=10.1016%2Fj.ejphar.2006.03.038&volume=538&issue=1%E2%80%933&pages=48-56&publication_year=2006&author=Giuliani%2CD&author=Leone%2CS&author=Mioni%2CC&author=Bazzani%2CC&author=Zaffe%2CD&author=Botticelli%2CAR>

    15.

    Giuliani D, Mioni C, Altavilla D, Leone S, Bazzani C, Minutoli L, et al.
    Both early and delayed treatment with melanocortin 4 receptor-stimulating
    Melanocortins produces neuroprotection in cerebral ischemia. Endocrinology.
    2006;147(3):1126–35.

    Article <https://doi.org/10.1210%2Fen.2005-0692> CAS
    <https://bmcneurol.biomedcentral.com/articles/cas-redirect/1:CAS:528:DC%2BD28XhvFygsbg%3D>
    PubMed
    <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=16254026>
    Google Scholar
    <http://scholar.google.com/scholar_lookup?&title=Both%20early%20and%20delayed%20treatment%20with%20melanocortin%204%20receptor-stimulating%20Melanocortins%20produces%20neuroprotection%20in%20cerebral%20ischemia&journal=Endocrinology&doi=10.1210%2Fen.2005-0692&volume=147&issue=3&pages=1126-35&publication_year=2006&author=Giuliani%2CD&author=Mioni%2CC&author=Altavilla%2CD&author=Leone%2CS&author=Bazzani%2CC&author=Minutoli%2CL>

    16.

    Bitto A, Polito F, Irrera N, Calò M, Spaccapelo L, Marini HR, et al.
    Protective effects of melanocortins on short-term changes in a rat model of
    traumatic brain injury*. Crit Care Med. 2012;40(3):945–51.

    Article <https://doi.org/10.1097%2FCCM.0b013e318236efde> CAS
    <https://bmcneurol.biomedcentral.com/articles/cas-redirect/1:CAS:528:DC%2BC38Xis1OmtLk%3D>
    PubMed
    <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=22036855>
    Google Scholar
    <http://scholar.google.com/scholar_lookup?&title=Protective%20effects%20of%20melanocortins%20on%20short-term%20changes%20in%20a%20rat%20model%20of%20traumatic%20brain%20injury%2A&journal=Crit%20Care%20Med&doi=10.1097%2FCCM.0b013e318236efde&volume=40&issue=3&pages=945-51&publication_year=2012&author=Bitto%2CA&author=Polito%2CF&author=Irrera%2CN&author=Cal%C3%B2%2CM&author=Spaccapelo%2CL&author=Marini%2CHR>

    17.

    Forslin Aronsson Ã, Spulber S, Popescu LM, Winblad B, Post C, Oprica M,
    et al. α-Melanocyte-stimulating hormone is neuroprotective in rat global
    cerebral ischemia. Neuropeptides. 2006;40(1):65–75.

    Article <https://doi.org/10.1016%2Fj.npep.2005.10.006> CAS
    <https://bmcneurol.biomedcentral.com/articles/cas-redirect/1:CAS:528:DC%2BD28XhslyltLk%3D>
    PubMed
    <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=16414116>
    Google Scholar
    <http://scholar.google.com/scholar_lookup?&title=%CE%B1-Melanocyte-stimulating%20hormone%20is%20neuroprotective%20in%20rat%20global%20cerebral%20ischemia&journal=Neuropeptides&doi=10.1016%2Fj.npep.2005.10.006&volume=40&issue=1&pages=65-75&publication_year=2006&author=Forslin%20Aronsson%2C%C3%83&author=Spulber%2CS&author=Popescu%2CLM&author=Winblad%2CB&author=Post%2CC&author=Oprica%2CM>

    18.

    Biolcati G, Marchesini E, Sorge F, Barbieri L, Schneider-Yin X, Minder EI.
    Long-term observational study of afamelanotide in 115 patients with
    erythropoietic protoporphyria. Br J Dermatol. 2015;172(6):1601–12.

    Article <https://doi.org/10.1111%2Fbjd.13598> CAS
    <https://bmcneurol.biomedcentral.com/articles/cas-redirect/1:CAS:528:DC%2BC2MXps12nsrY%3D>
    PubMed
    <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=25494545>
    Google Scholar
    <http://scholar.google.com/scholar_lookup?&title=Long-term%20observational%20study%20of%20afamelanotide%20in%20115%20patients%20with%20erythropoietic%20protoporphyria&journal=Br%20J%20Dermatol&doi=10.1111%2Fbjd.13598&volume=172&issue=6&pages=1601-12&publication_year=2015&author=Biolcati%2CG&author=Marchesini%2CE&author=Sorge%2CF&author=Barbieri%2CL&author=Schneider-Yin%2CX&author=Minder%2CEI>

    19.

    Biolcati G, Deybach JC, Hanneken S, Wilson P, Wahlin S, Varigos G et al.
    A randomized phase III trial of afamelanotide (Scenesse (R)), an agonistic
    alpha-melanocyte stimulating hormone analogue in the treatment of
    protoporphyria-induced phototoxicity. In: Br J Dermatol. 2011. p. 1143–3.
    20.

    Egger C, Opfer R, Wang C, Kepp T, Sormani MP, Spies L, et al. MRI FLAIR
    lesion segmentation in multiple sclerosis: does automated segmentation hold
    up with manual annotation? Neuroimage Clin. 2017;13:264–70.

    Article <https://doi.org/10.1016%2Fj.nicl.2016.11.020> PubMed
    <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=28018853>
    Google Scholar
    <http://scholar.google.com/scholar_lookup?&title=MRI%20FLAIR%20lesion%20segmentation%20in%20multiple%20sclerosis%3A%20does%20automated%20segmentation%20hold%20up%20with%20manual%20annotation%3F&journal=Neuroimage%20Clin&doi=10.1016%2Fj.nicl.2016.11.020&volume=13&pages=264-70&publication_year=2017&author=Egger%2CC&author=Opfer%2CR&author=Wang%2CC&author=Kepp%2CT&author=Sormani%2CMP&author=Spies%2CL>

    21.

    Wensink D, Wagenmakers MAEM, Barman-Aksözen J, Friesema ECH, Wilson JHP,
    van Rosmalen J, et al. Association of afamelanotide with improved outcomes
    in patients with erythropoietic protoporphyria in clinical practice. JAMA
    Dermatol. 2020;156(5):570.

    Article <https://doi.org/10.1001%2Fjamadermatol.2020.0352> PubMed
    <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=32186677>
    Google Scholar
    <http://scholar.google.com/scholar_lookup?&title=Association%20of%20afamelanotide%20with%20improved%20outcomes%20in%20patients%20with%20erythropoietic%20protoporphyria%20in%20clinical%20practice&journal=JAMA%20Dermatol&doi=10.1001%2Fjamadermatol.2020.0352&volume=156&issue=5&publication_year=2020&author=Wensink%2CD&author=Wagenmakers%2CMAEM&author=Barman-Aks%C3%B6zen%2CJ&author=Friesema%2CECH&author=Wilson%2CJHP&author=Rosmalen%2CJ>

    22.

    Minder AE, Barman-Aksoezen J, Schmid M, Minder EI, Zulewski H, Minder
    CE, et al. Beyond pigmentation: signs of liver protection during
    afamelanotide treatment in swiss patients with erythropoietic
    protoporphyria, an observational study. Therapeutic Adv Rare Disease.
    2021;2:1–17.

    Article <https://doi.org/10.1177%2F26330040211065453> Google Scholar
    <http://scholar.google.com/scholar_lookup?&title=Beyond%20pigmentation%3A%20signs%20of%20liver%20protection%20during%20afamelanotide%20treatment%20in%20swiss%20patients%20with%20erythropoietic%20protoporphyria%2C%20an%20observational%20study&journal=Therapeutic%20Adv%20Rare%20Disease&doi=10.1177%2F26330040211065453&volume=2&pages=1-17&publication_year=2021&author=Minder%2CAE&author=Barman-Aksoezen%2CJ&author=Schmid%2CM&author=Minder%2CEI&author=Zulewski%2CH&author=Minder%2CCE>

    23.

    Langendonk JG, Balwani M, Anderson KE, Bonkovsky HL, Anstey AV, Bissell
    DM, et al. Afamelanotide for erythropoietic protoporphyria. N Engl J Med.
    2015;373(1):48–59.

    Article <https://doi.org/10.1056%2FNEJMoa1411481> CAS
    <https://bmcneurol.biomedcentral.com/articles/cas-redirect/1:CAS:528:DC%2BC2MXht12hs7rE>
    PubMed
    <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=26132941>
    PubMed Central <http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4780255> Google
    Scholar
    <http://scholar.google.com/scholar_lookup?&title=Afamelanotide%20for%20erythropoietic%20protoporphyria&journal=N%20Engl%20J%20Med&doi=10.1056%2FNEJMoa1411481&volume=373&issue=1&pages=48-59&publication_year=2015&author=Langendonk%2CJG&author=Balwani%2CM&author=Anderson%2CKE&author=Bonkovsky%2CHL&author=Anstey%2CAV&author=Bissell%2CDM>

    24.

    Giuliani D, Leone S, Mioni C, Bazzani C, Zaffe D, Botticelli AR, et al.
    Broad therapeutic treatment window of [Nle4,
    D-Phe7]α-melanocyte-stimulating hormone for long-lasting protection against
    ischemic stroke, in mongolian gerbils. Eur J Pharmacol. 2006;538(1–3):48–56.

    Article <https://doi.org/10.1016%2Fj.ejphar.2006.03.038> CAS
    <https://bmcneurol.biomedcentral.com/articles/cas-redirect/1:CAS:528:DC%2BD28XkvVynsr0%3D>
    PubMed
    <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=16647700>
    Google Scholar
    <http://scholar.google.com/scholar_lookup?&title=Broad%20therapeutic%20treatment%20window%20of%20%5BNle4%2C%20D-Phe7%5D%CE%B1-melanocyte-stimulating%20hormone%20for%20long-lasting%20protection%20against%20ischemic%20stroke%2C%20in%20mongolian%20gerbils&journal=Eur%20J%20Pharmacol&doi=10.1016%2Fj.ejphar.2006.03.038&volume=538&issue=1%E2%80%933&pages=48-56&publication_year=2006&author=Giuliani%2CD&author=Leone%2CS&author=Mioni%2CC&author=Bazzani%2CC&author=Zaffe%2CD&author=Botticelli%2CAR>

    25.

    Wu X, Fu S, Liu Y, Luo H, Li F, Wang Y, et al. NDP-MSH binding
    melanocortin-1 receptor ameliorates neuroinflammation and BBB disruption
    through CREB/Nr4a1/NF-κB pathway after intracerebral hemorrhage in mice.
    J Neuroinflammation. 2019;16(1):192.

    Article <https://doi.org/10.1186%2Fs12974-019-1591-4> PubMed
    <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=31660977>
    PubMed Central <http://www.ncbi.nlm.nih.gov/pmc/articles/PMC6816206> Google
    Scholar
    <http://scholar.google.com/scholar_lookup?&title=NDP-MSH%20binding%20melanocortin-1%20receptor%20ameliorates%20neuroinflammation%20and%20BBB%20disruption%20through%20CREB%2FNr4a1%2FNF-%CE%BAB%20pathway%20after%20intracerebral%20hemorrhage%20in%20mice&journal=J%20Neuroinflammation&doi=10.1186%2Fs12974-019-1591-4&volume=16&issue=1&publication_year=2019&author=Wu%2CX&author=Fu%2CS&author=Liu%2CY&author=Luo%2CH&author=Li%2CF&author=Wang%2CY>

    26.

    Rinne P, Nordlund W, Heinonen I, Penttinen AM, Saraste A, Ruohonen ST,
    et al. α-Melanocyte-stimulating hormone regulates vascular NO availability
    and protects against endothelial dysfunction. Cardiovascular Res.
    2013;97(2):360–8.

    Article <https://doi.org/10.1093%2Fcvr%2Fcvs335> CAS
    <https://bmcneurol.biomedcentral.com/articles/cas-redirect/1:CAS:528:DC%2BC3sXhtFGntLk%3D>
    Google Scholar
    <http://scholar.google.com/scholar_lookup?&title=%CE%B1-Melanocyte-stimulating%20hormone%20regulates%20vascular%20NO%20availability%20and%20protects%20against%20endothelial%20dysfunction&journal=Cardiovascular%20Res&doi=10.1093%2Fcvr%2Fcvs335&volume=97&issue=2&pages=360-8&publication_year=2013&author=Rinne%2CP&author=Nordlund%2CW&author=Heinonen%2CI&author=Penttinen%2CAM&author=Saraste%2CA&author=Ruohonen%2CST>

    27.

    Mykicki N, Herrmann AM, Schwab N, Deenen R, Sparwasser T, Limmer A, et
    al. Melanocortin-1 receptor activation is neuroprotective in mouse models
    of neuroinflammatory disease. Sci Transl Med. 2016;8(362):362ra146.

    Article <https://doi.org/10.1126%2Fscitranslmed.aaf8732> PubMed
    <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=27797962>
    Google Scholar
    <http://scholar.google.com/scholar_lookup?&title=Melanocortin-1%20receptor%20activation%20is%20neuroprotective%20in%20mouse%20models%20of%20neuroinflammatory%20disease&journal=Sci%20Transl%20Med&doi=10.1126%2Fscitranslmed.aaf8732&volume=8&issue=362&publication_year=2016&author=Mykicki%2CN&author=Herrmann%2CAM&author=Schwab%2CN&author=Deenen%2CR&author=Sparwasser%2CT&author=Limmer%2CA>

    28.

    Namba K, Kitaichi N, Nishida T, Taylor AW. Induction of regulatory T
    cells by the immunomodulating cytokines alpha-melanocyte-stimulating
    hormone and transforming growth factor-beta2. J Leukoc Biol.
    2002;72(5):946–52.

    Article <https://doi.org/10.1189%2Fjlb.72.5.946> CAS
    <https://bmcneurol.biomedcentral.com/articles/cas-redirect/1:CAS:528:DC%2BD38Xpt1Sisr8%3D>
    PubMed
    <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=12429716>
    Google Scholar
    <http://scholar.google.com/scholar_lookup?&title=Induction%20of%20regulatory%20T%20cells%20by%20the%20immunomodulating%20cytokines%20alpha-melanocyte-stimulating%20hormone%20and%20transforming%20growth%20factor-beta2&journal=J%20Leukoc%20Biol&doi=10.1189%2Fjlb.72.5.946&volume=72&issue=5&pages=946-52&publication_year=2002&author=Namba%2CK&author=Kitaichi%2CN&author=Nishida%2CT&author=Taylor%2CAW>


    Download references
    <https://citation-needed.springer.com/v2/references/10.1186/s12883-023-03338-9?format=refman&flavour=references>
    Acknowledgements

    Not applicable.
    Funding

    This trial was sponsored by CLINUVEL Pharmaceuticals Ltd.
    Author information
    Authors and Affiliations

    1.

    Department of Neuroscience, Central Clinical School, Monash University,
    Melbourne, Australia

    Vimal Stanislaus & Geoffrey C Cloud
    2.

    Alfred Hospital, Melbourne, Australia

    Vimal Stanislaus, Anthony Kam, Lily Murphy & Geoffrey C Cloud
    3.

    CLINUVEL Pharmaceuticals, Melbourne, Australia

    Philippe Wolgen, Gill Walker & Pilar Bilbao

    Contributions

    GC, PW, GW, PB devised the study. VS, GC and LM involved in recruitment,
    drug administration, data collection and analysis. VS wrote the initial
    main manuscript text and prepared figures. AK assisted with imaging studies
    and measurements. All authors reviewed the manuscript.
    Corresponding author

    Correspondence to Geoffrey C Cloud <G.C...@alfred.org.au>.
    Ethics declarations
    Ethics approval and consent to participate

    The study was approved by Institutional Review Board, The Alfred Ethics
    Committee (Project no HREC/68070/Alfred-2020). Informed consent was
    obtained from all the participants in the study via approved institutional
    consent form. All the procedures were followed in accordance with the
    Declaration of Helsinki guidelines.
    Consent for publication

    Not applicable.
    Competing interests

    VS, AK, LM and GC declares no conflict of interest. GW, PB and PW are
    employees of CLINUVEL Pharmaceuticals Ltd which sponsored the study.
    Additional information
    Publisher’s Note

    Springer Nature remains neutral with regard to jurisdictional claims in
    published maps and institutional affiliations.
    Rights and permissions

    Open Access This article is licensed under a Creative Commons Attribution
    4.0 International License, which permits use, sharing, adaptation,
    distribution and reproduction in any medium or format, as long as you give
    appropriate credit to the original author(s) and the source, provide a link
    to the Creative Commons licence, and indicate if changes were made. The
    images or other third party material in this article are included in the
    article’s Creative Commons licence, unless indicated otherwise in a credit
    line to the material. If material is not included in the article’s Creative
    Commons licence and your intended use is not permitted by statutory
    regulation or exceeds the permitted use, you will need to obtain permission
    directly from the copyright holder. To view a copy of this licence, visit
    http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public
    Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/)
    applies to the data made available in this article, unless otherwise stated
    in a credit line to the data.

    Reprints and Permissions
    <https://s100.copyright.com/AppDispatchServlet?title=A%20feasibility%20and%20safety%20study%20of%20afamelanotide%20in%20acute%20stroke%20patients%20%E2%80%93%20an%20open%20label%2C%20proof%20of%20concept%2C%20phase%20iia%20clinical%20trial&author=Vimal%20Stanislaus%20et%20al&contentID=10.1186%2Fs12883-023-03338-9&copyright=The%20Author%28s%29&publication=1471-2377&publicationDate=2023-07-26&publisherName=SpringerNature&orderBeanReset=true&oa=CC%20BY%20%2B%20CC0>
    About this article
    [image: Check for updates. Verify currency and authenticity via CrossMark]
    <https://crossmark.crossref.org/dialog/?doi=10.1186/s12883-023-03338-9>
    Cite this article

    Stanislaus, V., Kam, A., Murphy, L. *et al.* A feasibility and safety study
    of afamelanotide in acute stroke patients – an open label, proof of
    concept, phase iia clinical trial. *BMC Neurol* 23, 281 (2023).
    https://doi.org/10.1186/s12883-023-03338-9

    Download citation
    <https://citation-needed.springer.com/v2/references/10.1186/s12883-023-03338-9?format=refman&flavour=citation>

    -

    Received06 December 2022
    -

    Accepted19 July 2023
    -

    Published26 July 2023
    -

    DOIhttps://doi.org/10.1186/s12883-023-03338-9

    On Wednesday, May 4, 2022 at 12:15:46 AM UTC-7 Uhohinc wrote:

    > Executive Summary
    >
    > - afamelanotide evaluated as safe in mild to moderate arterial
    > ischaemic stroke (NIHSS 1–15, n=6)
    > - NIHSS1 scores improved in five patients
    > - brain scans (MRI-FLAIR2) in all patients show reduction of affected
    > tissue
    > - strong functional recovery in all five surviving patients
    >
    > CLINUVEL today released positive final results of the open label pilot
    > study (CUV801) in arterial ischemic stroke (AIS), evaluating multiple doses
    > of CLINUVEL’s drug afamelanotide in six adult patients. Afamelanotide was
    > shown to be well tolerated, with five of the six patients showing
    > considerable clinical and functional recovery up to 42 days after treatment
    > .
    >
    > “*Final analyses from the CUV801 study show that surviving patients who
    > received treatment with afamelanotide all seemed to have recovered well in
    > the six weeks following their brain injury,*” CLINUVEL’s Head of Clinical
    > Operations, Dr Pilar Bilbao said. “*Our clinical team often publicly
    > emphasise the significance of afamelanotide as a safe drug in patients, and
    > in this study, we obtained further data that patients with longstanding
    > cardiovascular disease seem to tolerate afamelanotide well. The
    > significance of these findings is of benefit to all our current and future
    > programs*.”
    > “*Despite the considerable impact of strokes on individuals and society,
    > the treatment options available, even at specialist stroke units, are
    > tragically limited,*” Dr Bilbao said. “*We are seeking to prove that
    > afamelanotide can provide a safe, effective treatment option which can
    > improve the overall prognosis post-stroke and reduce patient disability
    > long-term.*”
    >
    > “*The first steps are to gain comfort that the intervention with
    > afamelanotide poses no harm to patients, while obtaining objective measures
    > of impact of treatment on the course of the patients’ disease. With CUV801
    > we have achieved both these outcomes and can now pursue further studies and
    > regulatory interactions with a degree of confidence that the drug performs
    > as expected.*”
    >
    > “*The gain for stroke patients, but also for society as a whole, lies in
    > the improvement in neurological functions, since the ability to resume
    > independent living saves high costs to our healthcare systems,*” Dr
    > Bilbao said.
    > - End -
    >
    > 1. The National Institutes of Health Stroke Scale (NIHSS) consists of
    > 15 tests to evaluate neurologic functioning and impairment caused by acute
    > cerebral infarction (stroke). A clinical assessment is made on the basis of
    > consciousness, language, neglect, visual-field loss, extraocular movement,
    > motor strength, muscle control, speech, and sensory loss. A trained
    > clinician assesses the patient’s ability to answer questions and perform
    > specific activities. In general, the evaluation is made in less than 10
    > minutes.
    > 2. The standard diagnosis of stroke patients is made upon hospital
    > admission through computed tomography perfusion (CTP) images to assess the
    > brain damage caused by the clot. The CTP holds some predictive value to
    > assess whether further brain damage will occur if the clot persists.
    > However, days after the stroke, brain scans are made by magnetic resonance
    > (MRI-FLAIR) providing actual information on the extent of brain damage and
    > recovery.
    >
    > Appendix I: CUV801 Study Design and Endpoints
    >
    > The primary objective of the study CUV801 was to evaluate the safety of
    > patients, who were first time administered afamelanotide within 24 hours of
    > suffering a stroke, while a secondary assessment was made of the recovery
    > of brain tissue calculated from the volume of area affected, neurological
    > function assessments and of the overall disability over 42 days.
    >
    > Validated evaluations were made using:
    >
    > - National Institutes of Health Stroke Scale (NIHSS)
    > Evaluation of the patients’ condition through functional assessment on
    > days 0, 1, 2, 3, 4, 7, 8 and 42.
    > - Brain scans
    > Brain scans (CTP and MRI-FLAIR) were made at various time intervals
    > (day 0, 3, 9) to assess dead brain tissue and areas at risk of irreversible
    > damage, due to an arterial clot.
    > - Evaluation of disability was made using the modified Rankin Scale
    > *Authorised for ASX release by the Board of Directors of CLINUVEL
    > PHARMACEUTICALS LTD*
    > Media Enquiries
    >
    > Monsoon Communications
    > Mr Rudi Michelson, 61 411 402 737, ru...@monsoon.com.au
    > Head of Investor Relations
    >
    > Mr Malcolm Bull, CLINUVEL PHARMACEUTICALS LTD
    > Investor Enquiries
    >
    > https://www.clinuvel.com/investors/contact-us
    >
    > On Thursday, March 24, 2022 at 10:30:50 AM UTC-7 Uhohinc wrote:
    >
    >> Supporting data for Neuroprotective role of α-Melanocyte-stimulating
    >> hormone on ischemia/reperfusion-induced brain and retinal damage in type 1
    >> diabetic mouse
    >> CiteDownload all (3.31 GB)
    >> <https://figshare.com/ndownloader/articles/19336520/versions/1>ShareEmbed+
    >> Collect
    >> Dataset
    >> posted on 23.03.2022, 21:24 by Rajesh Kumar GoitRajesh Kumar Goit
    >> <https://figshare.com/authors/Rajesh_Kumar_Goit/9067409>, Wai Ching
    >> LamWai Ching Lam <https://figshare.com/authors/Wai_Ching_Lam/9056957>, Amy
    >> Cheuk Yin LoAmy Cheuk Yin Lo
    >> <https://figshare.com/authors/Amy_Cheuk_Yin_Lo/9050201>
    >> USAGE METRICS <https://help.figshare.com/article/usage-metrics>
    >> *11*views
    >> *0*downloads
    >> *0*citations
    >> Read the peer-reviewed publication
    >> Neuropeptide α-Melanocyte-Stimulating Hormone Promotes Neurological
    >> Recovery and Repairs Cerebral Ischemia/Reperfusion Injury in Type 1 Diabetes
    >> <https://doi.org/10.1007/s11064-021-03453-4>
    >> Research Postgraduates <https://datahub.hku.hk/rpg>
    >> CATEGORIES
    >>
    >> - Central nervous system
    >> <https://figshare.com/search?q=:category:%20%22Central%20nervous%20system%22>
    >> - Sensory systems
    >> <https://figshare.com/search?q=:category:%20%22Sensory%20systems%22>
    >>
    >> KEYWORDS
    >> Cerebral Ischemia Reperfusion Injury
    >> <https://figshare.com/search?q=:keyword:%20%22Cerebral%20Ischemia%20Reperfusion%20Injury%22>Retinal
    >> ischemia/reperfusion
    >> <https://figshare.com/search?q=:keyword:%20%22Retinal%20ischemia%2Freperfusion%22>Type
    >> 1 diabetes
    >> <https://figshare.com/search?q=:keyword:%20%22Type%201%20diabetes%22>
    >> LICENCE
    >> CC BY-NC 4.0 <https://creativecommons.org/licenses/by-nc/4.0/>
    >> EXPORTS
    >> Select an option
    >> Hide footer
    >> About <https://figshare.com/about>Features
    >> <https://figshare.com/features>Tools
    >> <https://knowledge.figshare.com/app-category/figshare-tools>Blog
    >> <https://figshare.com/blog>Ambassadors
    >> <https://knowledge.figshare.com/ambassadors>Contact
    >> <https://figshare.com/contact>FAQs <https://knowledge.figshare.com/>Privacy
    >> Policy <https://figshare.com/privacy>Cookie Policy
    >> <https://figshare.com/cookie-policy>T&Cs <https://figshare.com/terms>
    >> Sitemap <https://figshare.com/sitemap>
    >> facebook page <https://facebook.com/FigShare>twitter page
    >> <https://twitter.com/figshare>vimeo page <https://vimeo.com/figshare>
    >> fig*share*. credit for *all *your research.
    >> On Friday, November 19, 2021 at 6:52:22 PM UTC-8 Uhohinc wrote:
    >>
    >>> <https://www.sharetease.com/index.php?members/gscheidhaferl.694/>
    >>> Gscheidhaferl
    >>> <https://www.sharetease.com/index.php?members/gscheidhaferl.694/>Member
    >>> Today at 2:37 AM
    >>> <https://www.sharetease.com/index.php?threads/clinuvel.1/post-64372>
    >>>
    >>> -
    >>> <https://www.sharetease.com/index.php?threads/clinuvel.1/post-64372>
    >>> - #11,359
    >>> <https://www.sharetease.com/index.php?threads/clinuvel.1/post-64372>
    >>>
    >>> Excuse me, but IMHO all this discussion about N=3 and 2 out of three is
    >>> kind of idle. N always gives the size of the statistical universe of the
    >>> sample you draw. Whether 2 out of three or three out of three patients or 3
    >>> out of 6 patients not really has any statistical significance and shoud be
    >>> called anything else but clinical trial. It is an experiment following the
    >>> "fail early" philosophy in drug development. The "endpoints" for
    >>> success of this are that no patient has been killed by the treatment.
    >>> If really some show slight improvment (as to my understanding this is the
    >>> case here), this is the basis to get ethical approval for starting a
    >>> real clinical trial with a way larger population. And this will cost
    >>> money and time.
    >>> On Wednesday, November 17, 2021 at 10:37:10 AM UTC-8 Uhohinc wrote:
    >>>
    >>>> Plasma α-Melanocyte Stimulating Hormone Predicts Outcome in Ischemic
    >>>> Stroke
    >>>> Dannielle Zierath
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#>
    >>>> ,
    >>>> Pat Tanzi
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#>
    >>>> ,
    >>>> Kevin Cain
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#>
    >>>> ,
    >>>> Dean Shibata
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#>
    >>>> , and
    >>>> Kyra Becker
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#>
    >>>> Originally published29 Sep 2011
    >>>> - Other version(s) of this article
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#>
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B1> The
    >>>> processing of POMC depends on a series of prohormone convertases (PCs), and
    >>>> the tissue in which POMC is processed determines its eventual end products. In
    >>>> brain, POMC is expressed in the arcuate nucleus of the hypothalamus. Cleavage
    >>>> by PC1 leads to the production of adrenocorticotrophic hormone (ACTH) and
    >>>> β-lipotropin; further processing by PC2 leads to production of smaller
    >>>> peptides, including α-MSH and β-endorphin.1
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B1>,2
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B2> α-MSH
    >>>> production is, thus, more robust in tissues that highly express PC2.
    >>>>
    >>>> As part of the acute phase/stress response in stroke, cortisol is
    >>>> elevated, and these elevations correlate with both stroke severity and
    >>>> outcome.3
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B3>–
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B4>5
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B5> Cortisol
    >>>> production depends largely on the expression of ACTH, and given the common
    >>>> origin of ACTH and α-MSH, we hypothesized that there might be
    >>>> stroke-induced alterations in α-MSH. In patients with traumatic brain
    >>>> injury, for instance, decreases in plasma α-MSH occur and are associated
    >>>> with worse outcome.6
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B6> To
    >>>> our knowledge, no studies have evaluated endogenous changes in α-MSH after
    >>>> stroke. Based on experimental data, however, a decrease similar to that
    >>>> seen in patients with traumatic brain injury is anticipated.7
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B7> We,
    >>>> thus, sought to describe the time course of changes in plasma α-MSH after
    >>>> ischemic stroke in relation to ACTH and cortisol. Because not all cortisol
    >>>> production depends on ACTH, however, we also assessed plasma
    >>>> interleukin (IL) 6, a cytokine that activates the
    >>>> hypothalamic-pituitary-adrenal axis and can directly stimulate cortisol
    >>>> production by the adrenal gland.8
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B8>
    >>>> MethodsResearch Subjects
    >>>>
    >>>> This study was part of a larger prospective study that followed immune
    >>>> responses over the course of the year after stroke onset.9
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B9>,10
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B10> The
    >>>> study was approved by the institutional review board, and all of the
    >>>> patients or their surrogates provided informed consent. Patients with
    >>>> ischemic stroke admitted to either Harborview Medical Center or the
    >>>> University of Washington Medical Center from September 2005 through May
    >>>> 2009 who were ≥18 years of age could be enrolled within 72 hours of symptom
    >>>> onset and were felt not likely to die from their stroke were eligible.
    >>>> Patients with ongoing therapy for malignancy, known history of HIV or
    >>>> hepatitis B or C, history of brain tumor, anemia (hematocrit <35 on
    >>>> admission), and those taking immunomodulatory drugs were excluded. Blood
    >>>> was drawn as soon as possible after stroke onset and at 3, 7, 30, 90, 180,
    >>>> and 365 days after stroke onset. Plasma was frozen at −80° until use.
    >>>> Clinical Data
    >>>>
    >>>> Demographic and clinical data were collected on all of the patients.
    >>>> Stroke severity was determined by the National Institutes of Health Stroke
    >>>> Scale score and outcome by the modified Rankin Scale. Total infarct volume
    >>>> on initial diffusion-weighted MRI was calculated by the ABC/2 method by a
    >>>> single radiologist trained in the Cardiovascular Health Study and
    >>>> Atherosclerosis Risk in Communities protocols for infarct scoring.11
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B11> Information
    >>>> about therapeutic interventions for the treatment of stroke and
    >>>> stroke-related complications, such as infection, was collected. Infection
    >>>> was defined as clinical symptoms of an infection (fever and/or pyuria for
    >>>> urinary tract infection and fever and/or productive cough and radiographic
    >>>> evidence of consolidation for pneumonia) and positive culture data (for
    >>>> both pneumonia and urinary tract infection).10
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B10>
    >>>> Laboratory Studies
    >>>>
    >>>> Leukocyte counts, plasma cortisol, and ACTH concentrations were
    >>>> determined by the clinical laboratory. Plasma α-MSH concentrations were
    >>>> determined using a commercially available enzyme immunoassay kit (Phoenix
    >>>> Pharmaceuticals, Belmont, CA). Briefly, peptides were eluted from 0.5 mL of
    >>>> acidified plasma using C18-SEP columns containing 200 mg of C18 (Phoenix
    >>>> Pharmaceuticals, Belmont CA); the samples were evaporated by centrifugal
    >>>> vacuum concentration and reconstituted in 125 μL of buffered saline before
    >>>> enzyme immunoassay. The concentration of circulating IL-6 was measured with
    >>>> a cytometric bead-based system (Fluorokine MAP, R&D Systems); the lower
    >>>> limit of detection was 1.11 pg/mL. Values below the limit of detection are
    >>>> referred to as not detected and assigned the lowest limit of detection for
    >>>> statistical testing.
    >>>> Statistics
    >>>>
    >>>> Descriptive data are presented as median and interquartile range. Group
    >>>> comparisons were performed using the Mann-Whitney *U* test or
    >>>> Kruskal-Wallis H test. Data were normalized and associations tested using
    >>>> the Pearson correlation. Logistic regression was used to estimate the odds
    >>>> ratio and 95% CI for the effect of the highest initial α-MSH concentration
    >>>> (within 72 hours of stroke onset) on neurological outcome at 1, 3, 6, and
    >>>> 12 months after stroke onset. Given the relatively severe strokes seen in
    >>>> this study, good outcome was defined as independent ambulation (modified
    >>>> Rankin Scale ≤3). Significance was set at *P*≤0.05.
    >>>> Results
    >>>>
    >>>> A total of 114 patients were enrolled in the parent study; plasma α-MSH
    >>>> concentrations were determined in 111 of these patients, who are the
    >>>> subject of this article. The characteristics of the overall study
    >>>> population have been described elsewhere.9
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B9>,10
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B10> For
    >>>> the 111 patients in whom α-MSH was assessed early (by 72 hours), the median
    >>>> age was 57 years (range: 44–66 years), the median National Institutes of
    >>>> Health Stroke Scale score was 11 (range: 4–19), the median infarct volume
    >>>> was 12 mL (range: 1–80 mL), and 35% of the patients were women. As in other
    >>>> publications related to this study population, we divided patients into
    >>>> tertiles based on stroke severity to assess changes in plasma α-MSH over
    >>>> the course of time.9
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B9>,10
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B10> Patients
    >>>> with the most severe strokes (National Institutes of Health Stroke Scale
    >>>> ≥17) had lower concentrations of plasma α-MSH than patients with the least
    >>>> severe strokes at both 24 hours and 72 hours after stroke onset (Figure A).
    >>>> There was still a trend toward decreased α-MSH at 1 week after stroke onset
    >>>> in these severely affected patients, but the differences normalized over
    >>>> the course of time. At 1 year after stroke, the median α-MSH concentration
    >>>> among all of the patients was 12.8 pg/mL (range: 6.4–21.1 pg/mL), which is
    >>>> similar to that reported in the literature for healthy adults.12
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B12> Stroke
    >>>> severity appeared to have little impact on plasma ACTH (Figure B), but
    >>>> patients with more severe strokes evidenced increases in cortisol and IL-6
    >>>> that persisted for ≥1 month after stroke onset (Figure C and D).
    >>>>
    >>>> - Download figure
    >>>> <https://www.ahajournals.org/cms/asset/d6ae8736-a41f-4ca6-bac5-718fce0916dc/zhs0121162460001.jpeg>
    >>>> - Download PowerPoint
    >>>> <https://www.ahajournals.org/action/downloadFigures?id=FU1&doi=10.1161%2FSTROKEAHA.111.627331>
    >>>>
    >>>> Figure. Plasma concentrations of α-melanocyte stimulating hormone
    >>>> (α-MSH; A), adrenocorticotrophic hormone (ACTH; B), cortisol (C), and
    >>>> interleukin (IL) 6 (D) over the course of 1 year after stroke. Box
    >>>> plots depict the median and interquartile range. Data are depicted by
    >>>> tertile of stroke severity, differs from the lowest tertile by **P*≤0.05
    >>>> or †*P*≤0.001.
    >>>>
    >>>> Early relationships among α-MSH, ACTH, cortisol, and IL-6, as well as
    >>>> the relationships of α-MSH, ACTH, cortisol, and IL-6 with infarct volume
    >>>> and stroke severity, are displayed in Table 1
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#T1>. Table
    >>>> 2 <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#T2> depicts
    >>>> the differences in the highest α-MSH concentration within the first 72
    >>>> hours after stroke as a function of clinical and demographic differences
    >>>> between patients, none of which are significant after controlling for
    >>>> stroke severity. Initial plasma α-MSH was not predictive of early
    >>>> poststroke infection in either univariate analyses or analyses controlling
    >>>> for covariates (data not shown).
    >>>>
    >>>> Table 1. Correlations Among α-MSH, ACT, Cortisol, Infarct Volume, and
    >>>> Stroke Severity at 24 Hours and 72 Hours After Stroke Onset
    >>>> VariableInfarct Volume*UncorrectedCorrected for
    >>>> NIHSSNIHSSACTHCortisolIL-6ACTHCortisolIL-6
    >>>> a-MSH
    >>>>
    >>>>
    >>>>
    >>>>
    >>>>
    >>>>
    >>>>
    >>>>
    >>>>     24 h
    >>>> −0.148, NS
    >>>> −0.479, *P*=0.010
    >>>> −0.127, NS
    >>>> −0.501, *P*=0.025
    >>>> −0.238, NS
    >>>> −0.181, NS
    >>>> −0.256, NS
    >>>> 0.281, NS
    >>>>     72 h
    >>>> −0.247, *P*=0.014
    >>>> −0.241, *P*=0.016
    >>>> −0.139, *P*=0.181
    >>>> −0.115, NS
    >>>> −0.209, *P*=0.042
    >>>> −0.102, NS
    >>>> 0.042, NS
    >>>> −0.068, NS
    >>>> Cortisol
    >>>>
    >>>>
    >>>>
    >>>>
    >>>>
    >>>>
    >>>>
    >>>>
    >>>>     24 h
    >>>> 0.498, *P*=0.007
    >>>> 0.728, *P*<0.001
    >>>> 0.304, *P*=0.132
    >>>> …
    >>>> 0.378, *P*=0.100
    >>>> 0.496, *P*=0.014
    >>>> …
    >>>> −0.237, NS
    >>>>     72 h
    >>>> 0.420, *P*<0.001
    >>>> 0.616, *P*<0.001
    >>>> 0.346, *P*<0.001
    >>>> …
    >>>> 0.535, *P*<0.001
    >>>> 0.358, *P*<0.001
    >>>> …
    >>>> 0.325, *P*=0.002
    >>>> ACTH
    >>>>
    >>>>
    >>>>
    >>>>
    >>>>
    >>>>
    >>>>
    >>>>
    >>>>     24 h
    >>>> 0.069, NS
    >>>> −0.068, NS
    >>>> …
    >>>> …
    >>>> −0.124, NS
    >>>> …
    >>>> …
    >>>> −0.118, NS
    >>>>     72 h
    >>>> 0.138, *P*=0.161
    >>>> 0.127, *P*=0.193
    >>>> …
    >>>> …
    >>>> 0.133, *P*=0.197
    >>>> …
    >>>> …
    >>>> 0.057, NS
    >>>> IL-6
    >>>>
    >>>>
    >>>>
    >>>>
    >>>>
    >>>>
    >>>>
    >>>>
    >>>>     24 h
    >>>> 0.517, *P*=0.006
    >>>> 0.700, *P*<0.001
    >>>> …
    >>>> …
    >>>> …
    >>>> …
    >>>> …
    >>>> …
    >>>>     72 h
    >>>> 0.393, *P*<0.001
    >>>> 0.566, *P*<0.001
    >>>> …
    >>>> …
    >>>> …
    >>>> …
    >>>> …
    >>>> …
    >>>>
    >>>> Given the significant relationship between stroke severity and α-MSH,
    >>>> cortisol, and IL-6, correlations corrected for stroke severity (using the
    >>>> NIHSS score as a continuous variable) are also presented. Data are
    >>>> normalized and presented as Pearson's r.
    >>>>
    >>>> MSH indicates melanocyte stimulating hormone; ACTH,
    >>>> adrenocorticotrophic hormone; IL, interleukin; NIHSS, National Institutes
    >>>> of Health Stroke Scale; NS, not significant (*P*≥0.200).
    >>>>
    >>>> *Infarct volume is not available for 3 persons.
    >>>>
    >>>> Table 2. Differences Between Initial Plasma α-MSH Concentrations
    >>>> (pg/mL) Based on Clinical and Demographic Variables
    >>>> Patient CharacteristicsVariablesUnadjusted *P*Adjusted for Stroke
    >>>> Severity *P*
    >>>> Statistics are by Mann-Whitney *U* test or Kruskal-Wallis H test and
    >>>> are either unadjusted or adjusted for stroke severity (using the NIHSS
    >>>> score as a continuous variable).
    >>>>
    >>>> AF indicates atrial fibrillation; CHD, coronary heart disease; DM,
    >>>> diabetes mellitus; HTN, hypertension; TACS, total anterior circulation
    >>>> stroke; PACS, partial anterior circulation stroke; LACS, lacunar stroke;
    >>>> POCS, posterior circulation stroke; PNA, pneumonia; NIHSS, National
    >>>> Institutes of Health Stroke Scale; NS, not significant; IV tPA, intravenous
    >>>> tissue-type plasminogen activator; MSH, melanocyte stimulating hormone.
    >>>> α-MSH values indicate the highest α-MSH concentration within the first 72 h
    >>>> after stroke onset.
    >>>>
    >>>> *Three patients did not have MRI imaging and are not included in this
    >>>> analysis (*P*≥0.200).
    >>>>
    >>>> The effect of α-MSH, ACTH, cortisol, and IL-6 on early and long-term
    >>>> outcomes is shown in Table 3
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#T3>.
    >>>> Univariate associations between initial IL-6 and worse outcomes are seen
    >>>> early after stroke (1 and 3 months), but this effect seems to be related
    >>>> solely to stroke severity. Higher plasma cortisol is independently
    >>>> associated with worse outcomes at 1 month after stroke onset, but this
    >>>> relationship attenuates over the course of time and is lost after
    >>>> controlling for stroke severity and other important predictors of outcome.
    >>>> The effect of early plasma α-MSH concentrations on outcome was not apparent
    >>>> until later time points after stroke and was independent of initial stroke
    >>>> severity, patient age, and infection status.
    >>>>
    >>>> Table 3. Likelihood for a Good Outcome at Given Time Points Based on
    >>>> Initial Plasma α-MSH or Cortisol
    >>>> VariableModelα-MSHACTHCortisolIL-6mRS ≤3*P*mRS ≤3*P*mRS ≤3*P*mRS ≤3*P*
    >>>> of Health Stroke Scale; NS, not significant (*P*≥0.200); CI,
    >>>> confidence interval.
    >>>> Discussion
    >>>>
    >>>> In this study we found early and sustained elevations in both plasma
    >>>> cortisol (to 1 month) and IL-6 (to 6 months) among patients with severe
    >>>> stroke, whereas ACTH concentrations were largely unchanged and α-MSH
    >>>> concentrations decreased early after stroke. That elevated plasma cortisol
    >>>> is seen in patients with severe strokes and is associated with worse
    >>>> outcome is well documented.3
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B3>,5
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B5>,13
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B13>–
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B14>15
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B15> Increased
    >>>> cortisol is considered to be a marker of the acute phase/stress response in
    >>>> stroke and is variably attributed to increased ACTH and/or IL-6.16
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B16>,17
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B17> We
    >>>> found both plasma cortisol and IL-6 to be highly correlated with stroke
    >>>> severity and infarct volume. As might be expected, there was a correlation
    >>>> between plasma ACTH and cortisol, and this correlation was essentially
    >>>> unchanged after controlling for stroke severity. Also, similar to previous
    >>>> studies, we saw a correlation between IL-6 and plasma cortisol. This
    >>>> correlation was slightly attenuated but not lost after controlling for
    >>>> stroke severity, suggesting that IL-6 may drive some cortisol production
    >>>> independent of stroke severity and ACTH expression. Despite the common
    >>>> origin of α-MSH and ACTH from POMC, the plasma concentrations of these
    >>>> neuropeptides were not correlated after stroke, and the association between
    >>>> plasma α-MSH and stroke severity/infarct volume was not nearly as robust as
    >>>> that seen for cortisol and IL-6. Given that the half-life of α-MSH in
    >>>> circulation is on the order of minutes, it is possible that more
    >>>> significant associations between α-MSH and stroke severity were missed
    >>>> because of timing of blood draws.
    >>>>
    >>>> Despite the limitations of this study with regard to timing of blood
    >>>> draws, we were still able to demonstrate a decrease in plasma α-MSH among
    >>>> patients with severe strokes (National Institutes of Health Stroke Scale
    >>>> ≥17) early after stroke onset. To our knowledge, this is the first study
    >>>> that addresses endogenous changes in plasma α-MSH after ischemic stroke,
    >>>> although we did find a similar decrease in plasma α-MSH in an animal study
    >>>> of severe stroke.7
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B7> Further,
    >>>> we found that higher plasma α-MSH was associated with an increased
    >>>> likelihood of experiencing a good clinical outcome, an effect that was most
    >>>> apparent at later time points after stroke and independent of stroke
    >>>> severity, patient age, and infection status. In contrast, the associations
    >>>> between cortisol and IL-6 on outcome were most robust at early time points
    >>>> after stroke and explained almost entirely by the fact that cortisol and
    >>>> IL-6 are markers of stroke severity. The lack of an independent association
    >>>> among cortisol, IL-6, and stroke outcome has been documented previously.
    >>>> 5 <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B5>,18
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B18>
    >>>>
    >>>> Both the independent association of α-MSH with stroke outcome and the
    >>>> delay in this observed association suggest that the effect of early plasma
    >>>> α-MSH on outcome is more than a reflection of the stress response related
    >>>> to stroke severity and that maintenance of plasma α-MSH after stroke onset
    >>>> may be protective. Furthermore, a growing body of experimental data shows
    >>>> that exogenous administration of α-MSH decreases infarct volume and
    >>>> improves stroke outcome.7
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B7>,19
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B19>–
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B20%20B21>
    >>>> 22 <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B22> There
    >>>> are numerous mechanisms by which α-MSH (and related neuropeptides) could
    >>>> improve stroke outcome, and these effects are mediated through 5 different
    >>>> melanocortin receptors (MCRs). Potent antipyretic properties of α-MSH,
    >>>> which could potentially be capitalized on in the treatment of stroke, are
    >>>> mediated through the MCR3/MCR4 receptor complex in the brain.23
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B23> MCR1
    >>>> is expressed by cells of the immune system and is responsible for mediating
    >>>> the robust anti-inflammatory and immunomodulatory properties of α-MSH,
    >>>> which include the prevention of T-helper 1 responses and the induction of T
    >>>> regulatory responses to selected antigens.24
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B24>–
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B25%20B26>
    >>>> 27 <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B27> Given
    >>>> the effect of α-MSH on the immune response, it is not surprising that it
    >>>> has been shown to improve outcome in animal models of experimental allergic
    >>>> encephalomyelitis.28
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B28>,29
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B29> We
    >>>> also found that α-MSH administration decreased infarct volume and improved
    >>>> neurological outcome 24 hours after transient middle cerebral artery
    >>>> occlusion in an animal model of stroke.7
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B7> Consistent
    >>>> with the known effects of α-MSH on the immune response, we found that
    >>>> splenocytes harvested from α-MSH–treated animals responded less well to
    >>>> phytohemagglutinin (a lymphocyte mitogen) than splenocytes harvested from
    >>>> saline-treated animals. Furthermore, the animals treated with α-MSH in this
    >>>> study were less likely to develop autoimmune responses to myelin basic
    >>>> protein, a response associated with worse stroke outcome.30
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B30>,31
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B31> Finally,
    >>>> α-MSH has neurotrophic properties that could aid in stroke recovery.32
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B32>–
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B33%20B34%20B35%20B36>
    >>>> 37 <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B37> At
    >>>> least some of these neurotrophic effects appear to be mediated by MCR4.
    >>>> 36 <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B36>,
    >>>> 37 <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B37> These
    >>>> effects of α-MSH, along with the immunomodulatory effects, may help to
    >>>> explain why delayed administration of α-MSH can improve outcome and why the
    >>>> association between early α-MSH and stroke outcome is not apparent until
    >>>> later time points.20
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B20>,37
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B37>–
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B38>39
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B39>
    >>>>
    >>>> α-MSH is an attractive candidate for stroke therapy given its
    >>>> multiplicity of actions and the possibility that delayed administration may
    >>>> still be of therapeutic value. The attractiveness of α-MSH as a therapeutic
    >>>> agent is further enhanced by its potential ease of administration;
    >>>> MSH-related neuropeptides are absorbed through the nasal mucosa rapidly
    >>>> after inhalation.40
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B40> In
    >>>> addition to exogenous administration of the neuropeptide, plasma α-MSH
    >>>> concentrations could be augmented by strategies that favor α-MSH processing
    >>>> from POMC/ACTH (ie, enhancing PC2 activity). The potent immunomodulatory
    >>>> properties of α-MSH, however, suggest the possibility that this peptide
    >>>> could predispose to infection, a complication that was seen in an animal
    >>>> model of stroke.41
    >>>> <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B41> In
    >>>> the current study, however, we did not find an independent association
    >>>> between α-MSH and infection risk. Furthermore, we did not see infectious
    >>>> complications related to α-MSH administration in our animal model of stroke.
    >>>> 7 <https://www.ahajournals.org/doi/10.1161/STROKEAHA.111.627331#B7>
    >>>>>>> *Melanocortin-1 Receptor Positively Regulates Human Artery
    >>>>>>> Endothelial Cell Migration*
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> Federica Saporitia Luca Piacentinia Valentina Alfieria,b
    >>>>>>> Elisa Bonoa
    >>>>>>>
    >>>>>>> Fabrizio Ferraria Mattia Chiesaa Gualtiero I. Colomboa
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> aUnit of Immunology and Functional Genomics, Centro Cardiologico
    >>>>>>> Monzino IRCCS, Milan, Italy, bDepartment of Pharmacological and
    >>>>>>> Biomolecular Sciences, Università degli Studi di Milano, Milan, Italy
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *Key Words*
    >>>>>>>
    >>>>>>> Melanocortin receptors • α-MSH • Human artery endothelial cells •
    >>>>>>> Cell migration
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *Abstract*
    >>>>>>>
    >>>>>>> *Background/Aims:* Melanocortin receptors (MCRs) belong to a
    >>>>>>> hormonal signalling pathway with multiple homeostatic and protective
    >>>>>>> actions. Microvascular and umbilical vein endothelial cells (ECs)
    >>>>>>> express components of the melanocortin system, including the type 1
    >>>>>>> receptor (MC1R), playing a role in modulating inflammation and vascular
    >>>>>>> tone. Since ECs exhibit a remarkable heterogeneity, we investigated
    >>>>>>> whether human artery ECs express any functional MCR and whether its
    >>>>>>> activation affects cell migration. *Methods:* We used reverse
    >>>>>>> transcription real-time PCR to examine the expression of melanocortin
    >>>>>>> system components in primary human artery ECs. We assessed MC1R protein
    >>>>>>> expression and activity by western blot, immunohistochemistry, cAMP
    >>>>>>> production, and intracellular Ca2+ mobilization assays. We
    >>>>>>> performed gap closure and scratch tests to examine cell migration after
    >>>>>>> stimulation with alpha-melanocyte-stimulating hormone (α-MSH), the receptor
    >>>>>>> highest-affinity natural ligand. We assessed differential
    >>>>>>> time-dependent transcriptional changes in migrating cells by microarray
    >>>>>>> analysis. *Results:* We showed that human aortic ECs (HAoECs)
    >>>>>>> express a functionally active MC1R. Unlike microvascular ECs,
    >>>>>>> arterial cells did not express the α-MSH precursor proopiomelanocortin, nor
    >>>>>>> produced the hormone. MC1R engagement with a single pulse of α-MSH
    >>>>>>> accelerated HAoEC migration both in the directional migration assay and in
    >>>>>>> the scratch wound healing test. This was associated with an
    >>>>>>> enhancement in Ca2+ signalling and inhibition of cAMP elevation.
    >>>>>>> Time-course genome-wide expression analysis in HAoECs undergoing
    >>>>>>> directional migration allowed identifying dynamic co-regulation of genes
    >>>>>>> involved in extracellular matrix-receptor interaction, vesicle-mediated
    >>>>>>> trafficking, and metal sensing – which have all well-established
    >>>>>>> influences on EC motility –, without affecting the balance between pro- and
    >>>>>>> anticoagulant genes. *Conclusion:* Our work broadens the knowledge
    >>>>>>> on peripherally expressed MC1R. These results indicate that the receptor is
    >>>>>>> constitutively expressed by arterial ECs and provide evidence of a novel
    >>>>>>> homeostatic function for MC1R, whose activation may participate in
    >>>>>>> preventing/healing endothelial dysfunction or denudation in macrovascular
    >>>>>>> arteries.
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *Introduction*
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> The melanocortin receptors (MCRs) are a family of rhodopsin-like G
    >>>>>>> protein-coupled receptors (GPCRs) that are activated by different
    >>>>>>> melanocortin peptide ligands, derived from the tissue-specific cleavage of
    >>>>>>> a common preprohormone precursor, the proopiomelanocortin (POMC) [1]. These
    >>>>>>> molecules, together with a number of endogenous antagonists and accessory
    >>>>>>> proteins, constitutes the so-called melanocortin system [2]. To date, five
    >>>>>>> MCRs have been identified, with different tissue distribution and a diverse
    >>>>>>> affinity for their natural ligands. MCRs mainly signal through
    >>>>>>> intracellular cAMP increase or, alternatively, transient intracellular
    >>>>>>> elevation of cytosolic free Ca2+ [3]. The melanocortin system has been
    >>>>>>> studied for its ability to regulate several physiological processes,
    >>>>>>> including pigmentation, adrenocortical steroidogenesis, energy homeostasis,
    >>>>>>> and exocrine gland secretion. In particular, the prototypical melanocortin
    >>>>>>> peptide, the alpha-melanocyte stimulating hormone (α-MSH), possesses a wide
    >>>>>>> spectrum of anti-inflammatory [4], immunoregulatory [5], and cytoprotective
    >>>>>>> activities, including protection and repair after organ damage (
    >>>>>>> *i.e.* cerebral and myocardial ischemia/reperfusion injury,
    >>>>>>> nephrotoxicity, and acute lung injury) [6]. As a consequence, targeting
    >>>>>>> melanocortin system is considered a promising strategy for new therapeutic
    >>>>>>> approaches in various inflammatory conditions [7].
    >>>>>>>
    >>>>>>> The melanocortin system has been involved in the modulation of
    >>>>>>> oxidative stress [8] and vascular endothelial damage [9]. A local
    >>>>>>> melanocortin system has been described in endothelial cells (ECs) of the
    >>>>>>> cutaneous microcirculation [10]. Moreover, the MC1R (and no other
    >>>>>>> MCR) has been detected both on murine brain microvascular ECs [11], and on
    >>>>>>> human dermal microvascular ECs (HDMECs) [10, 12] and umbilical vein
    >>>>>>> ECs (HUVECs) [13], with possible modulatory effects on endothelium
    >>>>>>> homeostasis. In particular, α-MSH has been shown to modulate blood
    >>>>>>> vessel tone by enhancing nitric oxide-cyclic guanosine monophosphate
    >>>>>>> dependent relaxation responses through endothelial MC1R [13].
    >>>>>>> Nonetheless, a formal demonstration that human artery ECs of the
    >>>>>>> macrovasculature express functional MCR(s) is currently missing. This is
    >>>>>>> substantial because ECs exhibit a remarkable heterogeneity and show
    >>>>>>> specific structure and functions associated with the blood vessel they
    >>>>>>> belong to, *i.e.* large and medium arteries, veins, or capillaries
    >>>>>>> [14, 15]. At the molecular level, ECs display phenotype markers that are
    >>>>>>> cell type-restricted, and exhaustive genome-wide expression studies
    >>>>>>> have shown unique gene expression patterns in ECs derived from different
    >>>>>>> tissues [16, 17]. This heterogeneity accounts for many human
    >>>>>>> vascular diseases restricted to specific types of vessels. Nevertheless,
    >>>>>>> our knowledge of EC biology has been mostly inferred by studies on HUVECs,
    >>>>>>> which are cells that originate from a vessel type that is rarely affected
    >>>>>>> by vascular disorders [18]. HDMECs and HUVECs do not recapitulate the
    >>>>>>> physiology of all the vascular ECs and, most importantly, their ability to
    >>>>>>> activate specific cell functions in response to MCR ligands may not overlap
    >>>>>>> those of artery ECs.
    >>>>>>>
    >>>>>>> A recent report showed that treatment with MCR agonists was able to
    >>>>>>> prevent the development of vascular dysfunction and attenuate plaque
    >>>>>>> inflammation in a mouse model of pre-established atherosclerosis
    >>>>>>> [19]. Artery endothelial dysfunction and/or injury are prominently
    >>>>>>> linked to the pathogenesis of atherosclerosis, thrombosis, or surgery
    >>>>>>> procedure complications [20]. An essential biological process
    >>>>>>> involved in endothelial healing upon vascular injury is EC migration. When
    >>>>>>> a blood vessel is damaged, the restoration of *endothelium* and
    >>>>>>> vessel integrity is achieved through *migration* of *healthy* *ECs* to
    >>>>>>> the site of the lesion and subsequent proliferation. Hence, EC migration
    >>>>>>> has a key role, besides angiogenesis, in vascular repair and tissue
    >>>>>>> regeneration [21]. In this work, we investigated whether human artery ECs
    >>>>>>> express any functional MCR and whether MCRs activation through α-MSH can
    >>>>>>> affect artery EC migration.
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *Materials and Methods*
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *Primary human artery endothelial cells*
    >>>>>>>
    >>>>>>> We purchased primary human artery ECs from the European Collection
    >>>>>>> of Authenticated Cell Cultures (ECACC, Salisbury, UK), Lonza (Allendale,
    >>>>>>> NJ), and Promocell (Heidelberg, Germany). We obtained three adult human
    >>>>>>> aortic ECs (HAoECs) and recoded them as *c1*, *c2* and *c3*,
    >>>>>>> namely: (*c1*) HAoEC (304-05a) from ECACC (catalogue no. 06090729),
    >>>>>>> (*c2*) HAoEC from Lonza (catalogue no. CC-2535), and (*c3*) HAoEC
    >>>>>>> from Promocell (catalogue no. C-12271). We also obtained three adult human
    >>>>>>> coronary artery ECs (HCAECs) and recoded them as *c4*, *c5* and *c6*,
    >>>>>>> namely: (*c4*) HCAEC (300-05a) from ECACC (catalogue no. 06090727),
    >>>>>>> (*c5*) HCAEC from Lonza (catalogue no. CC-2585), and (*c6*) HCAEC
    >>>>>>> from Promocell (catalogue no. C-12221). Primary ECs were tested for
    >>>>>>> cell-type specific markers by the manufactures. Cells were positive for
    >>>>>>> Factor VIII-related antigen or von Willebrand factor and CD31 expression,
    >>>>>>> positive for acetylated low-density lipoprotein uptake, and negative for
    >>>>>>> α-actin expression. Cells were seeded in 75 mL plastic flasks (Corning,
    >>>>>>> Tewksbury, MA) at a density of 2.5 × 103 cells/cm2 and cultured following
    >>>>>>> manufactures’ instructions. We performed all experiments at cell passages
    >>>>>>> 4–8. We tested cell cultures for mycoplasma contamination before any
    >>>>>>> experiments, using the PCR-based Mycoplasma detection kit Venor GeM OneStep
    >>>>>>> (Minerva Biolabs, Berlin, Germany).
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *Chemicals*
    >>>>>>>
    >>>>>>> The α-MSH peptide was obtained from Phoenix Pharmaceuticals
    >>>>>>> (Burlingame, CA); the peptide 153N-6
    >>>>>>> (H-[Met5,Pro6,D-Phe7,D-Trp9,Phe10]-MSH(5-13)) from Bachem (Bubendorf,
    >>>>>>> Switzerland); isobutyl methylxanthine (IBMX), forskolin, PD0332991
    >>>>>>> isethionate, and thapsigargin from Sigma-Aldrich (St. Louis, MO); 1,
    >>>>>>> 2-Bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid
    >>>>>>> tetrakis(acetoxymethyl ester) (BAPTA-AM) and 1-[6-[[(17β)-3-Methoxyestra-1,
    >>>>>>> 3,5(10)-trien-17-yl]amino]hexyl]-1H-pyrrole-2, 5-dione (U-73122) from
    >>>>>>> Tocris Bioscience (Bristol, UK). The peptides α-MSH and 153N-6 were
    >>>>>>> dissolved in water. IBMX, forskolin, PD0332991, thapsigargin, BAPTA-AM, and
    >>>>>>> U-73122 were dissolved in dimethyl sulfoxide (DMSO).
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *Reverse transcription quantitative PCR (RT-qPCR) for melanocortin
    >>>>>>> system components*
    >>>>>>>
    >>>>>>> Total RNA was extracted from ECs grown to confluence, adding TRIzol
    >>>>>>> Reagent (Invitrogen, Carlsbad, CA) directly to the culture dishes. Given
    >>>>>>> that some MCRs are single-exon intronless genes (*i.e.*, MC3R and
    >>>>>>> MC4R), while others are multi-exon genes with several splice variants (
    >>>>>>> *e.g.*, MC1R [22]), we treated RNA samples with RNase-free DNase-I
    >>>>>>> to eliminate genomic contamination and prevent amplification of genomic
    >>>>>>> DNA. This allowed us to use a single-exon probe qPCR design to detect the
    >>>>>>> canonical primary transcripts of the MCR genes. RNA quantification and
    >>>>>>> purity assessment were performed by micro-volume spectrophotometry on an
    >>>>>>> Infinite M200 PRO multimode microplate reader (Tecan, Männedorf,
    >>>>>>> Switzerland). RNA quality and integrity were checked by microfluidics
    >>>>>>> electrophoresis with the RNA 6000 Nano Assay Kit on a 2100 Bioanalyzer
    >>>>>>> (Agilent Technologies, Santa Clara, CA). Complementary DNA (cDNA) for
    >>>>>>> single target gene expression analysis was synthesized from 2 μg of total
    >>>>>>> RNA for each sample using the High Capacity cDNA Reverse Transcription Kit
    >>>>>>> (Applied Biosystems, Foster City, CA). TaqMan Array Human Endogenous
    >>>>>>> Controls 96-Well Plate PCR assay (Applied Biosystems) was preliminarily
    >>>>>>> employed to identify the most appropriate endogenous control gene. Analysis
    >>>>>>> of gene expression stability and selection of the best reference gene was
    >>>>>>> performed using the NormFinder v0.953 Excel Add-In [23]. We used single
    >>>>>>> tube TaqMan Gene Expression Assays (Applied Biosystems) for evaluating mRNA
    >>>>>>> expression of the melanocortin receptors (*MCR*s),
    >>>>>>> proopiomelanocortin (*POMC*), prohormone convertases, and the
    >>>>>>> endogenous constitutive gene (see details Supplemental Methods – for all
    >>>>>>> supplemental material see www.cellphysiolbiochem.com). Assays IDs
    >>>>>>> for the melanocortin system components and the reference gene were
    >>>>>>> Hs00267168_s1 (*MC1R*), Hs00265039_s1 (*MC2R*), Hs00252036_s1 (
    >>>>>>> *MC3R*), Hs00271877_s1 (*MC4R*), Hs00271882_s1 (*MC5R*),
    >>>>>>> Hs01596743_m1 (*POMC*), Hs01026107_m1 (proprotein convertase
    >>>>>>> subtilisin/kexin type 1, *PCSK1*), Hs01037347_m1 (*PCSK2*),
    >>>>>>> Hs00159829_m1 (furin, *PCSK3*), Hs00159844_m1 (*PCSK6*),
    >>>>>>> Hs00161638_m1 (secretogranin V, SCG5), and Hs99999902_m1 (ribosomal protein
    >>>>>>> large P0, RPLP0). We run three replicates of each assay for each sample (20
    >>>>>>> ng/well of cDNA) on a ViiA 7 Real-time PCR System (Applied Biosystems).
    >>>>>>> Experimental threshold and baseline were imputed by algorithms implemented
    >>>>>>> in the ViiA 7 software v1.2 (Applied Biosystems), and data were analysed by
    >>>>>>> the Pfaffl’s corrected ΔΔCt method [24].
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *α-MSH assay*
    >>>>>>>
    >>>>>>> Quantification of α-MSH release by primary HAoECs and HCAECs was
    >>>>>>> performed using an ultrasensitive fluorescent enzyme immunoassay (EIA) kit
    >>>>>>> (Phoenix Pharmaceuticals), following manufacture’s instruction. The EIA
    >>>>>>> sensitivity, *i.e.* the minimum detectable concentration, was 8.9
    >>>>>>> pg/mL. Cross-reactivity with the adrenocorticotropic hormone (ACTH) was
    >>>>>>> zero: α-MSH shares the sequence of ACTH (1–13), but α-MSH is acetylated at
    >>>>>>> the N-terminus and amidated at the C-terminus [7]. Cells were seeded to
    >>>>>>> confluence in 96-well culture plates, in complete endothelial growth medium
    >>>>>>> (EGM2; Lonza), and supernatants were collected and stored at -80 °C until
    >>>>>>> measurement.
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *Genomic DNA sequencing for MC1R*
    >>>>>>>
    >>>>>>> We used a 3500 Genetic Analyzer (Applied Biosystems) to perform DNA
    >>>>>>> sequencing of the *MC1R* gene open reading frame (ORF) for all
    >>>>>>> HCAECs and HAoECs. Genomic DNA amplicons of the *MC1R* ORF were
    >>>>>>> produced by PCR with the following primers: MC1R_Forward(1) (-25)
    >>>>>>> 5’-TCCTTCCTGCTTCCTGGACA-3’, MC1R_Reverse(1) (+980)
    >>>>>>> 5’-CACACTTAAAGCCGCGTGCAC-3’*. *The amplified fragments were
    >>>>>>> purified using the Agencourt AMPure XP kit (Beckman Coulter). Sequencing
    >>>>>>> reactions were carried out using the BigDye Terminator v3.1 Kit (Applied
    >>>>>>> Biosystems) in both strand directions to allow the production of four
    >>>>>>> overlapping fragments. Sequencing primers used were the MC1R_Forward(1),
    >>>>>>> the MC1R_Reverse(1) and: the inner MC1R_Forward(2) (+449)
    >>>>>>> 5’-TGCGCTACCACAGCATCGTG-3’, and the inner MC1R_Reverse(2) (+510)
    >>>>>>> 5’-CACCCAGATGGCCGCAAC-3’. Unincorporated fluorescent dideoxynucleotides and
    >>>>>>> salts were removed with the BigDye XTerminator Purification Kit (Applied
    >>>>>>> Biosystems). The purified sequencing reaction products were
    >>>>>>> electrokinetically injected into a 50 cm Capillary Array filled with the
    >>>>>>> POP-7 Polymer (Applied Biosystems). Electropherograms were analysed by the
    >>>>>>> Variant Reporter software v1.1 (Applied Biosystems).
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *Antibodies*
    >>>>>>>
    >>>>>>> Primary antibodies used were: anti-MC1R rabbit polyclonal antibody,
    >>>>>>> supplied with the specific control peptide antigen (Alomone Labs,
    >>>>>>> Jerusalem, Israel); anti-ATPase Na+/K+ transporting subunit alpha 1
    >>>>>>> (ATP1A1) rabbit polyclonal antibody (Cell Signaling Technology, Danvers,
    >>>>>>> MA); anti-β-actin mouse monoclonal IgG1 (Novus Biologicals, Littleton, CO);
    >>>>>>> and anti-Ki67 rabbit polyclonal IgG (Abcam, Cambridge, UK). Secondary
    >>>>>>> antibodies were: donkey anti-rabbit or anti-mouse IgG conjugated,
    >>>>>>> respectively, to IRDye 800CW and IRDye 680RD infrared dyes (LI-COR
    >>>>>>> Biosciences, Lincoln, NE), for immunoblotting; donkey anti-rabbit IgG
    >>>>>>> conjugated to the DyLight 488 fluorochrome (Jackson ImmunoResearch
    >>>>>>> Laboratories, West Grove, PA), for immunocytochemistry.
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *Western blotting*
    >>>>>>>
    >>>>>>> HAoECs and HCAECs (1.2 × 106) were lysed in Milliplex MAP Lysis
    >>>>>>> buffer (Millipore, Billerica, MA) with a complete protease inhibitor
    >>>>>>> cocktail (Roche, Mannheim, Germany) to obtain whole extracts, or with the
    >>>>>>> FractionPREP Cell Fractionation Kit (BioVision, Milpitas, CA) to obtain
    >>>>>>> plasma membrane extracts. Proteins were quantified using the Pierce BCA
    >>>>>>> Protein Assay Kit (Thermo Fisher Scientific). Thirty μg of each protein
    >>>>>>> extract were mixed with the Novex Tris-Glycine SDS sample buffer 2× and the
    >>>>>>> Novex sample reducing agent 10× (Invitrogen). Samples were loaded onto
    >>>>>>> 4-12% gradient Novex WedgeWell precast Tris-Glycine polyacrylamide gels
    >>>>>>> (Invitrogen) and run in Novex Tris-Glycine SDS running buffer for 40 min at
    >>>>>>> 200 V. Samples were blotted on nitrocellulose membranes using an iBlot
    >>>>>>> system (Invitrogen). Membranes were blocked in the Odyssey blocking buffer
    >>>>>>> (LI-COR Biosciences) for 1 h. Pre-absorption was performed by incubating
    >>>>>>> the anti-MC1R antibody for 30 min at room temperature with the inhibitory
    >>>>>>> MC1R peptide (two-fold excess of the peptide by weight). Primary or the
    >>>>>>> pre-absorbed antibodies were diluted (1:1000) in the Odyssey blocking
    >>>>>>> buffer (LI-COR Biosciences), and membranes were incubated overnight at 4°C.
    >>>>>>> Anti-β-actin and anti-ATP1A1 antibodies (1:5000) were used as reference
    >>>>>>> controls for whole or membrane extracts, respectively. Membranes were
    >>>>>>> incubated with IRDye secondary antibodies (1:10000) for 20 min at room
    >>>>>>> temperature. Immunoreactive bands were detected by an Odyssey Infrared
    >>>>>>> Imaging System (LI-COR Biosciences).
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *Anti-MC1R antibody specificity testing*
    >>>>>>>
    >>>>>>> The anti-MC1R antibody was raised against an epitope corresponding
    >>>>>>> to amino acid residues 217-232 in the 3rd intracellular loop of human MC1R.
    >>>>>>> To test the specific binding of the anti-MC1R antibody to the MC1R protein,
    >>>>>>> we generated a positive control for subsequent analyses by transiently
    >>>>>>> transfecting human HEK293 cells with the MC1R full-length cDNA by a
    >>>>>>> C-terminal fusion of tGFP tag in a pCMV6 vector (Origene, Rockville, MD).
    >>>>>>> Cells were grown in RPMI 1640 with 10% foetal bovine serum (FBS),
    >>>>>>> penicillin 100 U/mL and streptomycin 10 μg/mL (Sigma-Aldrich) to
    >>>>>>> approximately 50% confluence, and then transfected by incubation with the
    >>>>>>> TransIT-LT1 Transfection Reagent (Mirus Bio, Madison, WI) for 48 h.
    >>>>>>> Specificity of the MC1R antibody was demonstrated by pre-absorption with
    >>>>>>> the specific blocking peptide supplied with the primary antibody, which
    >>>>>>> abolished MC1R signal in Western immunoblot (see Supplementary Fig. S1).
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *Intracellular cAMP assay*
    >>>>>>>
    >>>>>>> Quantification of intracellular cAMP levels was performed using the
    >>>>>>> cAMP Biotrak enzyme immunoassay (GE Healthcare Life Sciences, Piscataway,
    >>>>>>> NJ). HAoECs were seeded to confluence in 96-well plates or 24-well plates
    >>>>>>> with IBIDI culture inserts (Martinsried, Germany). Cells, prior to 5-min
    >>>>>>> stimulation with α-MSH 10-8 M, were pre-treated for 30 min with IBMX 0.1
    >>>>>>> mM, to inhibit cAMP degradation by phosphodiesterases (PDEs). Cells treated
    >>>>>>> with IBMX alone were used as negative controls, whereas cells stimulated
    >>>>>>> with the activator of eukaryotic adenylyl cyclase forskolin (10 μM) served
    >>>>>>> as positive controls. As control for receptor-binding specificity, cells
    >>>>>>> were pre-treated with the MC1R-selective competitive α-MSH antagonist
    >>>>>>> 153N-6 (10-5 M) [25, 26] for 15 min in separate experiments. The
    >>>>>>> abovementioned concentration of α-MSH was selected for all functional
    >>>>>>> assays based on previous publications on HDMECs [10, 12] and on pilot
    >>>>>>> experiments with 100-fold scalar concentrations of peptide (10-6 M, 10-8 M,
    >>>>>>> and 10-10 M) that showed its effectiveness (see Results below).
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *Immunohistochemistry for MC1R*
    >>>>>>>
    >>>>>>> Formaldehyde-fixed paraffin sections of a normal human aorta were
    >>>>>>> incubated with the primary anti-MC1R antibody overnight at 4°C. As control
    >>>>>>> of the staining specificity, the anti-MC1R antibody was pre-incubated 30
    >>>>>>> min with its specific blocking peptide. Slides were incubated with a
    >>>>>>> biotinylated goat anti-rabbit IgG secondary antibody (1:200; Vector
    >>>>>>> Laboratories, Burlingame, CA) and signals were revealed using the
    >>>>>>> VECTASTAIN Elite ABC-HRP kit combined with the ImmPACT DAB EqV peroxidase
    >>>>>>> (HRP) substrate (Vector Laboratories). Images were recorded using an
    >>>>>>> AxioSkop microscope equipped with an AxioCam camera (Carl Zeiss).
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *Directional cell migration assay*
    >>>>>>>
    >>>>>>> The live-cell staining, lipophilic, near-infrared fluorescent
    >>>>>>> membrane probe 1, 1'-dioctadecyl-3, 3,3',3'-tetramethylindotricarbocyanine
    >>>>>>> iodide (DiR) was used for imaging of gap closure in a cell migration
    >>>>>>> assay [27]. HAoECs were treated with a solution of 2.5 μM DiR (Biotium,
    >>>>>>> Hayward, CA) in complete EGM2 medium for 20 min at 37°C, washed and seeded
    >>>>>>> onto 24-well plates with culture inserts (IBIDI, Martinsried, Germany).
    >>>>>>> Inserts were removed to create a cell-free gap of approximately 500 µm, and
    >>>>>>> HAoECs were allowed to migrate for 12h at 37°C and 5% CO2 in the presence
    >>>>>>> of 10-8 M α-MSH or in medium alone. As control for receptor-binding
    >>>>>>> specificity, cells were pre-treated with the MC1R-selective antagonist
    >>>>>>> 153N-6 (10-5 M) for 15 min. In addition, to dissect the calcium-dependency
    >>>>>>> of the α-MSH-induced cell migration, experiments were repeated pre-treating
    >>>>>>> cells for 15 min with either the intracellular Ca2+ chelator BAPTA-AM
    >>>>>>> (10-5 M) or the phospholipase C (PLC) inhibitor U-73122 (5 × 10-5 M).
    >>>>>>> Plates were scanned with the Odyssey imaging system (LI-COR Biosciences) at
    >>>>>>> 0, 3, 9, and 12 h, at 84 μm resolution and high quality setting (emission,
    >>>>>>> 800 nm). Scans were converted to 8-bit images and analysed with the NIH
    >>>>>>> ImageJ software v1.38x. For time-course gene-expression analysis, 2 ×
    >>>>>>> 104 HAoECs were plated in high 35-mm dishes with culture inserts (IBIDI)
    >>>>>>> and treated with α-MSH 10-8 M.
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *Scratch wound healing assay*
    >>>>>>>
    >>>>>>> HAoEC migration was also assessed using a scratch migration assay.
    >>>>>>> Briefly, HAoECs were seeded onto 6-well tissue culture plates at a density
    >>>>>>> of 2.5 × 103 cells/cm2 and grown to confluence. A gap of approximately 1 mm
    >>>>>>> was created in the adherent layer of confluent ECs by using a sterile
    >>>>>>> 0.1-mL pipette tip. After treatment with medium alone or α-MSH 10-8 M, with
    >>>>>>> or without 15-min pre-treatment with the MC1R antagonist 153N-6 (10-5 M),
    >>>>>>> the closure extent of the cell-free gap was detected by confocal microscope
    >>>>>>> imaging (Zeiss, Jena, Germany) at 6 and 24h and measured using the NIH
    >>>>>>> ImageJ software v1.38x.
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *Immunostaining for Ki67*
    >>>>>>>
    >>>>>>> HAoECs were plated in 8-chamber μ-slides (IBIDI) at a density of 1.0
    >>>>>>> × 103 cells/cm2, treated with medium alone, α-MSH 10-8 M, or α-MSH plus
    >>>>>>> 153N-6, and allowed to migrate for 24 h. Cells were then fixed for 20 min
    >>>>>>> in 4% paraformaldehyde solution in PBS and permeabilised with 0.1% Triton
    >>>>>>> X-100 (Sigma-Aldrich). Non-specific antibody binding was prevented by using
    >>>>>>> a blocking solution of 10% normal donkey serum (Jackson ImmunoResearch
    >>>>>>> Laboratories) for 1h. Cells were incubated with the anti-Ki-67 primary
    >>>>>>> antibody (1:100) overnight at 4°C and, then, with the DyLight-conjugated
    >>>>>>> species-specific secondary antibody (1:500) for 2h at room temperature.
    >>>>>>> Slides were finally incubated with DAPI (Sigma-Aldrich; 1:1000) for 5 min
    >>>>>>> to stain cell nuclei, mounted in a fluorescence mounting medium (Dako,
    >>>>>>> Glostrup, Denmark), and examined with an ApoTome fluorescence microscope
    >>>>>>> (Carl Zeiss, Jena, Germany). Images were acquired using the ZEN software
    >>>>>>> v.5.0 SP1.1 (Carl Zeiss) and analysed with the ImageJ software, counting
    >>>>>>> the percentage of Ki-67 positive cells over the total number of nuclei in
    >>>>>>> 10 different fields for each treatment conditions in 4 independent
    >>>>>>> experiments.
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *Cell morphology assessment*
    >>>>>>>
    >>>>>>> HAoECs were plated in 8-chamber μ-slides (IBIDI) at a density of 1.0
    >>>>>>> × 103 cells/cm2, incubated with α-MSH 10-8 M or medium alone for 6h, fixed
    >>>>>>> for 10 min in 4% paraformaldehyde solution, and permeabilised with 0.1%
    >>>>>>> Triton X-100 for 1h. Non-specific binding was prevented using a blocking
    >>>>>>> solution of 5% bovine serum albumin. Cells were stained for 1h at room
    >>>>>>> temperature with phalloidin, a high-affinity probe for polymeric F-actin,
    >>>>>>> conjugated to the red-orange fluorescent dye tetramethylrhodamine B
    >>>>>>> isothiocyanate (TRITC) (Sigma-Aldrich). Slides were then stained
    >>>>>>> with DAPI and images were acquired with an ApoTome fluorescence microscope
    >>>>>>> (Carl Zeiss). Images were then analysed using the ZEN software and cell
    >>>>>>> shape and stress fibres alignment were assessed. Changes in cell morphology
    >>>>>>> were assessed by the ImageJ software measuring the major and minor cellular
    >>>>>>> axis. Cells with axial ratios (long axis/short axis) larger than 3 were
    >>>>>>> counted in randomly selected fields in 3 separate experiments and expressed
    >>>>>>> as percentages of the total cells counted (250 cells on average).
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *Intracellular Ca2+ mobilization assay*
    >>>>>>>
    >>>>>>> Intracellular Ca2+ levels were measured using the Fluo-4 NW Calcium
    >>>>>>> Assay Kit (Invitrogen). HAoECs, seeded onto a 24-well plate with IBIDI
    >>>>>>> culture inserts in a calcium free medium, were loaded with 400 μL of Fluo-4
    >>>>>>> NW for 30 min at 37°C and 5% CO2. Fluorescence was measured for 300 sec
    >>>>>>> after treatment with α-MSH 10-8 M using the Infinite M200 PRO plate reader
    >>>>>>> (excitation, 494 nm; emission, 516 nm). Thapsigargin (10-8 M), an inhibitor
    >>>>>>> of sarco/endoplasmic reticulum Ca2+-ATPases that causes a rapid raise of
    >>>>>>> cytosolic Ca2+ by depleting endoplasmic reticulum stores [28], was used as
    >>>>>>> positive control for Ca2+i release, treating HAoECs for 120 sec before
    >>>>>>> stimulation with α-MSH (10-8 M). MC1R specific activation was assessed
    >>>>>>> pre-treating cells with the MC1R-selective antagonist 153N-6 (10-5 M) for
    >>>>>>> 15 min. Ca2+i changes were calculated as the difference between the area
    >>>>>>> under the curve (AUC) before (resting levels) and after addition of stimuli.
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *Time-course gene expression analysis by microarray*
    >>>>>>>
    >>>>>>> To isolate RNA from cells undergoing directional migration assay, we
    >>>>>>> used the Agencourt RNAdvance cell v2 kit (Beckman Coulter, Beverly, MA),
    >>>>>>> following manufacturer’s instructions. RNA extracted from migrating HAoECs
    >>>>>>> at 0.5, 3, 6, and 12h was used for microarray analysis. Labelled, linearly
    >>>>>>> amplified complementary RNA (cRNA) was generated by Illumina Total Prep RNA
    >>>>>>> Amplification Kit (Life Technologies), according to manufacturer’s manual.
    >>>>>>> Briefly, 200 ng of total RNA was reverse-transcribed to cDNA using an
    >>>>>>> oligo(dT) primer containing a T7 promoter sequence. Second-strand cDNA was
    >>>>>>> subsequently synthesized, and then *in vitro* transcribed adding
    >>>>>>> biotin-dNTPs. After column-based purification and ammonium acetate/ethanol
    >>>>>>> precipitation, cRNA was quantified by the Infinite M200 PRO plate reader.
    >>>>>>> cRNA profile of all samples was checked by the RNA 6000 Nano Assay kit in
    >>>>>>> an Agilent 2100 Bioanalyzer. cRNA (750 ng per sample) was hybridized at
    >>>>>>> 58°C for 18h on HumanHT-12 v4 Expression BeadChips (Illumina, San Diego,
    >>>>>>> CA), followed by detection signal reaction with the fluorolink
    >>>>>>> streptavidin-Cy3 (GE Healthcare Life Sciences) as recommended by
    >>>>>>> manufacturer’s instructions. Each array on the BeadChips was scanned using
    >>>>>>> an iSCAN System (Illumina). Array data export and quality control analysis
    >>>>>>> were performed with the GenomeStudio Software v2011.1 (Illumina).
    >>>>>>> Pre-processing of raw data was done by importing and analysing them with
    >>>>>>> the *lumi* package [29], in the R software environment v2.15.2.
    >>>>>>> Data variance stabilization was performed by variance stabilizing
    >>>>>>> transformation (VST). Transformed data were normalized by robust spline
    >>>>>>> normalization (RSN) algorithm, which combines the features of quantile and
    >>>>>>> loess normalization. For subsequent analysis, we retained probes with a
    >>>>>>> detection p-value < 0.01 in at least 10% samples.
    >>>>>>>
    >>>>>>> Raw and normalized, MIAME compliant microarray data are available in
    >>>>>>> the NCBI’s GEO repository under the accession number GSE49348 (
    >>>>>>> http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE49348).
    >>>>>>>
    >>>>>>> Microarray data were validated investigating mRNA expression of 84
    >>>>>>> wound healing related genes at different time points by RT-qPCR, using the
    >>>>>>> Human Wound Healing RT² Profiler PCR Arrays (Qiagen Sciences, Frederick,
    >>>>>>> MD) following manufacturers’ recommendations. The concordance of microarray
    >>>>>>> hybridization intensities (log2 transformed) with PCR data (Ct) was
    >>>>>>> measured computing the Pearson correlation coefficient and assessing its
    >>>>>>> statistical significance.
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *Statistical analysis and bioinformatics*
    >>>>>>>
    >>>>>>> Data from functional assays passed the Shapiro-Wilk test for
    >>>>>>> normality. Differences among groups were assessed by one-way ANOVA followed
    >>>>>>> by Tukey’s multiple comparisons test, or two-way ANOVA followed by
    >>>>>>> Bonferroni *post-hoc* test, as appropriate. P-values<0.05 were
    >>>>>>> annotations, *i.e.* Gene Ontology (GO) terms, KEGG pathways, and
    >>>>>>> the Swiss Prot (SP)-Protein Information Resource (PIR) keywords. Redundant
    >>>>>>> GO terms were removed using the web-based tool REViGO [32]. A network map
    >>>>>>> of the enrichment analysis was produced by the Cytoscape program v2.8.2
    >>>>>>> [33], using the Enrichment Map app [34], a network-based visualization
    >>>>>>> method for gene-set enrichment results.
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *Results*
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *Human macrovascular endothelial cells constitutively express a
    >>>>>>> functional MC1R, but not POMC*
    >>>>>>>
    >>>>>>> To determine which elements of the melanocortin system are expressed
    >>>>>>> in human ECs from large vessels, we first performed real-time PCR analysis
    >>>>>>> for detecting specific mRNAs in six human primary cells grown to
    >>>>>>> confluence, *i.e.* three aortic ECs (HAoECs) and three coronary
    >>>>>>> artery ECs (HCAECs). All the macrovascular ECs clearly expressed
    >>>>>>> *MC1R*, but no other known *MCR*s (Table 1). Cell lines expressed
    >>>>>>> the receptor mRNA at comparable levels, with the exception of one HCAEC
    >>>>>>> which showed levels twice as high as the other HCAECs. At variance with
    >>>>>>> human dermal microvascular EC [10], *POMC* was undetectable in
    >>>>>>> HAoECs and HCAECs. We detected the prohormone convertases (*PCSK1*,
    >>>>>>> *PCSK6*, *FURIN*, and *SCG5*) [35] that process POMC into most of
    >>>>>>> the derived peptides, but not *PCSK2*, which is needed to produce
    >>>>>>> α-MSH. Consistently, α-MSH was undetectable in culture supernatants of all
    >>>>>>> six macrovascular ECs (see Supplementary Fig. S2).
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *Table 1.* Expression of the MCRs, POMC, and prohormone convertases
    >>>>>>> in primary human macrovascular endothelial cells. HAoEC: human aortic
    >>>>>>> endothelial cells; HCAEC: human coronary artery endothelial cells; HA:
    >>>>>>> human astrocytes (positive control). Three different primary lines for each
    >>>>>>> type of EC were analysed by RT-qPCR: from c1,c4ECACC, c2,c5Lonza,
    >>>>>>> and c3,c6Promocell. In the upper panel, detection levels are reported as:
    >>>>>>> -, undetected; +, <35 Ct; and ++, <30 Ct. In the lower panel, MC1R
    >>>>>>> expression levels in each cell line are shown as means ± SEM of triplicate
    >>>>>>> technical replicates
    >>>>>>>
    >>>>>>> <https://www.cellphysiolbiochem.com/Articles/000094/full/Table%201.htm>
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> To verify whether the three HAoECs express the MC1R protein, we
    >>>>>>> performed immunoblot analysis. Specific immunoreactive bands, corresponding
    >>>>>>> to the molecular weight of the canonical fully active receptor [36], were
    >>>>>>> detected both in total cell lysates (see Supplementary Fig. S3A) and in
    >>>>>>> membrane extracts (Fig. 1A and S3A), showing that the MC1R receptor was
    >>>>>>> expressed on the plasma membrane of the HAoECs. Bands consistent with the
    >>>>>>> MC1R dimeric forms were also detected (see Supplementary Fig. S1 and S3A).
    >>>>>>> The level of expression of the MC1R monomer in total cell lysates was very
    >>>>>>> similar among the three primary cell lines, whereas the HAoEC no. c3
    >>>>>>> appeared to express half the quantity of the other two lines (see
    >>>>>>> Supplementary Fig. S3B and S3C). Finally, the canonical monomeric form of
    >>>>>>> the receptor was detected in all three HCAECs as well (see Supplementary
    >>>>>>> Fig. S4).
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *Fig. 1.* HAoECs express a functional MC1R. (A) Immunoblot analysis
    >>>>>>> of membrane extracts showed that all three studied primary cells express
    >>>>>>> MC1R on the plasma membrane. An anti-ATPase Na+/K+ transporting subunit
    >>>>>>> alpha 1 (ATP1A1) antibody was used as membrane-specific loading control
    >>>>>>> (upper light grey arrow). Absence of a β-actin immunoreactive band (lower
    >>>>>>> light grey arrow) excluded contamination with cytoplasmic proteins in this
    >>>>>>> preparation. The 37 kDa MC1R-specific immunoreactive band is indicated by a
    >>>>>>> grey arrow. Lanes are: M, molecular weight marker; C+, HEK293 cells
    >>>>>>> transiently transfected with the MC1R full-length cDNA (positive control);
    >>>>>>> c1, c2, c3, primary HAoECs from ECACC, Lonza, and Promocell, respectively.
    >>>>>>> (B) Intracellular cAMP concentrations were measured in confluent HAoECs
    >>>>>>> after treatment with α-MSH for 5 min, with or without the MC1R-selective
    >>>>>>> α-MSH antagonist 153N-6. Results are shown as scatter dot plots with mean ±
    >>>>>>> SD (n = 5-6 per treatment group). Statistical significance of
    >>>>>>> differences was assessed by one-way ANOVA [F(3,18) = 7.900, p=0.0014]
    >>>>>>> followed by Tukey's post-hoc test (*p<0.05, **p<0.01). (C)
    >>>>>>> Immunohistochemical detection of MC1R in a normal human aorta specimen
    >>>>>>> (10×) confirmed that HAoECs express the receptor in vivo. To control for
    >>>>>>> staining specificity, we used secondary antibody alone (left), anti-MC1R
    >>>>>>> antibody pre-adsorbed with the specific blocking peptide and secondary
    >>>>>>> antibody (centre), and anti-MC1R antibody with secondary antibody (right):
    >>>>>>> only the latter showed an intense staining.
    >>>>>>> <https://www.cellphysiolbiochem.com/Articles/000094/full/Fig%201.htm>
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> Given that MC1R is a highly polymorphic gene and that many variants
    >>>>>>> are known to affect its signal transduction [37], we sequenced the
    >>>>>>> *MC1R* ORF of the six primary human artery ECs to identify and
    >>>>>>> exclude from subsequent functional analysis those cells with gene variants
    >>>>>>> that may interfere with the cellular response to MC1R ligands. All the
    >>>>>>> three HCAECs bear a variant allele, whereas two HAoECs did not present any
    >>>>>>> polymorphism (see online suppl. material, Table S2). The variant alleles
    >>>>>>> found have been associated with a decrease in cAMP production in response
    >>>>>>> to α-MSH stimulation [38-40]. For functional testing, we elected to use the
    >>>>>>> HAoEC no. c2, which carried the wild-type receptor, due to its shorter
    >>>>>>> doubling time.
    >>>>>>>
    >>>>>>> We measured the changes in intracellular cAMP levels after treatment
    >>>>>>> with α-MSH, to test whether confluent HAoECs express a functionally active
    >>>>>>> MC1R. Indeed, 5-min stimulation with α-MSH 10-8 M induced a significant
    >>>>>>> increase of intracellular cAMP in cells grown to confluence (Fig. 1B); cAMP
    >>>>>>> elevation occurred in a concentration-dependent manner, showing a typical
    >>>>>>> inverted U-shaped dose-response curve (see Supplementary Fig. S5A) [41,
    >>>>>>> 42]. Co-incubation with the receptor antagonist 153N-6 (10-5 M) abolished
    >>>>>>> the elevation of cAMP, indicating that MC1R is specifically activated by
    >>>>>>> α-MSH (Fig. 1B).
    >>>>>>>
    >>>>>>> Finally, to test whether HAoECs express MC1R *in vivo*, we
    >>>>>>> performed immunohistochemistry staining for the receptor in
    >>>>>>> formaldehyde-fixed paraffin sections of a normal human aorta. We observed a
    >>>>>>> positive staining of endothelial cells, confirming the *in vitro* observations
    >>>>>>> (Fig. 1C).
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *α-MSH promotes migration of HAoEC via MC1R activation*
    >>>>>>>
    >>>>>>> To determine whether MC1R activation has any influence on HAoEC
    >>>>>>> migration and/or proliferation, we used a directional cell migration assay.
    >>>>>>> Stimulation with α-MSH 10-8 M enhanced HAoEC migration (Fig. 2A), and this
    >>>>>>> effect too occurred in a concentration-dependent manner (see Supplementary
    >>>>>>> Fig. S5B): in comparison with cells cultured in growth medium only,
    >>>>>>> migration speed appeared to accelerate after 3h of treatment and became
    >>>>>>> significantly higher at 9 and 12h in α-MSH-treated cells. Consistently,
    >>>>>>> concomitant use of 153N-6 10-5 M was able to abolish the
    >>>>>>> pro-migratory effect of α-MSH, whereas treatment with 153N-6 alone
    >>>>>>> did not alter EC migration speed (also see representative images in
    >>>>>>> Supplementary Fig. S6). Gap closure assays were then performed in the
    >>>>>>> presence of the proliferation inhibitor PD0332991: as expected, blocking
    >>>>>>> cell proliferation increased gap closure time, but the higher speed in
    >>>>>>> α-MSH-treated cells confirmed the enhancement in cell migration after MC1R
    >>>>>>> activation, which was still significant at 9 and 12h (Fig. 2B and
    >>>>>>> representative images in Supplementary Fig. S7A). To prove the
    >>>>>>> generalizability of the pro-migratory effect of MC1R stimulation on
    >>>>>>> macrovascular ECs, we showed that treatment with α-MSH 10-8 M significantly
    >>>>>>> enhanced cell migration also in the other HAoEC line (no. c1) bearing the
    >>>>>>> wild-type receptor, although at a lower speed (Fig. 2C and Supplementary
    >>>>>>> Fig. S7B). Finally, to ascertain whether the observed responses were
    >>>>>>> specifically dependent on the MC1R receptor subtype, we performed the same
    >>>>>>> directional cell migration assay with the HAoEC line that was found to
    >>>>>>> carry a loss-of-function allele in the *MC1R* gene (no. c3):
    >>>>>>> interestingly, these cells showed an attenuated response to α-MSH (10-8 M),
    >>>>>>> with a slight non-significant acceleration in cell migration (Fig. 2D and
    >>>>>>> Supplementary Fig. S7C). Of note, accelerated HAoEC migration upon
    >>>>>>> activation of MC1R was confirmed in *in vitro* scratch wound
    >>>>>>> healing assays (see Supplementary Fig. S8A and S8B): again, pre-treatment
    >>>>>>> with the receptor antagonist 153N-6 (10-5 M) abolished the effect.
    >>>>>>> Conversely, there was no clear-cut effect on cell proliferation following
    >>>>>>> MC1R activation, as documented by the number of Ki-67 positive cells, which
    >>>>>>> was not significantly different between treated and untreated HAoECs (see
    >>>>>>> Supplementary Fig. S9A and S9B). *MC1R* expression did not
    >>>>>>> significantly change over time during cell migration (not shown).
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *Fig. 2.* MC1R activation enhances HAoEC migration. (A) After
    >>>>>>> insert removal, HAoEC (no. c2) monolayers were treated with α-MSH 10-8 M,
    >>>>>>> with or without the MC1R-antagonist 153N-6 10-5 M, and allowed to migrate
    >>>>>>> for 3, 9, and 12h: gap closure was quantified using DiR cell staining and
    >>>>>>> near-infrared fluorescence scanning. Results are shown as mean ± SEM (n =
    >>>>>>> 6). Statistical significance of differences was assessed by two-way ANOVA [F(9,80) =
    >>>>>>> 2.957, p=0.0044, interaction time × treatment; F(3,80) = 10.85, p<0.0001,
    >>>>>>> treatment effect] with Bonferroni post-hoc test [**p<0.01,
    >>>>>>> ***p<0.001, α-MSH vs. medium alone (C)]. (B) Directional migration
    >>>>>>> assay was repeated in the presence of the proliferation inhibitor
    >>>>>>> PD0332991. Results are shown as mean ± SEM (n = 10). Statistical
    >>>>>>> significance of differences was assessed by two-way ANOVA [F(3,72) = 3.018,
    >>>>>>> p=0.0353, for interaction; F(1,72) = 9.074, p=0.0036, treatment effect]
    >>>>>>> with Bonferroni post-hoc test (*p<0.05, **p<0.01). (C) The migration assay
    >>>>>>> was repeated with HAoECs no. c1, the other cell line bearing wild-type MC1R
    >>>>>>> alleles. Results are shown as mean ± SEM (n = 4). Statistical significance
    >>>>>>> was assessed by two-way ANOVA [F(1,24) = 6.016, p=0.0218, for treatment
    >>>>>>> effect] with Bonferroni post-hoc test (**p<0.01). (D) The migration assay
    >>>>>>> was finally repeated with HAoECs no. c3, carrying a loss-of-function
    >>>>>>> mutation in the MC1R gene. Results are shown as mean ± SEM (n = 5). Two-way
    >>>>>>> ANOVA with Bonferroni post-hoc test showed no statistically significant
    >>>>>>> differences.
    >>>>>>> <https://www.cellphysiolbiochem.com/Articles/000094/full/Fig%202.htm>
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> As cell migration is preceded by changes in cell morphology and
    >>>>>>> actin filament remodelling, we evaluated whether these modifications
    >>>>>>> occurred in HAoECs after 6h from stimulation with α-MSH 10-8 M. Indeed, we
    >>>>>>> observed that MC1R activation through α-MSH induced an accelerated shift
    >>>>>>> from a "cobblestone", polygonal shape to an elongated shape in these ECs,
    >>>>>>> with rearrangement of actin filaments (Fig. 3A). Phalloidin-TRITC staining
    >>>>>>> showed formation of aligned stress fibres in α-MSH-treated cells compared
    >>>>>>> to untreated cells, whose actin filaments were mostly organized in short,
    >>>>>>> unaligned stress fibres. HAoECs were then quantified for cell elongation,
    >>>>>>> and cells stimulated with α-MSH showed a significantly higher number of
    >>>>>>> elongated cells in comparison with control cells (Fig. 3B).
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *Fig. 3.* MC1R activation enhances actin filament remodelling and
    >>>>>>> cell elongation in migrating HAoECs. (A) Non-confluent ECs were stimulated
    >>>>>>> with α-MSH for 6 h, then fixed and stained with TRITC-labelled phalloidin
    >>>>>>> for actin filament visualization, using DAPI for nuclear counterstain
    >>>>>>> (40×). Aligned stress fibres and cellular elongation are pronounced in
    >>>>>>> treated vs. untreated HAoECs. (B) Quantification of cell elongation. Cells
    >>>>>>> with axial ratios > 3 were counted in randomly selected fields and
    >>>>>>> expressed as percentages of the total cells counted. Results are shown as
    >>>>>>> scatter dot plots with mean ± SD (n = 3 per group). Statistical
    >>>>>>> significance of differences was assessed by two-tailed unpaired t test
    >>>>>>> (*p=0.0356).
    >>>>>>> <https://www.cellphysiolbiochem.com/Articles/000094/full/Fig%203.htm>
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> Since MC1R may signal through either cAMP increase or intracellular
    >>>>>>> elevation of free cytosolic Ca2+ [43], we tested which signal transduction
    >>>>>>> pathway was active in the enhancement of the HAoEC migration. Stimulation
    >>>>>>> with α-MSH 10-8 M did not lead to an increase of intracellular cAMP in
    >>>>>>> migrating HAoECs compared to control cells (see Supplementary Fig. S10). On
    >>>>>>> the contrary, MC1R activation resulted in a significant, rapid, and
    >>>>>>> sustained increase in intracellular Ca2+ levels over the control, early
    >>>>>>> after the removal of the insert in the cell migration assay (Fig. 4A). This
    >>>>>>> rise was completely abolished when HAoECs were pre-treated with the α-MSH
    >>>>>>> antagonist 153N-6 10-5 M, which in turn alone did not affect
    >>>>>>> Ca2+ signalling. Comparisons of the AUCs confirmed that the α-MSH-induced
    >>>>>>> rise in Ca2+ levels was highly significant (Fig. 4B). Incubation with
    >>>>>>> thapsigargin (10-8 M), a non-competitive inhibitor of sarco/endoplasmic
    >>>>>>> reticulum Ca2+-ATPases (SERCAs) that causes a rapid raise of cytosolic
    >>>>>>> Ca2+ by depleting endoplasmic reticulum stores [28], did not prevent a
    >>>>>>> further significant rise of Ca2+ in response to a subsequent
    >>>>>>> stimulus with α-MSH (Fig. 4C and 4D). This was almost completely
    >>>>>>> inhibited by pre-treating HAoECs with the α-MSH antagonist 153N-6 10-5 M.
    >>>>>>> Intriguingly, α-MSH 10-8 M was able to induce Ca2+ mobilization also in
    >>>>>>> confluent HAoECs, to levels comparable to those produced by thapsigargin
    >>>>>>> (see Supplementary Fig. S11). In this case, thapsigargin almost completely
    >>>>>>> hindered a further rise of Ca2+ in response to a subsequent stimulus with
    >>>>>>> α-MSH.
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *Fig. 4.* MC1R activation increases intracellular calcium levels in
    >>>>>>> migrating HAoECs. (A) Treatment with α-MSH after insert removal in the cell
    >>>>>>> migration assay induced a prompt increase in intracellular Ca2+ levels (as
    >>>>>>> detected by Fluo-4 NW fluorescent calcium indicator), which was completely
    >>>>>>> abolished by pre-treatment with the MC1R-antagonist 153N-6. (C) Rise of
    >>>>>>> intracellular Ca2+ in response to the stimulus with α-MSH was not prevented
    >>>>>>> by prior stimulation with thapsigargin (THAPS). This was inhibited by
    >>>>>>> pre-treating HAoECs with 153N-6. Arrows indicate thapsigargin or α-MSH
    >>>>>>> stimulation. Curves present the mean ± SEM of n = 5-6 independent
    >>>>>>> experiments. RFU, relative fluorescence unit. (B, D) The areas under the
    >>>>>>> curve (AUC) were used to compare α-MSH-induced effects with control
    >>>>>>> treatments. Results are shown as scatter dot plots and mean ± SD
    >>>>>>> Statistical significance of differences was assessed by one-way ANOVA [(B)
    >>>>>>> F(3,17) = 14.56, p<0.0001; (D) F(3,16) = 12.50, p=0.0001] with Tukey's
    >>>>>>> post-hoc test (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001).
    >>>>>>> <https://www.cellphysiolbiochem.com/Articles/000094/full/Fig%204.htm>
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> To further explore the Ca2+-dependency of the α-MSH-induced cell
    >>>>>>> migration, we repeated the directional cell migration assay in the presence
    >>>>>>> of the membrane-permeant Ca2+ chelator BAPTA-AM, which is widely used as an
    >>>>>>> intracellular Ca2+ sponge to control intracellular calcium ion
    >>>>>>> concentration ([Ca2+]i) [44]. The pro-migratory effect of α-MSH 10-8 M,
    >>>>>>> once more significant at 9 and 12 h, was indeed completely inhibited by
    >>>>>>> pre-treating HAoECs (no. c2) with BAPTA-AM 10-5 M (Fig. 5A), confirming
    >>>>>>> that Ca2+ mobilization via MC1R activation was involved in modulating cell
    >>>>>>> migration. Finally, since α-MSH-stimulation of MC1R may induce
    >>>>>>> [Ca2+]i elevation via activation of the PLCβ pathway [45, 46], which in
    >>>>>>> turn has a key role in mediating EC functions and angiogenesis [47], we
    >>>>>>> carried out the directional cell migration assay also in the presence of
    >>>>>>> the PLCβ inhibitor U-73122. Again, the pro-migratory effect of
    >>>>>>> α-MSH 10-8 M was inhibited by pre-treating HAoECs with U-73122 5 × 10-5 M
    >>>>>>> (Fig. 5B), suggesting that α-MSH evoked calcium mobilization/cell migration
    >>>>>>> was dependent on the activation of PLCβ.
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *Fig. 5.* Calcium chelation or PLC inhibition prevent MC1R-mediated
    >>>>>>> enhancement of HAoEC migration. (A) After insert removal, HAoEC (no. c2)
    >>>>>>> monolayers were treated with α-MSH 10-8 M, with or without pre-treatment
    >>>>>>> with the intracellular Ca2+ chelator BAPTA-AM 10-5 M, and allowed to
    >>>>>>> migrate for 3, 9, and 12h: gap closure was quantified using DiR cell
    >>>>>>> staining and near-infrared fluorescence scanning. Results are shown as mean
    >>>>>>> ± SEM (n = 5-6 per group). Statistical significance was assessed by two-way
    >>>>>>> ANOVA [F(9,68) = 2.337, p=0.0233, interaction time × treatment; F(3,68) =
    >>>>>>> 5.493, p=0.0019, treatment effect] with Bonferroni post-hoc test [*p<0.05,
    >>>>>>> **p<0.01, α-MSH vs. medium alone (C)]. (B) Directional migration assay was
    >>>>>>> carried out also pre-treating cells with the PLC inhibitor U-73122. Results
    >>>>>>> are shown as mean ± SEM (n = 5-6). Statistical significance was assessed by
    >>>>>>> two-way ANOVA [F(9,68) = 2.607, p=0.0120, for interaction; F(3,68) = 7.102,
    >>>>>>> p=0.0003, treatment effect] with Bonferroni post-hoc test (*p<0.05).
    >>>>>>> <https://www.cellphysiolbiochem.com/Articles/000094/full/Fig%205.htm>
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *Time-course expression analysis revealed several gene modules
    >>>>>>> dynamically regulated by MC1R activation*
    >>>>>>>
    >>>>>>> To evaluate the effects of MC1R activation at the transcriptional
    >>>>>>> level, we assessed genome-wide gene expression profiles at 0.5, 3, 6, and
    >>>>>>> 12h after stimulation with α-MSH 10-8 M *vs.* control in HAoECs
    >>>>>>> cultured in the directional cell migration assay. Applying stringent
    >>>>>>> filtering parameters, we deemed expressed 18936 of the 47231 measured
    >>>>>>> transcripts (40%). Comparative time-course analysis, using the STEM
    >>>>>>> algorithm [30], identified 637 genes whose expression consistently showed a
    >>>>>>> median change ≥ 30% over time as an effect of stimulation with α-MSH. These
    >>>>>>> genes fitted 57 of the 625 possible model profiles computed by the
    >>>>>>> clustering algorithm (see Supplementary Fig. S12). Five hundred and six
    >>>>>>> transcripts were associated with 15 distinct temporal profiles that showed
    >>>>>>> a statistically significant enriched number of genes at a FDR<0.05 (see
    >>>>>>> Supplementary Fig. S12 and Table S3a). The remaining 131 genes were
    >>>>>>> associated with model profiles that had a FDR>0.05 (see online suppl.
    >>>>>>> material, Table S3b) and, thus, were deemed as potentially arising from
    >>>>>>> noise by random chance and excluded from subsequent analysis.
    >>>>>>> Interestingly, we did not observe any significant change in *MC1R* expression
    >>>>>>> level in migrating ECs after stimulation with α-MSH at any time point. The
    >>>>>>> 15 significant temporal profiles of differential expression were grouped,
    >>>>>>> based on their similarity by a correlation coefficient ≥ 0.7, to form 6
    >>>>>>> different clusters (Fig. 6A and 6B). Overall, genes belonging to clusters 1
    >>>>>>> and 4 showed a marked increase in expression at 6h in treated vs. untreated
    >>>>>>> cells, whereas genes in clusters 2 and 3 displayed a marked decrease at the
    >>>>>>> same time point; conversely, genes in clusters 5 and 6 appeared to be
    >>>>>>> upregulated at 3h.
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *Fig. 6.* Significant temporal expression profiles of genes
    >>>>>>> modulated by MC1R activation in migrating HAoECs. (A) List of significantly
    >>>>>>> enriched temporal expression patterns identified by STEM analysis.
    >>>>>>> Expression profiles are grouped into six clusters based on their similarity
    >>>>>>> (r ≥ 0.7) and ordered by p-value significance within each cluster profile.
    >>>>>>> The number of genes belonging to a profile is reported. (B) Heatmap
    >>>>>>> depicting temporal expression of genes within each cluster. Genes
    >>>>>>> hierarchically clustered into 6 groups using one minus Pearson correlation
    >>>>>>> distance and the average linkage method. Data are the average log2 gene
    >>>>>>> expression ratio of α-MSH stimulated cells to non-stimulated cells (n = 3
    >>>>>>> independent experiments, with two technical replicates each). Normalized
    >>>>>>> expression ratios are shown as a gradient colour ranging from lower (blue)
    >>>>>>> to higher (gold) values.
    >>>>>>> <https://www.cellphysiolbiochem.com/Articles/000094/full/Fig%206.htm>
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> Time-course expression data of control and α-MSH stimulated cells at
    >>>>>>> 3 and 6h were validated using PCR-based arrays profiling key genes involved
    >>>>>>> in wound healing. Forty-eight genes were detected by both microarray and
    >>>>>>> real-time PCR (see Supplementary Fig. S13), with a strong positive
    >>>>>>> correlation between their average signal intensities (*r* ≥ 0.8,
    >>>>>>> p<0.0001 for all pairwise correlations).
    >>>>>>>
    >>>>>>> To uncover the biological meaning beneath these transcriptional
    >>>>>>> effects, we performed a functional enrichment analysis of the 506 regulated
    >>>>>>> genes (see online suppl. material, Table S4). Forty-four terms were
    >>>>>>> significantly enriched at p<0.01 and FDR<0.20 and were used to draw a
    >>>>>>> network to visually interpret biological data (Fig. 7). The most
    >>>>>>> significant gene sets included the phosphoprotein class (FDR<0.00002), the
    >>>>>>> endomembrane system (FDR<0.015), and the ECM-receptor interaction
    >>>>>>> (FDR<0.025). Notably, 197 of the 506 regulated genes encode for
    >>>>>>> phosphoproteins, 188 produce variant proteins by alternative splicing, and
    >>>>>>> 65 are transcription factors or regulators. Importantly, 11 genes,
    >>>>>>> *i.e.* *AGRN*, *COL1A1*, *COL1A2*, *COL4A5*, *COL5A1*, *DAG1*,
    >>>>>>> *ITGA2*, *ITGA10*, *LAMB1*, *LAMC1*, and *SPN*, belonged to either
    >>>>>>> the ECM-receptor interaction pathway or the extracellular matrix cellular
    >>>>>>> component.
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *Fig. 7.* Modules of co-regulated genes in migrating HAoECs upon
    >>>>>>> MC1R activation. The enrichment map of modulated genes was drawn as a
    >>>>>>> network of the most significant functionally annotated gene sets (p<0.01
    >>>>>>> and Benjamini FDR<0.20). Nodes represent gene sets. Node colour intensity
    >>>>>>> is relative to enrichment significance, from lower (light) to higher (dark
    >>>>>>> red). Node size is proportional to the gene set size. Gene sets are
    >>>>>>> connected by green edges based on their similarity. Edge thickness measures
    >>>>>>> the degree of the overlap between two gene sets (using a cut-off of the
    >>>>>>> Jaccard plus Overlap combined coefficient = 0.375). Clusters of tightly,
    >>>>>>> functionally related gene sets are circled and assigned an overall label.
    >>>>>>> Heat maps of temporal expression patterns of relevant gene sets and
    >>>>>>> pathways are displayed. Hierarchical clustering of genes was performed
    >>>>>>> using one minus Pearson correlation distance and the average linkage
    >>>>>>> method. Row normalized expression values are shown as a gradient colour
    >>>>>>> ranging from lower (blue) to higher (gold) values.
    >>>>>>> <https://www.cellphysiolbiochem.com/Articles/000094/full/Fig%207.htm>
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> To further analyse gene expression changes in a structured fashion,
    >>>>>>> functionally enrichment analysis was performed associating annotated gene
    >>>>>>> sets with the 6 different clusters of temporal profiles (see online suppl.
    >>>>>>> material, Table S5). Co-expressed gene subsets were visualized as temporal
    >>>>>>> clustered profiles sharing functional annotations (Fig. 8). Coupling
    >>>>>>> time-course gene expression analysis to enrichment analysis allowed
    >>>>>>> identifying significantly regulated genes that have never been associated
    >>>>>>> with MC1R signalling before, including genes involved in ECM-receptor
    >>>>>>> interaction, vesicle-mediated transport, SNARE protein complex formation,
    >>>>>>> and metal ion binding through metal-thiolate cluster structures
    >>>>>>> (metallothioneins, MTs).
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *Fig. 8.* Time-course gene cluster profiles. The 6 different
    >>>>>>> expression profiles represent time-dependent dynamic gene modulation as the
    >>>>>>> mean of significant temporal profiles grouped on the basis of their
    >>>>>>> similarity. Each cluster profile is associated with gene sets and pathways
    >>>>>>> (coloured rectangles) significant at the enrichment analysis. For cluster
    >>>>>>> 5, a gene set with a nominal p<0.05 is indicated. On the y-axes is the
    >>>>>>> log2 mean fold change (FC) relative to control cells, i.e. the log2 gene
    >>>>>>> expression ratio of α-MSH stimulated cells to non-stimulated cells; on the
    >>>>>>> x-axis is the experimental time scale (hours).
    >>>>>>> <https://www.cellphysiolbiochem.com/Articles/000094/full/Fig%208.htm>
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *Discussion*
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> In this work, we provide the first formal demonstration that human
    >>>>>>> artery ECs express constitutively a functional MC1R and present
    >>>>>>> evidence that activation of this melanocortin receptor drives faster EC
    >>>>>>> migration and wound closure. Besides, time-course gene expression
    >>>>>>> analysis allowed us identifying downstream molecular pathways associated
    >>>>>>> with the enhanced cell motility following α-MSH engagement of the MC1R.
    >>>>>>> This observation adds to the known functions of the melanocortin system,
    >>>>>>> which is known to regulate homeostasis and possess cellular and tissue
    >>>>>>> protective effects [2]. It is worth mentioning that our data are
    >>>>>>> apparently in contrast with the notion that α-MSH inhibits migration of
    >>>>>>> several cell types, such as immune/inflammatory [6, 7] or melanoma cells
    >>>>>>> [48]: our findings pinpoint that the spectrum of action of MC1R signalling
    >>>>>>> is wider and more diversified than previously thought, possibly depending
    >>>>>>> on the cell type and pathophysiological context. Similarly, α-MSH
    >>>>>>> binding to the MC1R stimulates or inhibits the proliferation respectively
    >>>>>>> of cultured human melanocytes [49] and mesothelioma cell lines [50].
    >>>>>>>
    >>>>>>> We detected both the MC1R mRNA and protein and demonstrated that it
    >>>>>>> was functionally active, since resting confluent HAoECs were able to
    >>>>>>> produce cAMP in response to exogenous α-MSH. No other component of the
    >>>>>>> melanocortin system was detectable in HAoECs. Consistently, we did not
    >>>>>>> detect α-MSH in cell culture supernatants. Thus, HAoECs are not a source of
    >>>>>>> melanocortin peptides, but may be targeted by endocrine secretion (by the
    >>>>>>> pituitary gland) or paracrine release of endogenous agonists (*e.g.* by
    >>>>>>> immune cells at injured sites) [6, 7]. These findings represent a
    >>>>>>> peculiar difference between macrovascular and microvascular ECs, as
    >>>>>>> it has been reported that HDMECs express POMC and release melanocortin
    >>>>>>> peptides upon stimulation [10]. In addition, unlike the microvascular ECs
    >>>>>>> [12], *MC1R* expression did not significantly changed upon exposure
    >>>>>>> of the HAoECs to α-MSH. This finding suggests that in macrovascular ECs
    >>>>>>> *MC1R* expression levels are not influenced by pathways that depend
    >>>>>>> on its activation and that HAoEC migration is not dependent on
    >>>>>>> *MC1R* upregulation.
    >>>>>>>
    >>>>>>> These results underline that artery ECs present cell type-restricted
    >>>>>>> gene expression, which may account for a specific physiological function
    >>>>>>> for MC1R, other than anti-inflammatory actions. This hypothesis led us to
    >>>>>>> investigate whether MC1R activation could affect macrovascular EC migration
    >>>>>>> after injury. EC migration is a fundamental process primed by damage and
    >>>>>>> involved in vascular homeostasis and repair. Our data revealed that MC1R
    >>>>>>> activation by α-MSH increased the rate of HAoEC migration, both in
    >>>>>>> gap-closure and in injury-induced wound-healing assays, without
    >>>>>>> significantly affecting cell proliferation. This effect was specifically
    >>>>>>> induced by MC1R activation, since the 153N-6 peptide antagonist at MC1R
    >>>>>>> [25] abolished the α-MSH-driven migration of HAoECs, reverting it to the
    >>>>>>> same rate of control cells. Consistently, ECs carrying a loss-of-function
    >>>>>>> mutation in the *MC1R* gene did not show a significant acceleration
    >>>>>>> in cell motility upon challenge with α-MSH. In seeming contrast to what we
    >>>>>>> observed, it has been recently reported that α-MSH inhibits *in
    >>>>>>> vitro* migration of HUVECs [51]; but this reinforces our idea that
    >>>>>>> the pro-migratory effect of α-MSH via MC1R activation is restricted to
    >>>>>>> arterial ECs of the macrovasculature. Accordingly, we observed a prompt
    >>>>>>> elevation of intracellular free Ca2+ after α-MSH stimulation in migrating
    >>>>>>> cells, but not of cAMP, suggesting that MC1R activation enhances EC
    >>>>>>> migration through the Ca2+ signalling cascade. Indeed, artificial
    >>>>>>> intracellular calcium buffering by pre-treating cells with the
    >>>>>>> cell-permeant Ca2+ chelator BAPTA-AM completely abolished the α-MSH-evoked
    >>>>>>> acceleration in EC migration. Increase of calcium levels in the cytosol is
    >>>>>>> an evolutionary conserved signal involved in the regulation of EC motility.
    >>>>>>> Ca2+ mobilization can both stabilize and weaken cell-ECM interactions
    >>>>>>> responsible for the asymmetry between cell front and rear adhesions, which
    >>>>>>> finally results in cellular directed movement [52-54].
    >>>>>>>
    >>>>>>> Intriguingly, our experiments showed that HAoEC MC1R might signal by
    >>>>>>> increasing cAMP and/or intracellular Ca2+ depending on the cellular state:
    >>>>>>> resting confluent HAoECs responded to MC1R engagement with α-MSH through
    >>>>>>> cAMP and [Ca2+]i increase, while migrating cells responded through
    >>>>>>> Ca2+ mobilization without any cAMP increase. To date, only a few reports
    >>>>>>> support an involvement of calcium as a second messenger in MC1R signalling,
    >>>>>>> besides cAMP. Ca2+ responses has been reported in HEK 293 cells transfected
    >>>>>>> with mouse *Mc1r* [55] and in human melanoma cell lines [48],
    >>>>>>> keratinocytes [56], and basophils [57] expressing MC1R. No elevation in
    >>>>>>> cAMP was detected in keratinocytes and basophils in response to α-MSH [56,
    >>>>>>> 57], whereas in melanoma cells and keratinocytes intracellular Ca2+ release
    >>>>>>> was observed only in the presence of a pharmacological adenosine agonist
    >>>>>>> that inhibits the cAMP pathway [48, 56]. Conversely, our findings provide
    >>>>>>> evidence that MC1R couples to both cAMP and Ca2+ signalling systems in
    >>>>>>> HAoECs and suggest that different functional states may direct alternative
    >>>>>>> signalling pathways in macrovascular ECs. This is remarkable: MC1R appears
    >>>>>>> to be one of those GPCRs that may simultaneously couple to distinct
    >>>>>>> unrelated G-proteins and alternatively activate multiple intracellular
    >>>>>>> effectors [58] depending on cell type, physiological condition, and the
    >>>>>>> availability of G-protein (Gαs or Gαq) adaptors [59]. Of note, in the MCR
    >>>>>>> family, alternative G-protein coupling has been reported for MC4R [60].
    >>>>>>>
    >>>>>>> In HEK 293 cells transfected with *Mc1r*, complete depletion of
    >>>>>>> *i.e.*, genes involved in the regulation of RNA transcription,
    >>>>>>> encoding for proteins for which isoforms exist due to pre-mRNA splicing
    >>>>>>> events (alternative splicing), and genes belonging to the phosphoprotein
    >>>>>>> category. This indicates that MC1R activation has a wide influence on
    >>>>>>> pathways playing a prominent role in regulating cellular activity. MC1R
    >>>>>>> activation also modulated genes associated with the endomembrane system and
    >>>>>>> intracellular organelle lumen, suggesting a role in controlling cellular
    >>>>>>> trafficking and molecule mobilization. Remarkably, MC1R engagement with
    >>>>>>> α-MSH affected the ECM-receptor interaction pathway, which is known to be
    >>>>>>> critical for the directional haptotactic EC migration [64]. Conversely,
    >>>>>>> MC1R activation did not affect the expression of cell cycle-related genes,
    >>>>>>> which was consistent with the apparent lack of effect on HAoEC
    >>>>>>> proliferation in the gap closure assay. Our findings suggest that the
    >>>>>>> regulation of the ECM components, *i.e.* collagens and laminins,
    >>>>>>> and of their receptors, *i.e.* integrins and dystroglycans, through
    >>>>>>> MC1R may drive higher HAoEC motility. α-MSH appears to boost HAoEC
    >>>>>>> migration regulating the interaction between the cellular receptor
    >>>>>>> integrins (*ITGA2* and *ITGA10*) and *DAG1* to their ECM
    >>>>>>> counterpart collagens (*COL1A1*, *COL1A2*, *COL4A5*, and *COL5A1*),
    >>>>>>> laminins (*LAMB1* and *LAMC1*) and *AGRN*. The directed motility of
    >>>>>>> ECs is strictly dependent on cell adhesion to ECM [64, 65]. Integrins and
    >>>>>>> interstitial collagen mediate haptotactic cell migration, which is of
    >>>>>>> primary importance in driving EC migration during large vessel repair [21,
    >>>>>>> 66]. Furthermore, time-course analysis evidenced that 9 genes of the
    >>>>>>> ECM-receptor interaction pathway had a similar temporal expression profile,
    >>>>>>> with a peak induction at 3h followed by a reversion at 6h, suggesting that
    >>>>>>> common factor(s) may control their co-expression. Conversely,
    >>>>>>> *ITGA2* and *SPN* showed a specular temporal profile, with a later
    >>>>>>> peak expression at 6h, which is suggestive of a sequential upregulation of
    >>>>>>> ECM-receptor interaction genes [67]. Remarkably, we showed that α-MSH
    >>>>>>> enhances EC migration along with actin filament remodelling and changes in
    >>>>>>> cell architecture. Binding of integrins to type-I collagen suppresses cAMP
    >>>>>>> production and the activity of cAMP-dependent protein kinase A:
    >>>>>>> consequently, actin polymerization is induced, contributing to the
    >>>>>>> formation of stress fibres and to EC contractility, which finally generates
    >>>>>>> the directional movement [68]. This is consistent with the idea that the
    >>>>>>> fine-tuning of integrins and their binding molecules promoted by MC1R
    >>>>>>> activation plays a key role in conditioning HAoEC migration rate. In
    >>>>>>> addition, MC1R stimulation induced an early upregulation of SNARE proteins
    >>>>>>> (which mediate vesicle-membrane fusion) and cytoplasmic vesicle genes,
    >>>>>>> followed by a later overexpression of metal-binding proteins. Importantly,
    >>>>>>> trafficking and delivery/fusion vesicle proteins are essential for the
    >>>>>>> regulation of front-rear polarity during directional cell migration [69,
    >>>>>>> 70]. Likewise, MTs enhance EC motility [71] and angiogenesis [72] through
    >>>>>>> transcriptional regulation of various vascular growth-factors, and their
    >>>>>>> modulation drove suppression of reactive oxygen species production in ECs
    >>>>>>> exposed to elevated laminar shear stress [73]. Such a pattern of temporal
    >>>>>>> dynamics in gene expression (*i.e.* ECM-receptor interaction,
    >>>>>>> SNARE, or MT genes) is expected as an "impulse response" to a transient
    >>>>>>> signal, namely a single pulse of α-MSH [74]. This typical oscillating wave
    >>>>>>> of co-expressed genes may reflect a highly ordered temporal organization in
    >>>>>>> gene transcription, which ultimately results in the subsequent, coordinated
    >>>>>>> translation into the corresponding effector proteins that drive the
    >>>>>>> α-MSH-mediated increase in EC migration speed. Consistently, the peaks in
    >>>>>>> gene expression were followed at 6-12 hours by a transition to the steady
    >>>>>>> state.
    >>>>>>>
    >>>>>>> In summary, MC1R activation via α-MSH appears to accelerate
    >>>>>>> directional HAoEC migration through the following steps: (*a*)
    >>>>>>> binding of melanocortin hormones to MC1R induces (*b*) an increase
    >>>>>>> in cytosolic Ca2+ while preventing a rise in cAMP biosynthesis, through a
    >>>>>>> putative alternative G-protein coupling and PLC-pathway activation, and
    >>>>>>> subsequently (*c*) the coordinate modulation of genes of the
    >>>>>>> ECM-receptor interaction, vesicle- and SNARE-mediated trafficking pathways,
    >>>>>>> and metal sensing proteins, (*d*) possibly regulating the cell
    >>>>>>> front-rear polarity. These responses reflect an unrecognized protective
    >>>>>>> function of the melanocortin system, which is fostered by previously
    >>>>>>> unreported α-MSH-activated, MC1R-mediated signalling and molecular pathways.
    >>>>>>>
    >>>>>>> MC1R tonic signalling and pro-migratory action may be relevant for
    >>>>>>> the homeostatic functions of the arterial endothelium. The endothelium
    >>>>>>> monolayer lining in the luminal side of blood vessels plays a pivotal role
    >>>>>>> in the regulation of the haemostatic balance, prevention of vascular
    >>>>>>> inflammation, and protection against vascular injury [75]. Normal ECs
    >>>>>>> express a number of inhibitors of platelet and leukocyte activation,
    >>>>>>> vasodilators, and anticoagulant and procoagulant molecules. Damage to these
    >>>>>>> cells is associated with a shift in the haemostatic balance to the
    >>>>>>> procoagulant side [15], loss of protective molecules and expression of
    >>>>>>> adhesive, inflammatory and mitogenic factors, leading to the development of
    >>>>>>> thrombosis, pathologic remodelling, and atherosclerosis [75]. Endothelial
    >>>>>>> dysfunction is characterized by an imbalance between procoagulant and
    >>>>>>> anticoagulant mediators and regenerated arterial endothelium may be
    >>>>>>> functionally incompetent with reduced expression of antithrombotic
    >>>>>>> molecules [15, 76]. EC migration is a key event in wound healing and tissue
    >>>>>>> regeneration, including reendothelialisation after stent implantation [76].
    >>>>>>> Remarkably, MC1R activation in migrating HAoEC did not alter the balance
    >>>>>>> between pro- and anticoagulant genes, *i.e.* expression of
    >>>>>>> procoagulant (such as *VWF*, *F2R*, and *F3*) and anticoagulant
    >>>>>>> genes (*THBD*, *HSPG*, *EPCR*, and *TFPI*) was not affected by
    >>>>>>> α-MSH. Thus, MC1R activation may have beneficial effects both ameliorating
    >>>>>>> HAoEC motility properties and maintaining the equilibrium between pro- and
    >>>>>>> anticoagulant signals.
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *Conclusion*
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> Our work broadens the knowledge on MCR regulatory roles and supports
    >>>>>>> the concept of a novel function for peripherally expressed MC1R, whose
    >>>>>>> signalling may participate in preventing/healing of artery endothelial
    >>>>>>> dysfunction, vascular repair, and reendothelialisation. Endothelial artery
    >>>>>>> MC1R could represent a target for original therapeutic strategies aimed at
    >>>>>>> preventing/repairing endothelial injury in a variety of cardiovascular
    >>>>>>> pathological conditions associated with endothelial denudation [20].
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *Acknowledgements*
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> We thank Dr Chiara Speroni for help and excellent technical
    >>>>>>> assistance. We thank Fondazione Banca di Treviso ONLUS for kindly providing
    >>>>>>> us with the human aorta specimen. This study was supported by Institutional
    >>>>>>> Research Funds (Italian Ministry of Health, Funds 5‰ 2009-11; to G.I.C.).
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> *Disclosure Statement*
    >>>>>>>
    >>>>>>>
    >>>>>>>
    >>>>>>> The authors declare no conflict of interests.
    >>>>>>> On Tuesday, September 21, 2021 at 9:36:57 PM UTC-7 Uhohinc wrote:
    >>>>>>>
    >>>>>>>> RESEARCH PAPER
    >>>>>>>>
    >>>>>>>> The melanocortin MC1 receptor agonist BMS-470539 inhibits
    >>>>>>>> leucocyte trafficking in the inflamed vasculature
    >>>>>>>> G Leoni
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/action/doSearch?ContribAuthorRaw=Leoni%2C+G>
    >>>>>>>> ,M-B Voisin
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/action/doSearch?ContribAuthorRaw=Voisin%2C+M-B>
    >>>>>>>> ,K Carlson
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/action/doSearch?ContribAuthorRaw=Carlson%2C+K>
    >>>>>>>> ,SJ Getting
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/action/doSearch?ContribAuthorRaw=Getting%2C+SJ>
    >>>>>>>> ,S Nourshargh
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/action/doSearch?ContribAuthorRaw=Nourshargh%2C+S>
    >>>>>>>> ,M Perretti
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/action/doSearch?ContribAuthorRaw=Perretti%2C+M>
    >>>>>>>> ,
    >>>>>>>> First published: 13 April 2010
    >>>>>>>>
    >>>>>>>> https://doi.org/10.1111/j.1476-5381.2010.00688.x
    >>>>>>>> Citations: 27
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#citedby-section>
    >>>>>>>> SECTIONS
    >>>>>>>> PDF
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/epdf/10.1111/j.1476-5381.2010.00688.x>
    >>>>>>>> TOOLS
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#>
    >>>>>>>>
    >>>>>>>> SHARE
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#>
    >>>>>>>> Abstract
    >>>>>>>>
    >>>>>>>> *Background and purpose: *Over three decades of research
    >>>>>>>> evaluating the biology of melanocortin (MC) hormones and synthetic
    >>>>>>>> peptides, activation of the MC type 1 (MC1) receptor has been identified as
    >>>>>>>> a viable target for the development of novel anti-inflammatory therapeutic
    >>>>>>>> agents. Here, we have tested a recently described selective agonist of
    >>>>>>>> MC1 receptors, BMS-470539, on leucocyte/post-capillary venule interactions
    >>>>>>>> in murine microvascular beds.
    >>>>>>>>
    >>>>>>>> *Experimental approach: *Intravital microscopy of two murine
    >>>>>>>> microcirculations were utilized, applying two distinct modes of promoting
    >>>>>>>> inflammation. The specificity of the effects of BMS-470539 was assessed
    >>>>>>>> using mice bearing mutant inactive MC1 receptors (the recessive yellow e/e
    >>>>>>>> colony).
    >>>>>>>>
    >>>>>>>> *Key results: *BMS-470539, given before an ischaemia–reperfusion
    >>>>>>>> protocol, inhibited cell adhesion and emigration with no effect on cell
    >>>>>>>> rolling, as assessed 90 min into the reperfusion phase. These properties
    >>>>>>>> were paralleled by inhibition of tissue expression of both CXCL1 and CCL2.
    >>>>>>>> Confocal investigations of inflamed post-capillary venules revealed
    >>>>>>>> immunostaining for MC1 receptors on adherent and emigrated leucocytes.
    >>>>>>>> Congruently, the anti-inflammatory properties of BMS-470539 were lost in
    >>>>>>>> mesenteries of mice bearing the inactive mutant MC1 receptors. Therapeutic
    >>>>>>>> administration of BMS-470539 stopped cell emigration, but did not affect
    >>>>>>>> cell adhesion in the cremasteric microcirculation inflamed by superfusion
    >>>>>>>> with platelet-activating factor.
    >>>>>>>>
    >>>>>>>> *Conclusions and implications: *Activation of MC1 receptors
    >>>>>>>> inhibited leucocyte adhesion and emigration. Development of new chemical
    >>>>>>>> entities directed at MC1 receptors could be a viable approach in the
    >>>>>>>> development of novel anti-inflammatory therapeutic agents with potential
    >>>>>>>> application to post-ischaemic conditions.
    >>>>>>>> Abbreviations:
    >>>>>>>>
    >>>>>>>> - ACTH
    >>>>>>>> - adrenocorticotrophin
    >>>>>>>> - αMSH
    >>>>>>>> - alpha-melanocyte-stimulating hormone
    >>>>>>>> - IR
    >>>>>>>> - ischaemia–reperfusion
    >>>>>>>> - LPS
    >>>>>>>> - lipolysaccharide
    >>>>>>>> - PAF
    >>>>>>>> - platelet-activating factor
    >>>>>>>>
    >>>>>>>> Introduction
    >>>>>>>>
    >>>>>>>> The concept of active resolution in inflammation has, in recent
    >>>>>>>> years, gained such momentum that several studies are detailing the
    >>>>>>>> mechanisms that ensure the correct time – and spatial – dependence of this
    >>>>>>>> important phase of the host response. Specific pathways are activated in
    >>>>>>>> the body to ensure that, for instance, the process of leucocyte migration,
    >>>>>>>> which is incited by several classes of pro-inflammatory mediators and
    >>>>>>>> adhesion molecules (Ley *et al.*, 2007
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b27>),
    >>>>>>>> will subside over time in an active mode (Serhan and Savill, 2005
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b34>
    >>>>>>>> ; Gonzalez-Rey and Delgado, 2007
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b19>
    >>>>>>>> ; Serhan *et al.*, 2007
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b33>
    >>>>>>>> ).
    >>>>>>>>
    >>>>>>>> α-Melanocyte-stimulating hormone (α-MSH) and adrenocorticotrophin
    >>>>>>>> (ACTH) are endogenous polypeptides that belong to the group of endogenous
    >>>>>>>> anti-inflammatory mediators (Gonzalez-Rey and Delgado, 2007
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b19>
    >>>>>>>> ; Brzoska *et al.*, 2008
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b3>).
    >>>>>>>> These molecules activate specific receptors, melanocortin (MC) receptors
    >>>>>>>> (nomenclature follows Alexander *et al.*, 2009
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b1>),
    >>>>>>>> which inhibit, on one hand, the production of pro-inflammatory cytokines
    >>>>>>>> from target cells (Catania *et al.*, 2004
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b5>),
    >>>>>>>> and, on the other, put in motion pro-resolving processes including the
    >>>>>>>> induction of haem oxygenase 1 (Lam *et al.*, 2005
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b24>).
    >>>>>>>> In integrated systems, these molecular and cellular events would lead to a
    >>>>>>>> tight control on the experimental inflammatory response preventing its
    >>>>>>>> overshooting.
    >>>>>>>>
    >>>>>>>> From a pathophysiological perspective, compelling evidence for the
    >>>>>>>> inhibitory functions of this pathway derives from the exacerbation of
    >>>>>>>> colitis observed in mice bearing an inactive MC1 receptor (the recessive
    >>>>>>>> yellow e/e mouse colony) (Maaser *et al.*, 2006
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b30>).
    >>>>>>>> On the other hand, MC3 receptor null mice present a higher degree of
    >>>>>>>> vascular inflammation following an ischaemia–reperfusion (IR) insult (
    >>>>>>>> Leoni *et al.*, 2008
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b26>).
    >>>>>>>> This response is associated with higher levels of pro-inflammatory
    >>>>>>>> cytokines as measured in injured tissues. The same holds true in
    >>>>>>>> MC3 null mice after 3 months of high-fat diet, where augmented tissue
    >>>>>>>> expression of pro-inflammatory chemokines occurs during development of an
    >>>>>>>> obese-like status (Trevaskis *et al.*, 2007
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b36>
    >>>>>>>> ).
    >>>>>>>>
    >>>>>>>> Natural and synthetic MC peptides bring about homeostatic and
    >>>>>>>> anti-inflammatory actions by activating either MC1 or MC3 receptors.
    >>>>>>>> Utilization of agonists with different degrees of selectivity for these
    >>>>>>>> receptors produces remarkable tissue-protective and anti-inflammatory
    >>>>>>>> effects (Brzoska *et al.*, 2008
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b3>).
    >>>>>>>> Three decades of research into the biology of MC peptides and their
    >>>>>>>> receptors on their effect on innate immunity presents an opportunity to
    >>>>>>>> exploit this immunomodulatory system for therapeutic development (
    >>>>>>>> Catania *et al.*, 2004
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b5>
    >>>>>>>> ; Getting, 2006
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b12>
    >>>>>>>> ; Brzoska *et al.*, 2008
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b3>).
    >>>>>>>> Modification of short sequences of natural MCs is a viable way forward in
    >>>>>>>> drug development (Grieco *et al.*, 2000
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b20>
    >>>>>>>> ; Brzoska *et al.*, 2008
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b3>
    >>>>>>>> ; Doi *et al.*, 2008
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b9>).
    >>>>>>>> Another way forward would lie in the identification and development of
    >>>>>>>> novel chemical entities that would activate, selectively, either MC1 or
    >>>>>>>> MC3 receptors, and this goal has recently been achieved for MC1 receptors. The
    >>>>>>>> compound, BMS-470539, binds to human MC1 receptors in the low nanomolar
    >>>>>>>> range, and, in mice, inhibits lipopolysaccharide (LPS)-induced systemic
    >>>>>>>> tumour necrosis factor (TNF) release and LPS-induced leucocyte migration
    >>>>>>>> into the lung (Kang *et al.*, 2006
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b22>
    >>>>>>>> ).
    >>>>>>>>
    >>>>>>>> Our recent study performed with MC3 receptor null mice demonstrated
    >>>>>>>> expression of MC1 receptor mRNA and protein in the post-ischaemic tissue (
    >>>>>>>> Leoni *et al.*, 2008
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b26>);
    >>>>>>>> we tested here whether BMS-470539 would exert anti-inflammatory actions on
    >>>>>>>> the vascular inflammation in the mesentery that follows an IR procedure.
    >>>>>>>> These data have been extended to another protocol for intravital microscopy
    >>>>>>>> using a distinct microvascular bed (cremasteric microcirculation) and
    >>>>>>>> inflammatory stimulus [topically applied platelet-activating factor (PAF)].
    >>>>>>>> Finally, we determined whether these pharmacological effects of BMS-470539
    >>>>>>>> were mediated by activation of endogenous MC1 receptors using mice bearing
    >>>>>>>> a mutant and inactive receptor.
    >>>>>>>> Materials and methodsAnimals
    >>>>>>>>
    >>>>>>>> All animal care and experimental protocols complied with the
    >>>>>>>> guidelines laid down by the Ethical Committee for the Use of Animals, Barts
    >>>>>>>> and The London School of Medicine and the Home Office regulations (Guidance
    >>>>>>>> on the Operation of Animals, Scientific Procedures Act, 1986). Male mice
    >>>>>>>> (2–3 weeks old, ∼20 g body weight) were maintained on a standard chow
    >>>>>>>> pellet diet and had free access to water, with a 12 h light/dark cycles.
    >>>>>>>> Wild-type (WT) animals (strain C57BL/6J; B & K, Hull, UK) were used 7 days
    >>>>>>>> after arrival. The MC1 receptor recessive yellow (e/e) mouse colony bearing
    >>>>>>>> a frameshift mutation in the MC1 receptor gene (Robbins *et al.*,
    >>>>>>>> 1993
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b31>)
    >>>>>>>> were originally a gift from Dr Nancy Levin (Trega Bioscience, San Diego,
    >>>>>>>> CA, USA).
    >>>>>>>> *In vivo* models of vascular inflammation
    >>>>>>>>
    >>>>>>>> *Intravital microscopy in the mesenteric microcirculation. * Intravital
    >>>>>>>> microscopy was performed as previously reported (Leoni *et al.*,
    >>>>>>>> 2008
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b26>).
    >>>>>>>> The mice were anaesthetized with a mixture of xylazine (7.5 mg·kg−1) and
    >>>>>>>> ketamine (150 mg·kg−1), and kept warm at 37°C with a heating pad. A
    >>>>>>>> polyethlylene catheter (PE-10 with an internal diameter of 0.28 mm) was
    >>>>>>>> placed into the internal jugular vein for administration of drugs.
    >>>>>>>> Mesenteric ischaemia was induced with a micro-aneurysm clip (Harvard
    >>>>>>>> Apparatus, Kent, UK), clamping the superior mesenteric artery for 35 min.
    >>>>>>>> The clip was then removed, and reperfusion was allowed for 90 min (for
    >>>>>>>> evaluation of white blood cell reactivity). Sham-operated animals underwent
    >>>>>>>> the same surgical procedure except clamping of the superior mesenteric
    >>>>>>>> artery.
    >>>>>>>>
    >>>>>>>> The mesenteric vascular bed was exteriorized; after positioning the
    >>>>>>>> microcirculation under the microscope, a 5 min equilibration period
    >>>>>>>> preceded the recording of quantitative measurements. Analyses of
    >>>>>>>> leucocyte–endothelium interactions were made in three to four randomly
    >>>>>>>> selected post-capillary venules (diameter between 20 and 40 µm; visible
    >>>>>>>> length of at least 100 µm) for each mouse.
    >>>>>>>>
    >>>>>>>> Quantification of microcirculatory parameters was performed
    >>>>>>>> off-line by frame-to-frame analysis of the videotaped images. White blood
    >>>>>>>> cell rolling velocity (*V*WBC) was determined from the time
    >>>>>>>> required for a leucocyte to roll a given distance along the length of the
    >>>>>>>> venule, and is reported in·µm·s−1. Rolling cell flux was determined by
    >>>>>>>> counting the number of leucocytes passing a reference point in the venule
    >>>>>>>> per minute, and expressed as cells per minute (cell·min−1). Leucocyte
    >>>>>>>> adhesion was measured by counting clearly visible cells on the vessel wall
    >>>>>>>> in a 100 µm stretch. An adherent cell was defined as a cell that had
    >>>>>>>> remained stationary for 30 s or longer. Leucocyte emigration from the
    >>>>>>>> microcirculation into the tissue was calculated by counting the number of
    >>>>>>>> cells in a 100 × 50 µm2 area on both sides of the 100 µm vessel segment.
    >>>>>>>> Red blood cell centreline velocity was measured in venules with an optical
    >>>>>>>> Doppler velocimeter (Microcirculation Research Institute, Texas A&M
    >>>>>>>> University, Dallas, TX, USA), and venular wall shear rate was determined
    >>>>>>>> based on the Newtonian definition: wall shear rate = 8000 [(red blood cell
    >>>>>>>> velocity/1.6)/venular diameter].
    >>>>>>>>
    >>>>>>>> *Drug treatment. * The selective MC1 receptor agonist BMS-470539 (
    >>>>>>>> Herpin *et al.*, 2003
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b21>)
    >>>>>>>> was used both in WT and MC1 receptor recessive e/e mice. The compound (MW =
    >>>>>>>> 559.697) was given in a dose range and route of administration, shown to be
    >>>>>>>> inhibitory in three distinct models of inflammation (Kang *et al.*,
    >>>>>>>> 2006
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b22>).
    >>>>>>>> Therefore, doses of 18.47, 6.16 and 2.05 mg·kg−1 (corresponding to 33, 11
    >>>>>>>> and 2.9 µmol·kg−1, respectively) were given i.v. (via jugular vein) in a
    >>>>>>>> fresh solution of PBS (100 µL per mouse) before inducing ischaemia.
    >>>>>>>>
    >>>>>>>> *Intravital microscopy in the cremasteric microcirculation. * Intravital
    >>>>>>>> microscopy was used to observe PAF-induced leucocyte responses within the
    >>>>>>>> cremasteric microcirculation, adopting a protocol used to monitor events in
    >>>>>>>> the microcirculation in real time (Chatterjee *et al.*, 2005
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b6>).
    >>>>>>>> Briefly, the cremaster was dissected free of skin and fascia, opened and
    >>>>>>>> superfused with bicarbonate-buffered saline (in mM: 131.92, NaCl; 3.35,
    >>>>>>>> KCl; 1.16, MgSO4; 17.97, NaHCO3; and 1.98, CaCl2, pH 7.4, 37°C) at a rate
    >>>>>>>> of 2 mL·min−1. During the 30 min stabilization period, a post-capillary
    >>>>>>>> venule (diameter between 20 and 40 µm; length > 100 µm) was selected; then,
    >>>>>>>> 100 nM PAF (C16 form: C26H54NO7P; Sigma-Aldrich, Poole, UK) was added to
    >>>>>>>> the superfusion buffer. One minute recordings were made with a Hamamatsu
    >>>>>>>> C9300 digital camera (Intelligent Imaging Innovations, Göttingen, Germany)
    >>>>>>>> every 15 min up to 120 min. In some experiments, 60 min after PAF
    >>>>>>>> stimulation, BMS-470539 was administered i.v. at dose 33 µmol·kg−1.
    >>>>>>>> Leucocyte cell rolling, firm adhesion and transmigration in post-capillary
    >>>>>>>> venules with a wall shear rate ≥ 500·s–1 were quantified as previously
    >>>>>>>> described.
    >>>>>>>> *Ex-vivo* analyses
    >>>>>>>>
    >>>>>>>> *elisa measurements. * At the end of the intravital microscopy
    >>>>>>>> procedure, mesentery tissues were harvested and stored at −80°C. Mesenteric
    >>>>>>>> tissue fragments of sham-operated animals and mice subjected to IR were
    >>>>>>>> homogenized in 1 mL of PBS containing anti-proteases (0.1 mM phenylmethyl
    >>>>>>>> sulphonyl fluoride, 0.1 mM benzethonium chloride, 10 mM EDTA and 20 IU
    >>>>>>>> aprotinin A) and 0.05% Tween 20. Quantitative elisa to monitor tissue
    >>>>>>>> content of mouse CCL2 (MCP-1) and CXCL1 (KC) was run according to the
    >>>>>>>> manufacturer's instructions (R&D System Europe, Oxford, UK).
    >>>>>>>>
    >>>>>>>> *Tissue myeloperoxidase (MPO) activity. * Leucocyte MPO activity
    >>>>>>>> was assessed by measuring the H2O2-dependent oxidation of
    >>>>>>>> 3,3′,5,5′-tetramethylbenzidine (TMB) following a well-validated protocol (
    >>>>>>>> Cuzzocrea *et al.*, 1997
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b7>
    >>>>>>>> ; Gavins *et al.*, 2005
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b11>
    >>>>>>>> ; Leoni *et al.*, 2008
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b26>).
    >>>>>>>> Briefly, mesenteric tissue samples from sham- and I/R-treated mice were
    >>>>>>>> homogenized in PBS containing 0.5% hexadecyl trimethylammonium bromide
    >>>>>>>> (HTAB) detergent. The homogenate was centrifuged at 13 000×*g* for
    >>>>>>>> 5 min prior to adding 20 µL supernatant volumes to 160 µL of 2.8 mM of TMB,
    >>>>>>>> and 20 µL of 0.1 mM of H2O2 in 96-well plates. The plates were incubated
    >>>>>>>> for 5 min at room temperature, and optical density was read at 620 nm using
    >>>>>>>> GENios (TECAN, Reading, UK). Assays were performed in duplicate and
    >>>>>>>> normalized for protein content (BCA protein assay, Pierce, UK).
    >>>>>>>>
    >>>>>>>> *Confocal analyses. * Whole-mount immunostaining of tissues was
    >>>>>>>> performed as previously described with few modifications (Voisin *et 
    >>>>>>>> al.*, 2010
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b37>).
    >>>>>>>> Briefly, the mice were humanely killed, and tissues of interest (cremaster
    >>>>>>>> muscle and mesenteric tissue) were dissected and immediately fixed by
    >>>>>>>> placing into PBS plus 4% paraformaldehyde for 30 min at 4°C. Following
    >>>>>>>> fixation, whole-mounted tissues were blocked and permeabilized in PBS
    >>>>>>>> containing 10% normal goat serum, 10% FCS, 5% normal mouse serum and 0.5%
    >>>>>>>> Triton X-100 for 2 h at room temperature. The tissues were then
    >>>>>>>> immunostained with antibodies against the leucocyte marker CD45
    >>>>>>>> (APC-conjugated anti-CD45, Cambridge Bioscience, Cambridge, UK), the
    >>>>>>>> α-smooth muscle actin (α-SMA) to detect the pericytes, and thus the
    >>>>>>>> vasculature (cy3-conjugated anti-α-SMA, Sigma-Aldrich) and the
    >>>>>>>> anti-MC1 receptor (Sigma) in PBS + 10% FCS at 4°C for 3 days. Following
    >>>>>>>> three washes in PBS, the tissues were incubated with a 488-conjugated
    >>>>>>>> anti-rabbit secondary antibody, for 3–4 h at 4°C in PBS + 10% FCS. The
    >>>>>>>> samples were then viewed using a Leica SP5 confocal (Leica Microsystems,
    >>>>>>>> Milton Keynes, UK) incorporating a ×20 water-dipping objective (NA: 1.0) at
    >>>>>>>> 20–24°C. Z-stack images acquired with sequential scanning of the different
    >>>>>>>> channels were used for 3D reconstruction of whole vessels (200 µm length;
    >>>>>>>> four to six vessels per tissue) with the image-processing software IMARIS
    >>>>>>>> (Bitplane, Zurich, Switzerland).
    >>>>>>>> Data analysis
    >>>>>>>>
    >>>>>>>> All data are reported as mean ± SEM of *n* observations, using at
    >>>>>>>> least five mice per group. Statistical evaluation was performed
    >>>>>>>> using anova (Prism GraphPad software) with Bonferroni test for *post
    >>>>>>>> hoc* analyses, taking a *P* value < 0.05 as significant.
    >>>>>>>> Materials
    >>>>>>>>
    >>>>>>>> Ketamine hydrochloride was from Hoffman-La Roche, Basel
    >>>>>>>> Switzerland, and xylazine was from Janssen Pharmaceutica, Beerse, Belgium.
    >>>>>>>> The components of the MPO assay [TMB, H202 (30%), HTAB and MPO from human
    >>>>>>>> leucocytes] were all from Sigma Aldrich. BMS-470539 was a generous gift
    >>>>>>>> from Dr Timothy Herpin (Bristol-Meyers Squibb).
    >>>>>>>> ResultsEffects of BMS-470539 on the mesenteric microcirculation
    >>>>>>>>
    >>>>>>>> Application of the 35 + 90 min IR procedure to the mouse mesentery
    >>>>>>>> elicited the expected high degree of vascular inflammation in
    >>>>>>>> post-capillary venules (Figure 1
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#f1>).
    >>>>>>>> A sharp reduction in rolling velocity, associated with ∼3-fold increase in
    >>>>>>>> cell adhesion and emigration, could be consistently measured in IR tissues
    >>>>>>>> compared to sham-operated tissues.
    >>>>>>>>
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/cms/asset/e87913e5-a64b-4b04-9a36-34a3583fb101/bph_688_f1.gif>
    >>>>>>>> Figure 1
    >>>>>>>> Open in figure viewer
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#>
    >>>>>>>> PowerPoint
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/action/downloadFigures?id=f1&doi=10.1111%2Fj.1476-5381.2010.00688.x>
    >>>>>>>>
    >>>>>>>> Anti-inflammatory properties of BMS-470539 in the post-ischaemic
    >>>>>>>> mesenteric microcirculation. The mice were subjected to occlusion of the
    >>>>>>>> superior mesenteric artery (35 min) followed by 90 min reperfusion. A sham
    >>>>>>>> group (laparotomy but no occlusion of the artery) was also analysed.
    >>>>>>>> Vehicle or BMS-470539 was given i.v. (prior to inducing ischaemia).
    >>>>>>>> Cellular responses in the inflamed post-capillary venule were determined 90 
    >>>>>>>> min post-reperfusion, monitoring cell rolling as *V*WBC (A), cell
    >>>>>>>> adhesion (B) and cell emigration (C). Data are mean ± SEM of six mice per
    >>>>>>>> group. ****P* < 0.001, PBS I/R versus respective sham group; #*P* <
    >>>>>>>> 0.05, ##*P* < 0.01, ###*P* < 0.001 versus respective vehicle I/R
    >>>>>>>> group.
    >>>>>>>>
    >>>>>>>> Treatment of mice with BMS-470539 did not modify the IR-induced
    >>>>>>>> reduction in *V*WBC of rolling leucocytes (Figure 1A
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#f1>).
    >>>>>>>> In contrast, a dose-dependent inhibition of the extent of IR-induced
    >>>>>>>> leucocyte adhesion (Figure 1B
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#f1>)
    >>>>>>>> and emigration (Figure 1C
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#f1>)
    >>>>>>>> was observed, with significant reduction at doses of 6.16 and 18.47 
    >>>>>>>> mg·kg−1. The top dose of BMS-470539 (18.47 mg·kg−1; 660 nmol per mouse)
    >>>>>>>> brought IR-induced values of cell adhesion and emigration back to those
    >>>>>>>> measured in sham-operated mice, whereas the intermediate dose of 6.16 
    >>>>>>>> mg·kg−1 (corresponding to 123 nmol per mouse) significantly and selectively
    >>>>>>>> affected cell adhesion (∼50% reduction; *P* < 0.05) (Figure 1B
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#f1>).
    >>>>>>>> The lowest dose tested of 2.05 mg·kg−1 was ineffective on all parameters
    >>>>>>>> under observation.
    >>>>>>>>
    >>>>>>>> These inhibitory properties displayed by BMS-470539 prompted us to
    >>>>>>>> determine other parameters of mesenteric tissue inflammation, focusing on
    >>>>>>>> the most effective dose of 18.47 mg·kg−1. Figure 2
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#f2> reports
    >>>>>>>> these data displaying the reduction in tissue levels of CCL2 (Figure 
    >>>>>>>> 2A
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#f2>)
    >>>>>>>> and CXCL1 (Figure 2B
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#f2>)
    >>>>>>>> upon BMS-470539 treatment. For both chemokines, tissue expression of these
    >>>>>>>> chemokines was reduced to levels similar to those measured in sham-operated
    >>>>>>>> tissue samples (Figure 2A,B
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#f2>).
    >>>>>>>> MPO activity was increased after the IR procedure, and although not
    >>>>>>>> statistically significant, treatment with BMS-470539 resulted in a trend
    >>>>>>>> towards normalization of MPO activity (Figure 2C
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#f2>
    >>>>>>>> ).
    >>>>>>>>
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/cms/asset/1ac2c458-8ffb-4036-9ac2-558251c30678/bph_688_f2.gif>
    >>>>>>>> Figure 2
    >>>>>>>> Open in figure viewer
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#>
    >>>>>>>> PowerPoint
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/action/downloadFigures?id=f2&doi=10.1111%2Fj.1476-5381.2010.00688.x>
    >>>>>>>>
    >>>>>>>> BMS-470539 reduces IR-induced tissue chemokine expression. WT mice
    >>>>>>>> were treated as in Figure 1
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#f1>,
    >>>>>>>> with BMS-470539 being given at the highest dose of 18.57 mg·kg−1. A sham
    >>>>>>>> group (laparotomy but no occlusion of the artery) was also analysed. At the
    >>>>>>>> end of the IR protocol, mesenteries were homogenized and protein extracts
    >>>>>>>> used for the elisa assays to determine tissue content of CCL2 (A), CXCL1
    >>>>>>>> (B) and MPO activity (C). Data are mean ± SEM of six mice per group. *
    >>>>>>>> *P* < 0.05 versus respective sham group; #*P* < 0.05 versus
    >>>>>>>> respective vehicle I/R group.
    >>>>>>>>
    >>>>>>>> In recessive yellow e/e mice, the IR procedure produced a high
    >>>>>>>> degree of vascular inflammation, with marked attenuation in *V*WBC and
    >>>>>>>> increments in the extent of cell adhesion and emigration (Figure 3
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#f3>).
    >>>>>>>> When statistical comparisons were made for each variable, no significant
    >>>>>>>> difference between WT and recessive yellow e/e mice emerged for either cell
    >>>>>>>> rolling, adhesion or emigration (compare Figure 3
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#f3>
    >>>>>>>> with Figure 1
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#f1>
    >>>>>>>> ).
    >>>>>>>>
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/cms/asset/949f9f6c-7fc0-4bee-a554-7c8778a4019b/bph_688_f3.gif>
    >>>>>>>> Figure 3
    >>>>>>>> Open in figure viewer
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#>
    >>>>>>>> PowerPoint
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/action/downloadFigures?id=f3&doi=10.1111%2Fj.1476-5381.2010.00688.x>
    >>>>>>>>
    >>>>>>>> Lack of effect of BMS-470539 in the recessive yellow e/e mouse
    >>>>>>>> mesentery. Recessive yellow e/e (bearing an inactive mutant MC1 receptor)
    >>>>>>>> mice were subjected to occlusion of the superior mesenteric artery for 35 
    >>>>>>>> min, followed by reperfusion. A sham group (laparotomy but no occlusion of
    >>>>>>>> the artery) was also analysed. Cellular responses in the inflamed
    >>>>>>>> post-capillary venule were determined 90 min post-reperfusion, monitoring
    >>>>>>>> cell rolling as *V*WBC (A), cell adhesion (B) and emigration (C).
    >>>>>>>> Data are mean ± SEM of six mice per group. **P* < 0.05, ***P* <
    >>>>>>>> 0.01 versus respective sham group.
    >>>>>>>>
    >>>>>>>> Treatment of recessive yellow e/e mice with BMS-470539, given i.v.
    >>>>>>>> at the top dose of 18.47 mg·kg−1, did not affect any of the IR-induced
    >>>>>>>> vascular responses, with no effect on *V*WBC (Figure 3A
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#f3>),
    >>>>>>>> cell adhesion (Figure 3B
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#f3>)
    >>>>>>>> or cell emigration (Figure 3C
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#f3>
    >>>>>>>> ).
    >>>>>>>>
    >>>>>>>> To analyse which cell could be the target of the MC receptor
    >>>>>>>> inhibition, immunostaining of whole-mount mesentery subjected to IR injury
    >>>>>>>> was performed and viewed by confocal microscopy. Specifically, following
    >>>>>>>> inflammation, tissues were collected, fixed and immunostained for the
    >>>>>>>> pan-leucocyte marker CD45 and α-SMA to detect the pericytes of the venular
    >>>>>>>> wall, together with an anti-MC1 receptor or isotype control antibody. The
    >>>>>>>> 3D reconstructed images of the inflamed tissues showed specific
    >>>>>>>> immuno-staining of transmigrated leucocytes for MC1 receptors as compared
    >>>>>>>> with isotype control treated tissues (Figure 4A
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#f4>).
    >>>>>>>> Of note, MC1 receptors were highly expressed inside, but also, at a lower
    >>>>>>>> extent on the surface of the transmigrated and adherent leucocytes (Figure 
    >>>>>>>> 4B,C
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#f4>).
    >>>>>>>> The immunostaining of the tissues also demonstrated specific staining for
    >>>>>>>> MC1 receptors on the luminal side of the venular wall (Figure 4C
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#f4>
    >>>>>>>> ).
    >>>>>>>>
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/cms/asset/fd997781-1ada-4509-b1cc-3c711876e07e/bph_688_f4.gif>
    >>>>>>>> Figure 4
    >>>>>>>> Open in figure viewer
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#>
    >>>>>>>> PowerPoint
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/action/downloadFigures?id=f4&doi=10.1111%2Fj.1476-5381.2010.00688.x>
    >>>>>>>>
    >>>>>>>> MC1 receptor immunoreactivity in the inflamed mesentery. Confocal
    >>>>>>>> analyses of mesenteric tissue samples of WT mice. Tissues were obtained 90 
    >>>>>>>> min post-reperfusion, as detailed in Figure 1
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#f1>.
    >>>>>>>> There is an association between MC1 receptor immunoreactivity and
    >>>>>>>> CD45-positive leucocytes. (A) Staining was performed with an irrelevant
    >>>>>>>> control Ab (top panel) or anti-MC1 receptor Ab (bottom panel) in inflamed
    >>>>>>>> post-capillary venules. Images in the right panels are greater
    >>>>>>>> magnification of the region of interest showing expression of MC1 receptors
    >>>>>>>> by leucocytes. (B). Longitudinal cross section (2 µm) of a vessel showing
    >>>>>>>> luminal leucocytes expressing MC1 receptors. (C) Latitudinal cross section
    >>>>>>>> (1 µm) showing some degree of MC1 receptor staining within the vessel wall
    >>>>>>>> (below the pericyte layer; dotted arrow). In some images, an opacity filter
    >>>>>>>> was used reducing the colour intensity in one channel (either for CD45 or
    >>>>>>>> α-SMA immunostaining) to highlight expression of MC1 receptors within the
    >>>>>>>> leucocyte (open arrowhead), on the surface of the leucocyte (closed arrows)
    >>>>>>>> and on the luminal side of the vessel wall (dotted arrow) respectively.
    >>>>>>>> Data are representative of images obtained from tissues acquired from three
    >>>>>>>> mice. isoCTL, isotype control; αSMA, alpha-smooth muscle actin; MC1,
    >>>>>>>> anti-MC1 Ab; CD45, anti-CD45 Ab (se Methods for more details). Bar = 10 µm.
    >>>>>>>>
    >>>>>>>> The pharmacological effects produced by administration of compound
    >>>>>>>> BMS-470539 on the inflamed vasculature were not secondary to changes in the
    >>>>>>>> haemodynamic parameters of the vessels under investigation. This is shown
    >>>>>>>> in Table 1
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#t1>,
    >>>>>>>> where values of cell flux and wall shear rate were modified by 35 + 90 min
    >>>>>>>> IR, but not further modified by application of BMS-470539.
    >>>>>>>> Table 1. Haemodynamic parameters in the mesenteric microcirculation
    >>>>>>>> of WT and inactive MC1 e/e mice
    >>>>>>>> *Mouse genotype (procedure)**Diameter (µm)**Cell flux (cells*·*min*
    >>>>>>>> −*1**)**Wall shear rate (s* −*1* *)*
    >>>>>>>> WT (sham)
    >>>>>>>> 25.3 ± 1.7
    >>>>>>>> 9.5 ± 1.5
    >>>>>>>> 400.5 ± 10.5
    >>>>>>>> WT (35 + 90 IR)
    >>>>>>>> 27.2 ± 1.8
    >>>>>>>> 19.4 ± 0.9
    >>>>>>>> 280 ± 12.5
    >>>>>>>> WT (35 + 90 IR) + BMS-470539
    >>>>>>>> 25.0 ± 1.6
    >>>>>>>> 20.4 ± 0.4
    >>>>>>>> 305 ± 10.5
    >>>>>>>> Mutant MC1 e/e (sham)
    >>>>>>>> 26.7 ± 1.2
    >>>>>>>> 8 ± 0.6
    >>>>>>>> 386.2 ± 32.0
    >>>>>>>> Mutant MC1 e/e (35 + 90 IR)
    >>>>>>>> 25.6 ± 3.8
    >>>>>>>> 20.5 ± 5.1
    >>>>>>>> 280.1 ± 18.2
    >>>>>>>> Mutant MC1 e/e (35 + 90 IR) + BMS-470539
    >>>>>>>> 28.6 ± 2.8
    >>>>>>>> 18.5 ± 3.1
    >>>>>>>> 300 ± 10.4
    >>>>>>>>
    >>>>>>>> - The diameter of the mesenteric vessels analysed in 1
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#f1>
    >>>>>>>> , 3
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#f3> are
    >>>>>>>> summarized here, along with values for wall shear rate and cell flux. The
    >>>>>>>> mice were exposed to IR (35 min of ischaemia and 90 min of reperfusion). As
    >>>>>>>> indicated, BMS-470539 was given at a dose of 18.47 mg·kg−1 i.v. immediately
    >>>>>>>> before ischaemia. Data are mean ± SEM from six animals per group. For cell
    >>>>>>>> flux and wall shear rate, all IR values are significantly different from
    >>>>>>>> respective sham (*P* < 0.01).
    >>>>>>>>
    >>>>>>>> Effects of BMS-470539 on the cremasteric microcirculation
    >>>>>>>>
    >>>>>>>> To further elucidate the pharmacological potential of BMS-470539,
    >>>>>>>> as well as to determine the pathophysiological relevance of endogenous
    >>>>>>>> MC1 receptors, the next set of experiments was conducted within a different
    >>>>>>>> vascular bed, the mouse cremaster muscle microcirculation. The cremaster is
    >>>>>>>> a skeletal muscle widely used to study mechanisms of white blood cell
    >>>>>>>> interactions with the post-capillary venules (Dangerfield *et al.*,
    >>>>>>>> 2002
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b8>
    >>>>>>>> ; Young *et al.*, 2004
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b38>).
    >>>>>>>> It offers a higher degree of stability and so it is suitable to be inflamed
    >>>>>>>> over time, allowing the temporal monitoring of the cascade of events within
    >>>>>>>> the vasculature that characterizes the early phase of inflammation.
    >>>>>>>>
    >>>>>>>> Firstly, we determined expression of MC1 receptors in vascular
    >>>>>>>> cells also when these experimental conditions were applied. Supporting
    >>>>>>>> Information Figure S1 shows the MC1 receptor immunoreactivity detected in
    >>>>>>>> the inflamed vessels, with a marked signal deriving from intravascular
    >>>>>>>> (adherent), as well as extravasated leucocytes (Supporting Information
    >>>>>>>> Figure S1B). Co-staining with CD45, a pan-leucocyte marker, validated this
    >>>>>>>> observation, so that a high (>95%) degree of co-localization between CD45
    >>>>>>>> and MC1 positivity was evident (Supporting Information Figure S1D).
    >>>>>>>> Controls for the immunoreaction and subsequent confocal analyses are shown
    >>>>>>>> in Supporting Information Figure S1A,C.
    >>>>>>>>
    >>>>>>>> PAF superfusion of the cremasteric microcirculation produced a
    >>>>>>>> time-dependent inflammatory response with reduction in *V*WBC (not
    >>>>>>>> shown), and a time-dependent increase in cell adhesion (Figure 5A
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#f5>)
    >>>>>>>> and emigration (Figure 5B
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#f5>).
    >>>>>>>> At 60 min post-PAF superfusion, the extent of cell adhesion and emigration
    >>>>>>>> was approximately 50–70% of the response measured at the 2 h time-point (Figure 
    >>>>>>>> 5
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#f5>).
    >>>>>>>> At this juncture, the mice were split into two groups, receiving either an
    >>>>>>>> intravenous bolus of vehicle or of BMS-470539. Treatment with this
    >>>>>>>> MC1 receptor agonist, using this therapeutic protocol, did not affect cell
    >>>>>>>> adhesion (Figure 5A
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#f5>),
    >>>>>>>> but produced a marked blockade of cell emigration (Figure 5B
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#f5>
    >>>>>>>> ). Table 2
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#t2> reports
    >>>>>>>> haemodynamic parameters in the cremaster.
    >>>>>>>>
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/cms/asset/fc01b97f-0ca3-4c6e-b9e7-94ada41f2c95/bph_688_f5.gif>
    >>>>>>>> Figure 5
    >>>>>>>> Open in figure viewer
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#>
    >>>>>>>> PowerPoint
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/action/downloadFigures?id=f5&doi=10.1111%2Fj.1476-5381.2010.00688.x>
    >>>>>>>>
    >>>>>>>> BMS-470539 inhibits cell emigration in the cremasteric
    >>>>>>>> microcirculation activated by PAF superfusion. WT mouse cremasteric
    >>>>>>>> microcirculation was superfused with buffer containing PAF (100 nM), and 1 
    >>>>>>>> min recordings were made every 15 min up to 120 min. After 60 min, buffer
    >>>>>>>> (100 µL) or BMS-470539 (18.57 mg·kg−1) was given i.v. and cellular
    >>>>>>>> responses in the inflamed post-capillary venule determined after further 60 
    >>>>>>>> min. Cellular reactivity was monitored as cell adhesion (A) and emigration
    >>>>>>>> (B). Data are mean ± SEM of six mice per group. **P* < 0.05, ***P* <
    >>>>>>>> 0.01 versus respective buffer value.
    >>>>>>>> Table 2. Haemodynamic parameters in the mouse cremasteric
    >>>>>>>> microcirculation
    >>>>>>>> *Mouse (treatment)**Cell flux (cells*·*min*−*1**)**Wall shear rate
    >>>>>>>> (s* −*1* *)*
    >>>>>>>> WT (PAF 30 min)
    >>>>>>>> 12.80 ± 2.9
    >>>>>>>> 426.66 ± 59.2
    >>>>>>>> WT (PAF 60 min)
    >>>>>>>> 19.20 ± 2.4
    >>>>>>>> 446.66 ± 57.6
    >>>>>>>> WT (PAF + buffer 90 min)
    >>>>>>>> 23.00 ± 5.0
    >>>>>>>> 465.55 ± 63.2
    >>>>>>>> WT (PAF + buffer 120 min)
    >>>>>>>> 20.80 ± 4.5
    >>>>>>>> 553.33 ± 84.7
    >>>>>>>> WT (PAF + BMS-470539 90 min)
    >>>>>>>> 17.60 ± 4.9
    >>>>>>>> 536.66 ± 84.1
    >>>>>>>> WT (PAF + BMS-470539 120 min)
    >>>>>>>> 18.00 ± 4.8
    >>>>>>>> 549.99 ± 56.3
    >>>>>>>>
    >>>>>>>> - Values for wall shear rate and cell flux of experiments shown
    >>>>>>>> in Figure 5
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#f5> are
    >>>>>>>> summarized here. Diameters of post-capillary venules (20–30 µm) are not
    >>>>>>>> shown, as they did not change over time. The mouse cremaster was superfused
    >>>>>>>> with 100 nM PAF (0–60 min), then either buffer (100 µL) or BMS-470539
    >>>>>>>> (18.57 mg·kg−1) was given i.v., and parameters monitored for another 60 min
    >>>>>>>> (120 min post-PAF superfusion). Data are mean ± SEM of six WT animals per
    >>>>>>>> group.
    >>>>>>>>
    >>>>>>>> In line with the results obtained with the mesentery protocol,
    >>>>>>>> there was no difference between WT and the recessive yellow e/e mouse with
    >>>>>>>> respect to the cellular responses promoted by PAF (Supporting Information
    >>>>>>>> Figure S2). Importantly, BMS-470539 was ineffective in altering the degree
    >>>>>>>> of cell emigration when administered to recessive yellow e/e mice
    >>>>>>>> (Supporting Information Figure S3) supporting, again, the active
    >>>>>>>> involvement of MC1 receptors in transducing the *in vivo* anti-inflammatory
    >>>>>>>> properties of this compound.
    >>>>>>>> Discussion
    >>>>>>>>
    >>>>>>>> In this study, we have determined the inhibitory properties of a
    >>>>>>>> selective MC1 receptor agonist, BMS-470539, on the early phases of the
    >>>>>>>> inflammatory response, namely the interaction between circulating white
    >>>>>>>> blood cells and post-capillary venules. The data produced indicate that
    >>>>>>>> activation of mouse MC1 receptors by BMS-470539 exerts potent inhibition on
    >>>>>>>> the processes of cell adhesion and, in particular, emigration. Of interest,
    >>>>>>>> a significant expression of MC1 receptor expression in recruited leucocytes
    >>>>>>>> was noted; however, this receptor did not seem to play a pathophysiological
    >>>>>>>> role *per se* in these experimental conditions.
    >>>>>>>>
    >>>>>>>> The interest in MCs has grown over the years, so that three decades
    >>>>>>>> of research into the biology of these natural – and synthetic – peptides
    >>>>>>>> may become fruitful in the near future (Gonzalez-Rey *et al.*, 2007
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b18>).
    >>>>>>>> A wealth of evidence indicates that α-MSH, a pan-agonist to all MC
    >>>>>>>> receptors, except MC2, produces potent tissue-protective and
    >>>>>>>> anti-inflammatory effects in rodents, as well as in systems with human
    >>>>>>>> cells and samples (Catania *et al.*, 2004
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b5>
    >>>>>>>> ; Getting, 2006
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b12>
    >>>>>>>> ; Brzoska *et al.*, 2008
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b3>).
    >>>>>>>> In line with the potential exploitation of other endogenous
    >>>>>>>> anti-inflammatory pathways and targets for the development of novel
    >>>>>>>> anti-inflammatory drugs (Gilroy *et al.*, 2004
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b17>
    >>>>>>>> ; Gonzalez-Rey *et al.*, 2007
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b18>
    >>>>>>>> ; Serhan *et al.*, 2007
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b33>),
    >>>>>>>> it is possible that activation of MC receptors would have a lower burden of
    >>>>>>>> side effects as it would be mimicking the mechanisms employed endogenously
    >>>>>>>> to terminate inflammatory events.
    >>>>>>>>
    >>>>>>>> In the area of MCs and MC receptors in inflammation, attention has
    >>>>>>>> been focused on two members of this subfamily of G-protein-coupled
    >>>>>>>> receptors, namely MC1 and MC3 receptors. Initial pharmacological studies
    >>>>>>>> have implied a strong involvement of MC1 receptors in the anti-inflammatory
    >>>>>>>> properties of α-MSH, ACTH and other MCs (Lipton *et al.*, 1999
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b28>
    >>>>>>>> ; Catania *et al.*, 2000
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b4>).
    >>>>>>>> Subsequently, MC3 receptors were shown to be expressed on resident
    >>>>>>>> macrophages, and be activated to elicit inhibition in several settings of
    >>>>>>>> acute inflammation (Getting *et al.*, 1999; 2002
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b15%20%23b13>).
    >>>>>>>> Therefore, from a drug development perspective, there is a dual opportunity
    >>>>>>>> of developing either MC1 or MC3 receptor-selective agonists. Very few
    >>>>>>>> studies have assessed the pathophysiological roles of either MC1 or
    >>>>>>>> MC3 receptors, for instance, studying the phenotype of transgenic mice.
    >>>>>>>>
    >>>>>>>> The recessive yellow e/e mouse, which bears inactive MC1 receptors (
    >>>>>>>> Robbins *et al.*, 1993
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b31>),
    >>>>>>>> did not display differences in the acute inflammatory reaction to zymosan
    >>>>>>>> or other inflammogens, both for leucocyte recruitment and cytokine
    >>>>>>>> production (Getting *et al.*, 2003; 2006
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b14%20%23b16>).
    >>>>>>>> On the other hand, using two distinct models of colitis, disease
    >>>>>>>> exacerbation was shown in this mouse colony, favouring the possibility that
    >>>>>>>> MC1 receptors might be activated, or its endogenous agonists produced, in
    >>>>>>>> more chronic inflammatory conditions (Maaser *et al.*, 2006
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b30>).
    >>>>>>>> This conclusion is supported by the data presented here, where the
    >>>>>>>> recessive yellow e/e mouse was able to mount a leucocytic response in the
    >>>>>>>> vasculature, very similar to that noted in WT controls. These findings
    >>>>>>>> obtained from studies in different microvascular beds and stimulated by two
    >>>>>>>> different stimuli, in which cell adhesion and emigration were promoted by
    >>>>>>>> an IR procedure or PAF superfusion. Lack of involvement of MC1 receptors in
    >>>>>>>> these events may be due to the lack of generation of its endogenous
    >>>>>>>> selective ligands. Of importance, the receptor was highly
    >>>>>>>> expressed in inflamed tissues most notably by adherent and emigrated (or
    >>>>>>>> resident) leucocytes.
    >>>>>>>>
    >>>>>>>> The scenario, and ensuing conclusions, are quite different for
    >>>>>>>> MC3 receptors. Vascular inflammation is exacerbated in
    >>>>>>>> MC3 receptor null mice, as recently reported (Leoni *et al.*, 2008
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b26>).
    >>>>>>>> Application of the IR procedure, identical to that used in the present
    >>>>>>>> study, leads to marked cell adhesion and emigration with values >50%
    >>>>>>>> augmented with respect to WT mice. This increased vascular reactivity in
    >>>>>>>> MC3 receptor null mice is associated with, or is consequent to, an
    >>>>>>>> augmented tissue generation of pro-inflammatory chemokines, probably
    >>>>>>>> produced by tissue resident mast cells and macrophages (Ajuebor *et 
    >>>>>>>> al.*, 1999
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b2>
    >>>>>>>> ; Tailor *et al.*, 1999
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b35>).
    >>>>>>>> In line with the above hypothesis, it is possible that under these
    >>>>>>>> inflammatory conditions, endogenous selective MC3 receptor ligands are
    >>>>>>>> produced and active. Peripheral generation of the pro-opiomelanocortin gene
    >>>>>>>> product is now an accepted finding (Gonzalez-Rey *et al.*, 2007
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b18>
    >>>>>>>> ; Brzoska *et al.*, 2008
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b3>);
    >>>>>>>> however, the possibility that this polypeptide might be processed in a
    >>>>>>>> tissue-specific manner is yet to be tested and proven. Another theoretical
    >>>>>>>> explanation for the engagement of MC3, and not MC1 receptors, in the early
    >>>>>>>> (from 0 to 4 h) tissue inflammatory response could lie in the fact that
    >>>>>>>> post-translational modifications may occur, changing the affinity or the
    >>>>>>>> susceptibility to activation of one or the other MC receptor. Future
    >>>>>>>> studies will address these possibilities, which clearly are not mutually
    >>>>>>>> exclusive.
    >>>>>>>>
    >>>>>>>> Our observation that MC1 receptor expression is detectable on
    >>>>>>>> inflammatory cells is of importance, as such a phenomenon has often been
    >>>>>>>> indicated using molecular approaches, but rarely in whole tissues, and in
    >>>>>>>> such a clear-cut manner. Our confocal analyses allowed prompt
    >>>>>>>> detection of MC1 receptor on CD45+ cells, likely to be associated with
    >>>>>>>> cells adherent to the vascular wall, as well as with cells that had
    >>>>>>>> migrated into the tissue. In our previous study, we employed
    >>>>>>>> immunohistochemistry to detect MC1 and MC3 receptor immunoreactivity in
    >>>>>>>> extravasated neutrophils and macrophages within the post-IR mesenteric
    >>>>>>>> tissue (Leoni *et al.*, 2008
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b26>).
    >>>>>>>> Here, we demonstrated that adherent leucocytes are MC1 receptor positive.
    >>>>>>>> In line with previous reports (Scholzen *et al.*, 2003
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b32>),
    >>>>>>>> a weak expression of MC1 receptor on vascular endothelium could be
    >>>>>>>> observed; this is congruent with the ability of MC peptides to
    >>>>>>>> down-regulate endothelial cell expression of cell adhesion molecules (
    >>>>>>>> Scholzen *et al.*, 2003
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b32>).
    >>>>>>>> Here, we have not evaluated the effects of BMS-470539 on endothelial cells,
    >>>>>>>> and therefore cannot exclude a contributing role on modulation of
    >>>>>>>> endothelial cell adhesion molecules. It is possible that in addition to the
    >>>>>>>> effects observed on circulating leucocytes, an effect on the endothelium
    >>>>>>>> might occur in our experimental settings, which would aid in eliciting a
    >>>>>>>> reduction in the extent of leucocyte emigration.
    >>>>>>>>
    >>>>>>>> Use of the recessive yellow e/e mouse indicated that activation of
    >>>>>>>> MC1 receptors mediates, on its own, the anti-inflammatory effects of
    >>>>>>>> BMS-470539. In the mesenteric post-IR tissue, this selective MC1 receptor
    >>>>>>>> agonist prevented not only cell emigration, but also tissue generation of
    >>>>>>>> CCL2 and CXL1. These two chemokines are major effectors in recruiting
    >>>>>>>> neutrophils and monocytes in the early phases of the inflammatory response,
    >>>>>>>> being promptly produced by tissue mast cells and macrophages (
    >>>>>>>> Ajuebor *et al.*, 1999
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b2>).
    >>>>>>>> It is likely that their role is to promote adhesion of rolling leucocytes,
    >>>>>>>> a pre-requisite to subsequent emigration. With the IR protocol, we could
    >>>>>>>> not discriminate between a direct effect of BMS-470539 on cell adhesion and
    >>>>>>>> emigration, or whether the latter was secondary to a lowered tissue
    >>>>>>>> generation of pro-inflammatory chemokines. To address this further, we had
    >>>>>>>> to apply a protocol that could allow monitoring of the development of
    >>>>>>>> leucocyte reactivity in the vasculature. The data generated here highlight
    >>>>>>>> that inhibition of chemokine expression leads to the reduction in leucocyte
    >>>>>>>> recruitment observed within these models. Previous studies have shown that
    >>>>>>>> MC peptides can down-regulate the expression of pro-inflammatory cytokines,
    >>>>>>>> including interleukin (IL)-1β, IL-6 and TNF-α, as well as chemokines
    >>>>>>>> including IL-8 (Luger *et al.*, 1997
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b29>
    >>>>>>>> ; Brzoska *et al.*, 2008
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b3>).
    >>>>>>>> Moreover, it is also established that following this initial inhibition of
    >>>>>>>> pro-inflammatory chemokine and cytokine release, MC receptor
    >>>>>>>> agonists activate a delayed induction of anti-inflammatory pathways
    >>>>>>>> provoking an increase in IL-10 and haem oxygenase 1 expression (
    >>>>>>>> Lam *et al.*, 2005; 2006
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b24%20%23b25>
    >>>>>>>> ).
    >>>>>>>>
    >>>>>>>> Superfusion of PAF onto the microvasculature is an established
    >>>>>>>> protocol (Kubes *et al.*, 1990
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b23>
    >>>>>>>> ; Zimmerman *et al.*, 1994
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b39>
    >>>>>>>> ; Chatterjee *et al.*, 2005
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b6>)
    >>>>>>>> suitable to study alterations in the microcirculation of stable
    >>>>>>>> preparations of intravital microscopy. The cremaster preparation satisfies
    >>>>>>>> this requisite (Gavins and Chatterjee, 2004
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b10>).
    >>>>>>>> PAF application is known to produce direct activation of the intravascular
    >>>>>>>> leucocytes and the endothelium, provoking selectin-mediated rolling,
    >>>>>>>> followed by cell adhesion and emigration, along the established model for
    >>>>>>>> leucocyte recruitment (Ley *et al.*, 2007
    >>>>>>>> <https://bpspubs.onlinelibrary.wiley.com/doi/10.1111/j.1476-5381.2010.00688.x#b27>).
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#> 2010
    >>>>>>>>> May; 87(5): 779–789.
    >>>>>>>>> Published online 2010 Feb 3. doi: 10.1189/jlb.1109766
    >>>>>>>>> <https://dx.doi.org/10.1189%2Fjlb.1109766>
    >>>>>>>>> PMCID: PMC2858674
    >>>>>>>>> PMID: 20130219 <https://www.ncbi.nlm.nih.gov/pubmed/20130219>
    >>>>>>>>> Inflammatory mechanisms in ischemic stroke: role of inflammatory
    >>>>>>>>> cells
    >>>>>>>>> Rong Jin
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pubmed/?term=Jin%20R%5BAuthor%5D&cauthor=true&cauthor_uid=20130219>
    >>>>>>>>> ,* Guojun Yang
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pubmed/?term=Yang%20G%5BAuthor%5D&cauthor=true&cauthor_uid=20130219>
    >>>>>>>>> ,† and Guohong Li
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pubmed/?term=Li%20G%5BAuthor%5D&cauthor=true&cauthor_uid=20130219>
    >>>>>>>>> *,1
    >>>>>>>>> Author information
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#> Article
    >>>>>>>>> notes <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#> Copyright
    >>>>>>>>> and License information
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#>
    >>>>>>>>> Disclaimer <https://www.ncbi.nlm.nih.gov/pmc/about/disclaimer/>
    >>>>>>>>> This article has been cited by
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/citedby/> other
    >>>>>>>>> articles in PMC.
    >>>>>>>>> Go to: <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#>
    >>>>>>>>> Abstract
    >>>>>>>>>
    >>>>>>>>> Inflammation plays an important role in the pathogenesis of
    >>>>>>>>> ischemic stroke and other forms of ischemic brain injury. Experimentally
    >>>>>>>>> and clinically, the brain responds to ischemic injury with an acute and
    >>>>>>>>> prolonged inflammatory process, characterized by rapid activation of
    >>>>>>>>> resident cells (mainly microglia), production of proinflammatory
    >>>>>>>>> mediators, and infiltration of various types of inflammatory cells
    >>>>>>>>> (including neutrophils, different subtypes of T cells,
    >>>>>>>>> monocyte/macrophages, and other cells) into the ischemic brain tissue.
    >>>>>>>>> These cellular events collaboratively contribute to ischemic brain injury.
    >>>>>>>>> Despite intense investigation, there are still numerous controversies
    >>>>>>>>> concerning the time course of the recruitment of inflammatory cells in the
    >>>>>>>>> brain and their pathogenic roles in ischemic brain injury. In this review,
    >>>>>>>>> we provide an overview of the time-dependent recruitment of different
    >>>>>>>>> inflammatory cells following focal cerebral I/R. We discuss how these cells
    >>>>>>>>> contribute to ischemic brain injury and highlight certain recent findings
    >>>>>>>>> and currently unanswered questions about inflammatory cells in the
    >>>>>>>>> pathophysiology of ischemic stroke.
    >>>>>>>>> *Keywords: *inflammation, leukocytes, brain ischemia
    >>>>>>>>> Go to: <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#>
    >>>>>>>>> Introduction
    >>>>>>>>>
    >>>>>>>>> Stroke is the third leading cause of death and the most frequent
    >>>>>>>>> cause of permanent disability worldwide [1
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B1>], and
    >>>>>>>>> inflammation appears to play an important role in the pathogenesis of
    >>>>>>>>> ischemic stroke and other forms of ischemic brain injury. Clinically, the
    >>>>>>>>> susceptibility of the patients to stroke and the subsequent prognosis are
    >>>>>>>>> influenced by systemic inflammatory processes [2
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B2>, 3
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B3>].
    >>>>>>>>> Stroke patients with systemic inflammation exhibit clinically poorer
    >>>>>>>>> outcomes [4
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B4>,5
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B5>,6
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B6>].
    >>>>>>>>> Experimentally, focal cerebral ischemia induces a time-dependent
    >>>>>>>>> recruitment and activation of inflammatory cells, including neutrophils,
    >>>>>>>>> T cells, and monocytes/macrophages, and inhibiting the inflammatory
    >>>>>>>>> response, decreases infarct size and improves neurological deficit in
    >>>>>>>>> experimental stroke [7
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B7>, 8
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B8>].
    >>>>>>>>> Although anti-inflammatory approaches have proven successful in animal
    >>>>>>>>> models [9
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B9>,10
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B10>,11
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B11>],
    >>>>>>>>> attempts to translate this into clinical application have been unsuccessful
    >>>>>>>>> [12 <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B12>,
    >>>>>>>>> 13 <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B13>],
    >>>>>>>>> likely as a result of the heterogeneity in mechanisms underlying
    >>>>>>>>> postischemic brain inflammation and the uncertain time window at which
    >>>>>>>>> inflammation could be targeted in the human disease situation [13
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B13>].
    >>>>>>>>> Thus, a comprehensive understanding of the time-dependent recruitment of
    >>>>>>>>> inflammatory cells following focal cerebral I/R and how these cells
    >>>>>>>>> differentially (and synergistically) contribute to ischemic brain injury is
    >>>>>>>>> a prerequisite for developing effective therapeutic interventions for the
    >>>>>>>>> treatment of acute ischemic stroke by targeting inflammatory pathways in a
    >>>>>>>>> time-dependent manner.
    >>>>>>>>>
    >>>>>>>>> Despite intense investigation, there are still numerous
    >>>>>>>>> controversies concerning the time course of the recruitment of inflammatory
    >>>>>>>>> cells in the brain and their pathogenic roles in ischemic brain injury. In
    >>>>>>>>> the present review, we provide an overview of the time-dependent
    >>>>>>>>> recruitment of different inflammatory cells following focal cerebral I/R.
    >>>>>>>>> This review focuses on the potential contribution of these cells to
    >>>>>>>>> ischemic brain injury and highlights recent findings and currently open
    >>>>>>>>> questions regarding inflammatory cells in the pathophysiology of ischemic
    >>>>>>>>> stroke.
    >>>>>>>>> Go to: <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#>
    >>>>>>>>> EXPERIMENTAL STROKE MODELS AND LEUKOCYTE RECRUITMENT
    >>>>>>>>>
    >>>>>>>>> Ischemic stroke results from transient or permanent reduction in
    >>>>>>>>> regional cerebral blood flow. In humans, ischemic stroke occurs most often
    >>>>>>>>> in the area perfused by the MCA [14
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B14>].
    >>>>>>>>> Studies in animal models of stroke have provided an invaluable contribution
    >>>>>>>>> to our current understanding of the pathophysiology of ischemic stroke [
    >>>>>>>>> 15 <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B15>].
    >>>>>>>>> One of the most relevant stroke models involves transient or permanent MCAO
    >>>>>>>>> in the rats and mice [14
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B14>, 15
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B15>].
    >>>>>>>>> Rats are one of the most suitable species for stroke study because of the
    >>>>>>>>> pathogenetic similarities of strokes in rats and humans [16
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B16>]. In
    >>>>>>>>> recent years, the importance of mouse MCAO models has increased rapidly
    >>>>>>>>> with the development of transgenic or knockout techniques for a targeted
    >>>>>>>>> single gene [15
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B15>].
    >>>>>>>>> Currently, there are three main categories of transient MCAO: intraluminal
    >>>>>>>>> MCAO with thread or wire filaments (the most widely used model in the
    >>>>>>>>> literature); abluminal application of potent vasoconstrictor endothelin-1
    >>>>>>>>> to the MCA; and thromboembolic models, including photochemically induced
    >>>>>>>>> thrombotic MCAO and the introduction of emboli into the cerebral
    >>>>>>>>> circulation. The details of the design and operation of these animal stroke
    >>>>>>>>> models have been described elsewhere [14
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B14>, 15
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B15>]. The
    >>>>>>>>> results of the comparisons between transient and permanent MCAO models in
    >>>>>>>>> rats and mice are summarized in Table 1
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/table/T1/>.
    >>>>>>>>> TABLE 1.
    >>>>>>>>>
    >>>>>>>>> Comparison of Transient and Permanent MCAO Stroke Models in Rats
    >>>>>>>>> and Mice
    >>>>>>>>> Transient MCAOPermanent MCAOReferences
    >>>>>>>>> Reperfusion
    >>>>>>>>> With MCA reperfusion after a defined period of focal cerebral
    >>>>>>>>> ischemia.
    >>>>>>>>> Without reperfusion.
    >>>>>>>>> [14 <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B14>,
    >>>>>>>>> 15 <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B15>]
    >>>>>>>>> Ischemic damage
    >>>>>>>>> Lesions primarily in the ipsilateral cortex and striatum but also
    >>>>>>>>> shown in hippocampus.
    >>>>>>>>> Lesions primarily in the ipsilateral cortex but also shown in
    >>>>>>>>> striatum. Lesion size in the cortex comparable with or larger than
    >>>>>>>>> transient MCAO.
    >>>>>>>>> [8 <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B8>,9
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B9>,10
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B10>, 15
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B15>]
    >>>>>>>>> Leukocyte infiltration
    >>>>>>>>> Inducing adhesion and infiltration of a large number of leukocytes
    >>>>>>>>> in the ischemic brain tissue.
    >>>>>>>>> Although inducing a significant amount of leukocyte rolling and
    >>>>>>>>> adhesion in pial venules, only a small number of leukocytes infiltrated
    >>>>>>>>> into ischemic tissue.
    >>>>>>>>> [8 <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B8>,9
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B9>,10
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B10>, 15
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B15>]
    >>>>>>>>> Antileukocyte (including antiadhesion molecule) therapy
    >>>>>>>>> Immunoblocking or genetic deletion of a number of adhesion
    >>>>>>>>> molecules (e.g., CD11b/CD18, ICAM-1, P-selectin) effectively reduces
    >>>>>>>>> ischemic brain injury.
    >>>>>>>>> Less effective.
    >>>>>>>>> [9 <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B9>,10
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B10>,11
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B11>, 17
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B17>,18
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B18>,19
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B19>,20
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B20>,21
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B21>]
    >>>>>>>>> Clinical relevance
    >>>>>>>>> Generally appreciated, as most cases of human ischemic stroke have
    >>>>>>>>> spontaneous or tPA-induced reperfusion.
    >>>>>>>>> Limited, as human ischemic stroke is seldom permanent.
    >>>>>>>>> [14 <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B14>,
    >>>>>>>>> 15 <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B15>]
    >>>>>>>>>
    >>>>>>>>> Emerging data indicate that transient MCAO models may better mimic
    >>>>>>>>> the pathophysiology of human stroke compared with permanent occlusion
    >>>>>>>>> models in rats and mice (Table 1)
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/table/T1/>.
    >>>>>>>>> In human stroke, cerebral vessel occlusion is seldom permanent, as most
    >>>>>>>>> cases of human ischemic stroke have spontaneous or thrombolytic
    >>>>>>>>> therapy-induced reperfusion [14
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B14>, 15
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B15>].
    >>>>>>>>> Leukocyte infiltration into the ischemic brain in transient MCAO models is
    >>>>>>>>> more prominent, and antileukocyte strategies (including antiadhesion
    >>>>>>>>> molecule strategies) have generally proven to be more effective in animal
    >>>>>>>>> stroke models of transient but not permanent ischemia [8
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B8>, 15
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B15>]. For
    >>>>>>>>> this reason, experimental studies about leukocyte recruitment and ischemic
    >>>>>>>>> brain injury are now performed mostly using transient cerebral I/R models
    >>>>>>>>> in rats and mice [8
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B8>, 15
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B15>].
    >>>>>>>>> Go to: <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#>
    >>>>>>>>> TIME-DEPENDENT RECRUITMENT OF INFLAMMATORY CELLS DURING CEREBRAL
    >>>>>>>>> I/R
    >>>>>>>>>
    >>>>>>>>> The brain’s inflammatory responses to postischemia are
    >>>>>>>>> characterized by a rapid activation of resident cells (mainly microglial
    >>>>>>>>> cells), followed by the infiltration of circulating inflammatory cells,
    >>>>>>>>> including granulocytes (neutrophils), T cells, monocyte/macrophages, and
    >>>>>>>>> other cells in the ischemic brain region, as demonstrated in animal models [
    >>>>>>>>> 22 <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B22>,23
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B23>,24
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B24>,25
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B25>] and
    >>>>>>>>> in stroke patients [26
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B26>,27
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B27>,28
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B28>,29
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B29>]. In
    >>>>>>>>> the acute phase (minutes to hours) of ischemic stroke, ROS and
    >>>>>>>>> proinflammatory mediators (cytokines and chemokines) are released rapidly
    >>>>>>>>> from injured tissue [22
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B22>, 23
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B23>].
    >>>>>>>>> These mediators induce the expression of the adhesion molecules on cerebral
    >>>>>>>>> ECs and on leukocytes and thus, promote the adhesion and transendothelial
    >>>>>>>>> migration of circulating leukocytes [8
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B8>]. In
    >>>>>>>>> the subacute phase (hours to days), infiltrating leukocytes release
    >>>>>>>>> cytokines and chemokines, especially excessive production of ROS and
    >>>>>>>>> induction/activation of MMP (mainly MMP-9), which amplify the
    >>>>>>>>> brain-inflammatory responses further by causing more extensive activation
    >>>>>>>>> of resident cells and infiltration of leukocytes, eventually leading to
    >>>>>>>>> disruption of the BBB, brain edema, neuronal death, and hemorrhagic
    >>>>>>>>> transformation [22
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B22>, 23
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B23>] (*Fig.
    >>>>>>>>> 1*
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/figure/F1/>).
    >>>>>>>>> However, many of these proinflammatory factors have a dual role at early
    >>>>>>>>> and late stages of stroke. For instance, regardless of the cellular origin,
    >>>>>>>>> MMP-9 has been shown to affect early ischemic brain damage detrimentally
    >>>>>>>>> but promote brain regeneration and neurovascular remodeling in the later
    >>>>>>>>> repair phase [22
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B22>].
    >>>>>>>>> Thus, a thorough understanding of the time course of events leading to
    >>>>>>>>> inflammation in ischemic brain injury is critical [23
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B23>].
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/figure/F1/>
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/figure/F1/>
    >>>>>>>>>
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/core/lw/2.0/html/tileshop_pmc/tileshop_pmc_inline.html?title=Click%20on%20image%20to%20zoom&p=PMC3&id=2858674_zgb9990951210001.jpg>
    >>>>>>>>> Open in a separate window
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/figure/F1/?report=objectonly>
    >>>>>>>>> Figure 1.
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/figure/F1/>
    >>>>>>>>>
    >>>>>>>>> *Potential inflammatory pathways that respond to cerebral I/R.* Mac-1
    >>>>>>>>> is a β2-integrin (CD11b/CD18); PSGL-1 actually functions as a ligand for
    >>>>>>>>> E-/P-/L-selectins.
    >>>>>>>>> Resident microglia and blood-derived macrophages
    >>>>>>>>>
    >>>>>>>>> Microglial cells, the resident macrophages of the brain, are
    >>>>>>>>> activated rapidly in response to brain injury [30
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B30>, 31
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B31>].
    >>>>>>>>> Experimental data have shown that resident microglia are activated within
    >>>>>>>>> minutes of ischemia onset and produce a plethora of proinflammatory
    >>>>>>>>> mediators, including IL-1β and TNF-α, which exacerbate tissue damage [
    >>>>>>>>> 32 <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B32>,33
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B33>,34
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B34>] but
    >>>>>>>>> may also protect the brain against ischemic and excitotoxic injury [
    >>>>>>>>> 35 <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B35>,36
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B36>,37
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B37>].
    >>>>>>>>> Postischemic microglial proliferation peaks at 48–72 h after focal cerebral
    >>>>>>>>> ischemia and may last for several weeks after initial injury [38
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B38>, 39
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B39>]. In
    >>>>>>>>> contrast to the rapid resident microglia response, blood-derived leukocytes
    >>>>>>>>> are recruited to the brain tissue, usually with a delay of hours to a few
    >>>>>>>>> days [24
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B24>, 25
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B25>, 40
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B40>].
    >>>>>>>>>
    >>>>>>>>> However, reactive microglia are morphologically and functionally
    >>>>>>>>> similar to blood-derived monocyte/macrophages [24
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B24>, 25
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B25>]. To
    >>>>>>>>> date, it has been difficult to distinguish these cells in the brain, as
    >>>>>>>>> there is a lack of discriminating cellular markers [24
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B24>, 41
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B41>].
    >>>>>>>>> Blood-derived macrophages are able to acquire a ramified morphology
    >>>>>>>>> indistinguishable from resident microglia, and reactive resident microglia
    >>>>>>>>> can develop into a phagocytic phenotype indistinguishable from infiltrating
    >>>>>>>>> macrophages. Fortunately, the use of chimeric mice with the GFP bone marrow
    >>>>>>>>> provides a powerful tool to distinguish their roles and contributions in
    >>>>>>>>> ischemic brain injury [24
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B24>, 25
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B25>, 41
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B41>].
    >>>>>>>>> Most current data have shown that blood-derived macrophages are recruited
    >>>>>>>>> into the ischemic brain tissue, most abundantly at Days 3–7 after stroke
    >>>>>>>>> (but not significant prior to 3 days after cerebral ischemia) [41
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B41>,42
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B42>,43
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B43>,44
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B44>].
    >>>>>>>>> Schilling et al. [24
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B24>, 41
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B41>, 42
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B42>] show
    >>>>>>>>> that resident microglial activation precedes and predominates over
    >>>>>>>>> blood-derived macrophage infiltration after transient MCAO in a chimeric
    >>>>>>>>> mouse model. These studies demonstrated that neutrophils are the
    >>>>>>>>> first blood-derived leukocytes seen at Day 1 in the damaged brain, whereas
    >>>>>>>>> blood-derived macrophages (GFP-positive) were rarely observed at Day 2 but
    >>>>>>>>> reached peak numbers at Day 7 and decreased thereafter. In contrast,
    >>>>>>>>> resident microglial cells (GFP-negative) are already activated rapidly at
    >>>>>>>>> Day 1 after focal cerebral ischemia. Intriguingly, even at Days 4 and 7,
    >>>>>>>>> most macrophage-like cells remain GFP-negative, indicating that they are
    >>>>>>>>> resident microglia-derived; however, in mouse models of transient MCAO [
    >>>>>>>>> 45 <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B45>]
    >>>>>>>>> and permanent MCAO [25
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B25>],
    >>>>>>>>> others demonstrate that blood-derived macrophages (Iba1-positive) are
    >>>>>>>>> infiltrated into the brain 24–48 h after focal cerebral ischemia, but the
    >>>>>>>>> number of the infiltrating macrophages remains much lower than activated
    >>>>>>>>> resident microglia. Together, most current data support the hypothesis that
    >>>>>>>>> the vast majority of macrophage-like cells in the ischemic brain represents
    >>>>>>>>> activated resident microglia, especially during the first few days
    >>>>>>>>> following cerebral I/R injury.
    >>>>>>>>> Neutrophils
    >>>>>>>>>
    >>>>>>>>> Of the various types of leukocytes, neutrophils are among the
    >>>>>>>>> first to infiltrate ischemic brain (30 min to a few hours of focal cerebral
    >>>>>>>>> ischemia), peak earlier (Days 1–3), and then disappear or decrease rapidly
    >>>>>>>>> with time [8
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B8>, 23
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B23>].
    >>>>>>>>> However, the infiltrating neutrophils may remain more than 3 days or longer
    >>>>>>>>> in the ischemic brain after focal cerebral I/R, but most likely, their
    >>>>>>>>> existence is largely masked after 3 days by large-scale accumulation of
    >>>>>>>>> activated microglia/macrophages in the inflammatory site [46
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B46>]. In
    >>>>>>>>> the rat model of endothelin-1-induced cerebral ischemia, Weston et al. [
    >>>>>>>>> 46 <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B46>]
    >>>>>>>>> observed that neutrophil infiltration into the brain increases at 1 day,
    >>>>>>>>> peaks at 3 days, and although reduced, continues through 7 and 15 days
    >>>>>>>>> after cerebral ischemia.
    >>>>>>>>>
    >>>>>>>>> A recent study seems to challenge the current view, as it provides
    >>>>>>>>> evidence demonstrating that the recruitment of other inflammatory cells may
    >>>>>>>>> precede neutrophil infiltration in response to cerebral ischemia [
    >>>>>>>>> 47 <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B47>].
    >>>>>>>>> In a mouse transient MCAO model, flow cytometric analysis of cell samples
    >>>>>>>>> isolated from the ischemic brains shows that the majority of leukocyte
    >>>>>>>>> cells in the ischemic hemisphere at 3 days after MCAO includes neutrophils [
    >>>>>>>>> 47 <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B47>],
    >>>>>>>>> which is consistent with most reports in the literature [43
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B43>, 48
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B48>, 49
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B49>].
    >>>>>>>>> However, an interesting observation is that the infiltration of other
    >>>>>>>>> inflammatory cells, including macrophages, lymphocytes, and DCs, in the
    >>>>>>>>> ischemic hemisphere precedes the neutrophilic influx [47
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B47>].
    >>>>>>>>> T lymphocytes
    >>>>>>>>>
    >>>>>>>>> Earlier studies suggest that lymphocyte recruitment into the brain
    >>>>>>>>> is involved in the later stages of ischemic brain injury [50
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B50>,51
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B51>,52
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B52>]. In
    >>>>>>>>> a rat model of the photochemically induced focal ischemia,
    >>>>>>>>> immunocytochemistry reveals that numerous T cells infiltrated the border
    >>>>>>>>> zone around the infarct by Day 3, and the number of infiltrating T cells
    >>>>>>>>> increased further between Days 3 and 7 [50
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B50>]. In
    >>>>>>>>> a mouse model of transient MCAO, flow cytometeric examination of the
    >>>>>>>>> inflammatory cell infiltration in the ischemic brain reveals that (CD3+) T
    >>>>>>>>> cells increased relatively late (3–4 days) postischemia, whereas activated
    >>>>>>>>> (CD11b+) microglia/macrophages and (Ly6G+) neutrophils increased
    >>>>>>>>> significantly at earlier times postischemia [52
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B52>].
    >>>>>>>>> However, more recent studies in rodent models demonstrate that T cells
    >>>>>>>>> accumulate in the ischemic brain within the first 24 h after focal cerebral
    >>>>>>>>> I/R and may influence the evolution of tissue inflammation and injury prior
    >>>>>>>>> to their appearance in the extravascular brain compartment [40
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B40>, 53
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B53>]. In
    >>>>>>>>> recent years, increasing research efforts have been devoted to the roles of
    >>>>>>>>> specific T cell subtypes in ischemic stroke. There are many subtypes of
    >>>>>>>>> lymphocytes, and several subtypes of T cells have been implicated in the
    >>>>>>>>> pathogenesis of ischemic stroke [8
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B8>, 40
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B40>].
    >>>>>>>>> However, the time course of the recruitment of different subtypes of T
    >>>>>>>>> cells into the ischemic brain remains largely undetermined.
    >>>>>>>>> Other inflammatory cells
    >>>>>>>>>
    >>>>>>>>> In addition to the above leukocytes, several other types of
    >>>>>>>>> inflammatory cells such as DCs and MCs have been implicated recently in
    >>>>>>>>> ischemic brain injury. These inflammatory cells are considered as early
    >>>>>>>>> responders to act in the first-line defense in response to cerebral
    >>>>>>>>> ischemia. In a mouse model of transient MCAO, Felger et al. [54
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B54>] show
    >>>>>>>>> that DCs accumulated in the ischemic hemisphere at 24 h after focal
    >>>>>>>>> cerebral ischemia, particularly in the border region of the infarct where T
    >>>>>>>>> cells accrued. MCs in the brain are typically located perivascularly and
    >>>>>>>>> contain potent, fast-acting vasoactive and proteolytic substances. In a rat
    >>>>>>>>> model of transient MCAO, Strbian et al. [55
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B55>] show
    >>>>>>>>> that brain MCs regulate early brain swelling and neutrophil accumulation at
    >>>>>>>>> 4 h after ischemia.
    >>>>>>>>>
    >>>>>>>>> In summary, our current knowledge about the time-dependent
    >>>>>>>>> infiltration of inflammatory cells into the brain is based on
    >>>>>>>>> immunohistochemistry and especially on flow cytometry of brain samples [
    >>>>>>>>> 47 <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B47>, 52
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B52>].
    >>>>>>>>> However, there are important limitations of these approaches. For flow
    >>>>>>>>> cytometric analysis, there is a need to isolate cells from brain tissue
    >>>>>>>>> using enzymatic digestion ex vivo. The surface antigens for specific types
    >>>>>>>>> of inflammatory cells may be modulated after the enzymatic digestion. In
    >>>>>>>>> addition, immunohistochemistry and flow cytometry cannot examine dynamic
    >>>>>>>>> alteration in the same animal as a result of a nonsurvival procedure.
    >>>>>>>>> Similarly, our current knowledge about adhesive interactions of
    >>>>>>>>> inflammatory cells with cerebral microcirculation after cerebral I/R is
    >>>>>>>>> based on optical imaging technologies (especially on intravital
    >>>>>>>>> microscopy), which allow for observation and quantification of cell
    >>>>>>>>> adhesion to the walls of intact cerebral microvessels [8
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B8>, 40
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B40>].
    >>>>>>>>> There are important limitations of these approaches, including the need to
    >>>>>>>>> examine microvessels on or near the brain surface, labeling the total
    >>>>>>>>> leukocyte population, and being unable to assess early and late adhesive
    >>>>>>>>> events in the same animal as a result of a nonsurvival procedure. Of note,
    >>>>>>>>> there are many inconsistencies in the literature about the time course of
    >>>>>>>>> the recruitment of various inflammatory cells in the brain following focal
    >>>>>>>>> cerebral ischemia, even in the very same experimental animal models [
    >>>>>>>>> 47 <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B47>, 52
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B52>] (*Fig.
    >>>>>>>>> 2*
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/figure/F2/>
    >>>>>>>>> ).
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/figure/F2/>
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/figure/F2/>
    >>>>>>>>>
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/core/lw/2.0/html/tileshop_pmc/tileshop_pmc_inline.html?title=Click%20on%20image%20to%20zoom&p=PMC3&id=2858674_zgb9990951210002.jpg>
    >>>>>>>>> Open in a separate window
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/figure/F2/?report=objectonly>
    >>>>>>>>> Figure 2.
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/figure/F2/>
    >>>>>>>>>
    >>>>>>>>> *Schematic showing a time-dependent recruitment of inflammatory
    >>>>>>>>> cells into the brain following focal cerebral ischemia in mice.* The
    >>>>>>>>> figure, adapted from (A) ref. [52
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B52>] and
    >>>>>>>>> (B) ref. [47
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B47>] with
    >>>>>>>>> permission. Note that a transient 60-min MCAO model in C57Bl6 mice was used
    >>>>>>>>> in both reports.
    >>>>>>>>>
    >>>>>>>>> With improvements in imaging technology and labeling methods, such
    >>>>>>>>> as positron emission tomography/single photon emission tomography and
    >>>>>>>>> functional MRI, it has now become possible to examine accurately
    >>>>>>>>> inflammatory cell trafficking and the molecular activity (e.g., MPO and
    >>>>>>>>> oxidative activity) noninvasively in ischemic brain parenchyma in living
    >>>>>>>>> animals. Advanced imaging techniques and experimental approaches will
    >>>>>>>>> provide the opportunity to visualize and assess more directly the dynamic
    >>>>>>>>> profiles of specific inflammatory cell trafficking, adhesive interactions,
    >>>>>>>>> and molecular activity of these inflammatory cells with cerebral
    >>>>>>>>> microcirculation and with each other in the brains of living animals at
    >>>>>>>>> early and late stages of cerebral I/R. The application of such imaging
    >>>>>>>>> technologies and approaches should help to address some important
    >>>>>>>>> unanswered questions about how these cells contribute to ischemic brain
    >>>>>>>>> injury differentially and collaboratively.
    >>>>>>>>> Go to: <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#>
    >>>>>>>>> ROLE OF ACTIVATED MICROGLIA/MACROPHAGES IN CEREBRAL I/R DAMAGE
    >>>>>>>>>
    >>>>>>>>> Resident microglial cells are major inflammatory cells in the
    >>>>>>>>> brain that are among the first cells to respond to brain injury, and
    >>>>>>>>> multiple lines of evidence have shown that activated microglia play a dual
    >>>>>>>>> role in ischemic stroke. Microglia exert neurotoxic functions through the
    >>>>>>>>> production of ROS via NADPH oxidase [56
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B56>],
    >>>>>>>>> cytokines (IL-1β, IL-6, TNF-α) [30
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B30>, 31
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B31>], and
    >>>>>>>>> MMP-9 [57
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B57>].
    >>>>>>>>> These events precede leukocyte infiltration into the brain and may play a
    >>>>>>>>> crucial role in mediating the initial increase in BBB permeability and the
    >>>>>>>>> early infiltration of circulating leukocytes into the brain [56
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B56>,57
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B57>,58
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B58>].
    >>>>>>>>> Microglia activation potentiates damage to BBB integrity, whereas
    >>>>>>>>> inhibition of microglial activation may protect the brain after ischemic
    >>>>>>>>> stroke by improving BBB viability and integrity in vivo and in vitro [
    >>>>>>>>> 58 <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B58>].
    >>>>>>>>>
    >>>>>>>>> In contrast, activated microglia also appear to play a
    >>>>>>>>> neuroprotective role after cerebral ischemia [59
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B59>,60
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B60>,61
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B61>,62
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B62>].
    >>>>>>>>> Production of neurotoxic and neuroprotective factors emphasizes the complex
    >>>>>>>>> role of resident microglia in the process of tissue damage, neuronal
    >>>>>>>>> survival, and regeneration in the response to cerebral ischemia. The
    >>>>>>>>> protective role of microglia is possibly mediated by their ability to
    >>>>>>>>> eliminate excess excitotoxins in the extracellular space, in part through
    >>>>>>>>> phagocytosis of infiltrating neutrophils [39
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B39>].
    >>>>>>>>> Further, accumulating evidence indicates that microglia can produce various
    >>>>>>>>> neurotrophic factors such as neurotrophins and growth factors (fibroblast
    >>>>>>>>> growth factor, TGF-β1), which are involved in neuronal survival and brain
    >>>>>>>>> tissue repair in cases of brain injury [59
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B59>,60
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B60>,61
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B61>,62
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B62>].
    >>>>>>>>> Intriguingly, recent work [63
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B63>] has
    >>>>>>>>> identified a neuroprotective role for microglia-derived TNF in cerebral
    >>>>>>>>> ischemia through TNF-p55R in mice.
    >>>>>>>>>
    >>>>>>>>> Experimentally, TNF has neuroprotective and neurotoxic effects.
    >>>>>>>>> Although TNF can be produced by microglia and infiltrating leukocytes in
    >>>>>>>>> the brain, the neuroprotective effects of TNF appear to be attributed to
    >>>>>>>>> microglia- but not leukocyte-derived TNF. These findings may have clinical
    >>>>>>>>> relevance and potential applications. TNF is implicated in ischemic stroke
    >>>>>>>>> and trauma in humans [64
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B64>],
    >>>>>>>>> where similar to the mouse [65
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B65>, 66
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B66>], it
    >>>>>>>>> is produced by microglia and infiltrating leukocytes [67
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B67>]. In
    >>>>>>>>> addition, abundant evidence indicates a neuroprotective role of
    >>>>>>>>> proliferating microglial cells in cerebral ischemia in vivo [38
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B38>, 39
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B39>].
    >>>>>>>>> Selective ablation of proliferating microglial cells exacerbates ischemic
    >>>>>>>>> brain injury associated with a decrease in insulin-like growth factor-1 and
    >>>>>>>>> an increase in cytokines (IL-1β, IL-6, TNF-α) [38
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B38>].
    >>>>>>>>>
    >>>>>>>>> As discussed above, activated microglia are morphologically and
    >>>>>>>>> functionally indistinguishable from blood-derived monocyte/macrophages in
    >>>>>>>>> the brain. Thus, it has been difficult to determine their distinct
    >>>>>>>>> contribution to the pathogenesis of ischemic stroke. Nevertheless, the
    >>>>>>>>> difference of the time course of their recruitment in the brain suggests
    >>>>>>>>> that they contribute to ischemic brain injury in different time-dependent
    >>>>>>>>> manners. Experimental studies using GFP bone marrow chimera mice indicate
    >>>>>>>>> that blood-derived macrophage infiltration into the brain occurs at a later
    >>>>>>>>> time after focal cerebral I/R [24
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B24>, 25
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B25>, 41
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B41>].
    >>>>>>>>> These studies have revealed significant differences in terms of the ratio
    >>>>>>>>> and contribution of resident microglia versus exogenous infiltrating
    >>>>>>>>> macrophages to early postischemic cerebral injury. Resident microglia
    >>>>>>>>> dominate over blood-derived macrophages during the first 3–4 days of
    >>>>>>>>> cerebral I/R [24
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B24>, 25
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B25>, 41
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B41>]. In
    >>>>>>>>> the absence of blood-derived monocytes, brain microglia is able to
    >>>>>>>>> differentiate into macrophages [56
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B56>].
    >>>>>>>>>
    >>>>>>>>> Regardless of their origin, activated microglia/macrophages seem
    >>>>>>>>> to be critical in the clearance of infiltrating neutrophils after cerebral
    >>>>>>>>> I/R. As discussed above, neutrophil infiltration occurs in the first 3 days
    >>>>>>>>> after cerebral I/R, and thereafter, macrophage-like cells replace them as
    >>>>>>>>> the dominant inflammatory cells in the ischemic site. The major pathway for
    >>>>>>>>> clearance of infiltrating neutrophils and their potentially cytotoxic
    >>>>>>>>> substances from the inflammatory sites is apoptosis followed by engulfment
    >>>>>>>>> by activated microglia/macrophages [68
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B68>,69
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B69>,70
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B70>,71
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B71>].
    >>>>>>>>> Macrophages can resolve neutrophils and therefore, reduce neuronal injury
    >>>>>>>>> by triggering neutrophil apoptosis, engulfing them, and thereby preventing
    >>>>>>>>> the release of cytotoxic substances into the surrounding tissue [
    >>>>>>>>> 68 <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B68>, 69
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B69>].
    >>>>>>>>> Induction of apoptosis and phagocytosis of apoptotic neutrophils by
    >>>>>>>>> reactive microglia/macrophages is a critical step in the resolution of the
    >>>>>>>>> inflammatory response and in preventing further exacerbation of the
    >>>>>>>>> ischemic injury [69
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B69>, 71
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B71>]. In
    >>>>>>>>> a rat model of endothelin-1-induced cerebral ischemia, Weston et al. [
    >>>>>>>>> 46 <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B46>, 72
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B72>]
    >>>>>>>>> demonstrate that large-scale emigration of neutrophils into the ischemic
    >>>>>>>>> region occurs during the first day and peaks at 3 days after cerebral
    >>>>>>>>> ischemia. Double immunostaining clearly shows that macrophages (stained by
    >>>>>>>>> ED-1) engulf neutrophils (stained by anti-polymorphonuclear neutrophil
    >>>>>>>>> sera) in the brain and that this engulfment of invading neutrophils
    >>>>>>>>> increases with time (50% of neutrophils in the brain are engulfed at 3 days
    >>>>>>>>> and 85% at 15 days) [46
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B46>].
    >>>>>>>>> Nevertheless, it is unclear whether the “ED-1-stained cells” in the brain
    >>>>>>>>> represent activated resident microglia or/and infiltrating macrophages.
    >>>>>>>>> Go to: <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#>
    >>>>>>>>> ROLE OF NEUTROPHIL INFILTRATION IN CEREBRAL I/R DAMAGE
    >>>>>>>>>
    >>>>>>>>> Despite intense investigation, the exact role of neutrophils in
    >>>>>>>>> the pathogenesis of ischemic stroke remains under debate. Most experimental
    >>>>>>>>> and clinical studies support the importance of neutrophil infiltration in
    >>>>>>>>> ischemic stroke. In animal models of focal cerebral I/R, recruitment of
    >>>>>>>>> neutrophils in the ischemic brain occurs within 30 min to a few hours and
    >>>>>>>>> peaks in the first 3 days [8
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B8>, 23
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B23>].
    >>>>>>>>> Genetic deficiency or antibody blockade of leukocyte adhesion molecules
    >>>>>>>>> (e.g., ICAM-1, CD11b/CD18, P-selectin) [8
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B8>,9
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B9>,10
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B10>,11
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B11>, 17
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B17>,18
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B18>,19
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B19>,20
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B20>,21
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B21>, 49
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B49>] has
    >>>>>>>>> been shown to reduce infarct volume, brain edema, neurological deficits,
    >>>>>>>>> and mortality in animal models of ischemic stroke. These protective effects
    >>>>>>>>> appear to be more effective in the transient but not permanent MCAO models
    >>>>>>>>> in rats and mice. Clinical studies have confirmed that neutrophils
    >>>>>>>>> accumulate intensively in the regions of human cerebral infarction, and
    >>>>>>>>> this accumulation is correlated with the severity of the brain tissue
    >>>>>>>>> damage and poor neurological outcome after ischemic stroke [28
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B28>, 29
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B29>, 73
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B73>].
    >>>>>>>>> Furthermore, total leukocyte and neutrophil counts are increased in the
    >>>>>>>>> first 3 days after symptom onset in stroke patients, and this is associated
    >>>>>>>>> with larger final infarct volumes (on CT and MRI) and increased stroke
    >>>>>>>>> severity [27
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B27>, 29
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B29>]. A
    >>>>>>>>> number of potential mechanisms may explain how activation and accumulation
    >>>>>>>>> of neutrophils contribute to the pathogenesis of ischemic stroke. These
    >>>>>>>>> mechanisms include: excessive production of ROS, such as superoxide and
    >>>>>>>>> hypochlorous acid via NADPH oxidase and MPO, respectively; release of a
    >>>>>>>>> variety of proinflammatory cytokines (IL-1β, IL-6, TNF-α) and chemokines
    >>>>>>>>> (MCP-1, MIP-1α, IL-8); release of elastase and MMPs (mainly MMP-9); and
    >>>>>>>>> enhancing expression of leukocyte β2-integrins (Mac-1, LFA-1) and adhesion
    >>>>>>>>> molecules (PSGL-1, L-selectin). By these mechanisms, infiltrating
    >>>>>>>>> neutrophils amplify a cerebral inflammatory response that may exacerbate
    >>>>>>>>> ischemic brain injury further [8
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B8>, 22
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B22>, 23
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B23>] (Fig.
    >>>>>>>>> 1)
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/figure/F1/>.
    >>>>>>>>> Nevertheless, the pathogenic role of neutrophils in ischemic stroke remains
    >>>>>>>>> uncertain, and some studies fail to demonstrate a clear correlation between
    >>>>>>>>> neutrophil infiltration and infarct formation [74
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B74>,75
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B75>,76
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B76>,77
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B77>,78
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B78>,79
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B79>].
    >>>>>>>>>
    >>>>>>>>> Recent studies suggest that neutrophil infiltration may play a
    >>>>>>>>> more prominent role in the pathogenesis of ischemic stroke in individuals
    >>>>>>>>> with elevated systemic inflammation. In stroke patients with prior
    >>>>>>>>> infection, total leukocyte and neutrophil counts and the extent of
    >>>>>>>>> leukocyte-platelet adhesion and activation are elevated in the circulation [
    >>>>>>>>> 29 <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B29>, 80
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B80>, 81
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B81>].
    >>>>>>>>> Recent experimental studies have shown that systemic inflammation
    >>>>>>>>> exacerbates neutrophil infiltration in the brain and thus, alters the
    >>>>>>>>> kinetics of the BBB tight junction disruption after experimental stroke in
    >>>>>>>>> mice [4 <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B4>
    >>>>>>>>> , 82 <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B82>].
    >>>>>>>>> These studies clearly demonstrate that infiltrating neutrophils are the
    >>>>>>>>> primary source of increased (fivefold) MMP-9 activity in the ischemic brain
    >>>>>>>>> of IL-1β-challenged mice at 4, 8, or 24 h after MCAO. A transformation from
    >>>>>>>>> transient to sustained BBB disruption caused by enhanced neutrophil-derived
    >>>>>>>>> neurovascular MMP-9 is a critical mechanism underlying the exacerbation of
    >>>>>>>>> ischemic brain injury by systemic inflammation, mediated through conversion
    >>>>>>>>> of a transient to a sustained disruption of the tight junction protein,
    >>>>>>>>> claudin-5, and markedly exacerbated disruption of the cerebrovascular basal
    >>>>>>>>> lamina protein, collagen-IV [82
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B82>].
    >>>>>>>>> These molecular mechanisms may contribute to the poor clinical outcome in
    >>>>>>>>> stroke patients presenting with antecedent infection. Stroke patients
    >>>>>>>>> presenting with an elevated systemic inflammatory status may be at
    >>>>>>>>> increased risk of MMP-9-mediated neurovascular proteolysis and hemorrhagic
    >>>>>>>>> transformation [83
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B83>],
    >>>>>>>>> particularly when recombinant tPA is administered for thrombolytic therapy,
    >>>>>>>>> as tPA is known to promotes neutrophil degranulation and MMP-9 release [
    >>>>>>>>> 84 <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B84>, 85
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B85>]. In
    >>>>>>>>> this regard, it is critical to better understand the exact roles of
    >>>>>>>>> neutrophils in the pathogenesis of ischemic stroke under clinically
    >>>>>>>>> relevant conditions that are linked to an elevated systemic inflammatory
    >>>>>>>>> status, such as prior infection, atherosclerosis, type 2 diabetes, obesity,
    >>>>>>>>> and rheumatoid arthritis.
    >>>>>>>>> Go to: <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#>
    >>>>>>>>> ROLE OF DIFFERENT SUBTYPES OF T LYMPHOCYTES IN CEREBRAL I/R DAMAGE
    >>>>>>>>>
    >>>>>>>>> In recent years, considerable research efforts have been devoted
    >>>>>>>>> to understanding the roles of lymphocytes in ischemic brain injury. Several
    >>>>>>>>> subtypes of T cells have been implicated in the pathogenesis of ischemic
    >>>>>>>>> stroke, and accumulating evidence indicates that different subtypes of T
    >>>>>>>>> cells play differential roles in response to cerebral I/R injury.
    >>>>>>>>> CD4+ and CD8+ T cells
    >>>>>>>>>
    >>>>>>>>> Experimental evidence indicates that in the vascular bed of other
    >>>>>>>>> organs (e.g., intestine, liver, and kidney), CD4+ and CD8+ T cells
    >>>>>>>>> contribute importantly to the pathogenesis of I/R injury [86
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B86>,87
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B87>,88
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B88>].
    >>>>>>>>> Recent work has shown that CD4+ and CD8+ T cells are major contributors to
    >>>>>>>>> brain inflammation in a mouse model of transient MCAO. Studies using
    >>>>>>>>> intravital video microscopy show that Rag1(−/−), CD4+ T cell(−/−), CD8+ T
    >>>>>>>>> cell(−/−), and IFN-γ(−/−) mice have comparable, significant reductions in
    >>>>>>>>> cerebral I/R-induced leukocyte and platelet adhesion in cerebral
    >>>>>>>>> microcirculation, compared with wild-type mice after exposure to focal
    >>>>>>>>> cerebral I/R [40
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B40>].
    >>>>>>>>> Futhermore, data indicate that CD4+ and CD8+ T cells contribute to the
    >>>>>>>>> inflammatory and thrombogenic responses, brain infarction, and neurological
    >>>>>>>>> deficit associated with experimental stroke [40
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B40>].
    >>>>>>>>> Moreover, experimental studies have shown that CD4+ TH1 cells may play a
    >>>>>>>>> key role in the pathogenesis of stroke through releasing proinflammatory
    >>>>>>>>> cytokines, including IL-2, IL-12, IFN-γ, and TNF-α, whereas CD4+ TH2 cells
    >>>>>>>>> may play a protective role through anti-inflammatory cytokines such as
    >>>>>>>>> IL-4, IL-5, IL-10, and IL-13 [89
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B89>]. It
    >>>>>>>>> is important to note that some of these cytokines, especially IFN-γ, are
    >>>>>>>>> known to be critical in prevention of infections, which are a leading cause
    >>>>>>>>> of death in stroke patients, especially in the postacute phase of stroke [
    >>>>>>>>> 90 <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B90>],
    >>>>>>>>> which results mainly from immunodepression caused by depletion of
    >>>>>>>>> circulating T cell and NK cell populations and therefore, the antibacterial
    >>>>>>>>> cytokine IFN-γ in the early reperfusion period [90
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B90>].
    >>>>>>>>> Therefore, treatment of stroke patients by targeting T cells must be
    >>>>>>>>> designed carefully to evaluate and reduce deleterious and enhance
    >>>>>>>>> protective actions of specific T cell subtypes.
    >>>>>>>>> Treg cells
    >>>>>>>>>
    >>>>>>>>> Treg cells come in many forms, including CD4+CD25+ forkhead box
    >>>>>>>>> p3+ T cells (Tregs) and other subsets. Treg cells play a key part in
    >>>>>>>>> controlling immune responses under physiological conditions and in various
    >>>>>>>>> systemic and CNS inflammatory diseases [91
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B91>,92
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B92>,93
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B93>].
    >>>>>>>>> Experimental data have shown that Treg cells are capable of modulating
    >>>>>>>>> effector T cell function and secreting anti-inflammatory cytokines (IL-10,
    >>>>>>>>> TGF-β) [94
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B94>, 95
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B95>].
    >>>>>>>>> These actions enable Treg cells to be pivotal players in the fields of
    >>>>>>>>> self-tolerance, immunologic homeostasis, and damage control at the site of
    >>>>>>>>> inflammation [96
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B96>].
    >>>>>>>>> More recently, an elegant study by Liesz et al. [97
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B97>]
    >>>>>>>>> reveals that the Treg cells are key cerebroprotective immunomodulators in
    >>>>>>>>> acute experimental stroke in mice. They found that Treg cells prevent
    >>>>>>>>> secondary infarct growth by counteracting excessive production of
    >>>>>>>>> proinflammatory cytokines and by modulating invasion and/or activation of
    >>>>>>>>> lymphocytes and microglia in the ischemic brain. Depletion of Treg cells
    >>>>>>>>> increases delayed brain damage profoundly and deteriorates functional
    >>>>>>>>> outcome, and Treg cells antagonize enhanced TNF-α and IFN-γ production,
    >>>>>>>>> which induce delayed inflammatory brain damage. Also, Treg cell-derived
    >>>>>>>>> secretion of IL-10 is the key mediator of cerebroprotection via suppression
    >>>>>>>>> of deleterious cerebral cytokine (TNF-α, IFN-γ) production. Absence of
    >>>>>>>>> Treg cells augmented postischemic activation of resident and infiltrating
    >>>>>>>>> inflammatory cells including microglia and T cells, the main sources of
    >>>>>>>>> cerebral TNF-α and IFN-γ [97
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B97>, 98
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B98>],
    >>>>>>>>> respectively. TNF-α expression is elevated early after ischemia in the
    >>>>>>>>> brain, where it is generated predominantly by microglia. Whereas IFN-γ is
    >>>>>>>>> almost absent in normal brain tissue, its expression increases at a later
    >>>>>>>>> time-point after cerebral ischemia than does TNF-α expression, and its
    >>>>>>>>> expression is strongly induced after Treg cell depletion. Taken together,
    >>>>>>>>> these findings reveal a previously unknown role of the Treg cells as
    >>>>>>>>> cerebroprotective immunomodulators after stroke, thus potentially providing
    >>>>>>>>> new insights into the endogenous adaptive immune response after acute brain
    >>>>>>>>> ischemia.
    >>>>>>>>> γδT cells
    >>>>>>>>>
    >>>>>>>>> γδT cells represent a small subset of T cells that possesses a
    >>>>>>>>> distinct TCR on their surface. A majority of T cells has a TCR composed of
    >>>>>>>>> two glycoprotein chains, called α and β TCR chains. In contrast, in γδT
    >>>>>>>>> cells, the TCR is made up of one γ-chain and one δ-chain. This group of T
    >>>>>>>>> cells is usually much less common than αβT cells [99
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B99>]. The
    >>>>>>>>> conditions that lead to responses of γδT cells are not fully understood,
    >>>>>>>>> and current concepts of γδT cells as “first line of defense”, “regulatory
    >>>>>>>>> cells”, or “bridge between innate and adaptive responses” [99
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B99>] only
    >>>>>>>>> address facets of their complex behavior. A recent study by Shibata et al. [
    >>>>>>>>> 100 <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B100>]
    >>>>>>>>> demonstrates that resident γδT cells control early infiltration of
    >>>>>>>>> neutrophils in the peritoneal cavity of mice after *Escherichia
    >>>>>>>>> coli* infection. They indicate that a rapid and transient
    >>>>>>>>> production of IL-17 after i.p. infection with *E. coli* precedes
    >>>>>>>>> the influx of neutrophils. Flow cytometric analysis of intracellular
    >>>>>>>>> cytokine demonstrates that the γδT cell population is the major source of
    >>>>>>>>> IL-17. Neutralization of IL-17 results in a reduced infiltration of
    >>>>>>>>> neutrophils and impaired bacterial clearance. Mice depleted of γδT cells by
    >>>>>>>>> anti-TCR-γδ mAb treatment have diminished IL-17 production and reduced
    >>>>>>>>> neutrophil infiltration after *E. coli* infection [100
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B100>].
    >>>>>>>>> More recently, an elegant study by Shichita et al. [101
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B101>]
    >>>>>>>>> reveals a pivotal role of cerebral IL-17-producing γδT cells in the delayed
    >>>>>>>>> phase of ischemic brain injury. In a mouse model of transient MCAO, they
    >>>>>>>>> demonstrate that the infiltration of T cells into the brain as well as the
    >>>>>>>>> production of cytokines IL-17 and IL-23 play pivotal roles in the evolution
    >>>>>>>>> of brain infarction and accompanying neurological deficits. Blockade of T
    >>>>>>>>> cell infiltration into the brain by the immunosuppressant FTY720 reduced
    >>>>>>>>> cerebral I/R damage. The expression of IL-23 (most likely derived from
    >>>>>>>>> activated microglia/macrophages) [102
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B102>, 103
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B103>]
    >>>>>>>>> increases on Day 1 after I/R, whereas IL-17 levels are elevated after Day
    >>>>>>>>> 3, and this induction of IL-17 was dependent on IL-23. Immunohistochemistry
    >>>>>>>>> shows that γδT cells are localized in the infarct boundary zones at 4 days
    >>>>>>>>> after cerebral I/R. Intracellular cytokine staining confirms that γδT cells
    >>>>>>>>> are a major source of IL-17. Further, gene knockouts demonstrate that IL-23
    >>>>>>>>> functions in the immediate stage of cerebral I/R injury, whereas IL-17 is
    >>>>>>>>> an important role in the delayed phase of cerebral I/R injury, during which
    >>>>>>>>> apoptotic neuronal death occurs in the penumbra. A significant reduction in
    >>>>>>>>> infarct volume is observed in TCR-γδ knockout mice, as well as in mice
    >>>>>>>>> treated with TCR-γδ-specific antibody [100
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B100>].
    >>>>>>>>> These findings reveal a previously unknown role of the γδT cells in the
    >>>>>>>>> pathogenesis of ischemic stroke. Therefore, the γδT cells could be a novel,
    >>>>>>>>> therapeutic target for limiting the inflammatory events that amplify the
    >>>>>>>>> initial damage during cerebral I/R.
    >>>>>>>>> Go to: <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#>
    >>>>>>>>> ROLE OF OTHER INFLAMMATORY CELLS IN CEREBRAL I/R DAMAGE
    >>>>>>>>> DCs
    >>>>>>>>>
    >>>>>>>>> DCs are immune cells that form part of the mammalian immune system
    >>>>>>>>> and constitute key elements in the control of immune activation or immune
    >>>>>>>>> tolerance [104
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B104>].
    >>>>>>>>> Their main function is to process antigen material and present it on the
    >>>>>>>>> surface to other cells of the immune system, thus functioning as effective
    >>>>>>>>> APCs [105
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B105>].
    >>>>>>>>> There are at least two major lineages of DCs [106
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B106>]:
    >>>>>>>>> mDCs, which respond to bacteria and fungi, releasing IL-12, and pDCs, which
    >>>>>>>>> release IFN-α upon viral infection. Both lineages are detected as DCPs in
    >>>>>>>>> blood, patrolling through the circulation and invading the tissue in
    >>>>>>>>> response to a local infection or other inflammatory situation. mDCs and/or
    >>>>>>>>> pDCs appear to play a role in several proinflammatory diseases, especially
    >>>>>>>>> atherosclerosis [104
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B104>, 107
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B107>]. In
    >>>>>>>>> multiple sclerosis, mDCs invade the human brain, subsequently triggering
    >>>>>>>>> cerebral inflammation [108
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B108>].
    >>>>>>>>>
    >>>>>>>>> Several clinical and experimental studies suggest the potential
    >>>>>>>>> importance of DCs in cerebral inflammation and tissue injury during
    >>>>>>>>> ischemic stroke [54
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B54>, 109
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B109>, 110
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B110>].
    >>>>>>>>> Using flow cytometeric analysis of blood samples, Yilmaz et al. [
    >>>>>>>>> 109 <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B109>]
    >>>>>>>>> found that acute stroke leads to a significant but transient decrease in
    >>>>>>>>> circulating DCPs within 24 h after symptom onset in stroke patients, and
    >>>>>>>>> patients with large stroke size in CT scan have significantly lower mDCP,
    >>>>>>>>> pDCP, and total DCPs than those with smaller stroke. Follow-up analysis
    >>>>>>>>> shows a significant recovery of circulating DCP in the first 2–4 days after
    >>>>>>>>> stroke. Double immunohistochemical staining demonstrates colocalization of
    >>>>>>>>> mDCs and T cells and a high expression of HLA-DR close to mDCs observed,
    >>>>>>>>> suggesting that mDCs are mature and able to activate T cells in the
    >>>>>>>>> infarcted brain [109
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B109>].
    >>>>>>>>> Thus, circulating DCPs may be recruited into the infarcted brain and
    >>>>>>>>> thereby trigger cerebral immune/inflammatory reactions in the brain. This
    >>>>>>>>> view is also supported by previous findings that have shown that DCs are
    >>>>>>>>> present in the ischemic brain in a rat model of permanent MCAO [
    >>>>>>>>> 110 <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B110>].
    >>>>>>>>> Immunohistochemistry showed that numbers of DCs are low in nonischemic
    >>>>>>>>> (sham) brains but are elevated in the ischemic hemispheres at 1 h (11-fold
    >>>>>>>>> increase) and increase further in the 6-day observation period with an
    >>>>>>>>> 84-fold increase at 6 days after MCAO. Activated DCs expressing MHC-II
    >>>>>>>>> remain elevated at 6 days after MCAO in the ischemic versus nonischemic
    >>>>>>>>> hemispheres [110
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B110>].
    >>>>>>>>> More recently, Gelderblom et al. [47
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B47>]
    >>>>>>>>> demonstrate that DCs are increased by 20-fold on Day 3 and 12-fold on Day 7
    >>>>>>>>> and thus, constituted a substantial proportion of infiltrating cells. DCs
    >>>>>>>>> exhibit a significant up-regulation of MHC-II, and the increase of DCs is
    >>>>>>>>> even more pronounced if only MHCII high-expressing DCs are analyzed
    >>>>>>>>> (100-fold increase). To date, there is no direct experimental evidence
    >>>>>>>>> showing the correlation between the increase of DC numbers and brain
    >>>>>>>>> infarction in cerebral ischemia. Nevertheless, these previous observations
    >>>>>>>>> may constitute a basis for further studies about DCs in the pathogenesis of
    >>>>>>>>> ischemic stroke.
    >>>>>>>>> MCs
    >>>>>>>>>
    >>>>>>>>> MCs reside in a variety of locations in the brain of different
    >>>>>>>>> species, including humans, where they appear to be concentrated in the
    >>>>>>>>> diencephalic parenchyma, thalamus, and cerebral cortex [111
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B111>, 112
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B112>].
    >>>>>>>>> Their subendothelial and perivascular location at the boundary between the
    >>>>>>>>> intravascular and extravascular milieus and their ability to respond
    >>>>>>>>> rapidly to blood- and tissue-borne stimuli via release of potent
    >>>>>>>>> vasodilatory, proteolytic, fibrinolytic, and proinflammatory mediators
    >>>>>>>>> render MCs with a unique status to act in the first-line defense in various
    >>>>>>>>> pathologies [55
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B55>].
    >>>>>>>>> Experimental evidence indicates an emerging role of mast cells in cerebral
    >>>>>>>>> ischemic injury and hemorrhage [55
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B55>]. In
    >>>>>>>>> experimental cerebral I/R, MCs regulate BBB permeability, brain edema
    >>>>>>>>> formation, and the intensity of local neutrophil infiltration [55
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B55>].
    >>>>>>>>> Strbian et al. [113
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B113>]
    >>>>>>>>> demonstrate that cerebral MCs regulate early ischemic brain swelling and
    >>>>>>>>> neutrophil accumulation in a rat model of transient MCAO. Pharmacological
    >>>>>>>>> MC-blocking (sodium cromoglycate) leads to a 39% decrease in brain
    >>>>>>>>> swelling, and compound 48/80 (MC-degranulating agent) elevates it by 89%.
    >>>>>>>>> Early ischemic BBB leakage and postischemic neutrophil infiltration are
    >>>>>>>>> significantly lower in MC-deficient rats than in the wild-type. In
    >>>>>>>>> addition, MCs appear to play a role in the tPA-mediated cerebral
    >>>>>>>>> hemorrhages after experimental ischemic stroke and to be involved in the
    >>>>>>>>> expansion of hematoma and edema following intracerebral hemorrhage [
    >>>>>>>>> 113 <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B113>,
    >>>>>>>>> 114 <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B114>].
    >>>>>>>>> MC stabilization was reported to reduce hemorrhagic transformation and
    >>>>>>>>> mortality after administration of thrombolytics in experimental ischemic
    >>>>>>>>> stroke [114
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B114>].
    >>>>>>>>> Thus, MC stabilization may provide an adjuvant therapy in treatment of
    >>>>>>>>> acute ischemic stroke in patients.
    >>>>>>>>> Go to: <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#>
    >>>>>>>>> ANTI-INFLAMMATORY THERAPY
    >>>>>>>>>
    >>>>>>>>> The pathologic processes after ischemic stroke can be separated
    >>>>>>>>> into acute (within hours), subacute (hours to days), and chronic (days to
    >>>>>>>>> months) phases [115
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B115>, 116
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B116>].
    >>>>>>>>> Clinical and experimental data show an acute and prolonged inflammatory
    >>>>>>>>> response in the brain after stroke, and leukocyte recruitment is a hallmark
    >>>>>>>>> feature of the prolonged inflammatory response that occurs over hours to
    >>>>>>>>> days after cerebral ischemia [117
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B117>, 118
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B118>].
    >>>>>>>>> Experimental stroke studies demonstrate that reperfusion represents an
    >>>>>>>>> especially vulnerable period for the brain [8
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B8>,9
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B9>,10
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B10>,11
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B11>], as
    >>>>>>>>> it provides the potential benefits of restoring blood flow to an ischemic
    >>>>>>>>> region and simultaneously opens the flood gates for a massive influx of
    >>>>>>>>> activated leukocytes into ischemic tissue. Thereby, the subacute
    >>>>>>>>> reperfusion period after a stroke is considered more amenable to treatment
    >>>>>>>>> than acute neurotoxicity [116
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B116>,117
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B117>,118
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B118>]. It
    >>>>>>>>> is hypothesized that stroke outcomes may be improved by antileukocyte
    >>>>>>>>> strategies (including antiadhesion molecule strategies), which are targeted
    >>>>>>>>> specifically to the reperfusion period. This hypothesis is supported by
    >>>>>>>>> numerous experimental findings [8
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B8>, 15
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B15>]. As
    >>>>>>>>> discussed above, inhibition of leukocyte infiltration into the ischemic
    >>>>>>>>> brain via antiadhesion molecules (e.g., CD11b/CD18, ICAM-1, P-selectin) has
    >>>>>>>>> been shown to reduce infarct size, edema, and neurological deficits in
    >>>>>>>>> transient MCAO stroke models in rats and mice [9
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B9>,10
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B10>,11
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B11>, 17
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B17>,18
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B18>,19
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B19>,20
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B20>,21
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B21>, 72
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B72>], but
    >>>>>>>>> the benefits do not extend to permanent MCAO [9
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B9>, 10
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B10>].
    >>>>>>>>> Further, experimental studies demonstrate that antileukocyte strategies may
    >>>>>>>>> extend the therapeutic time window of tPA reperfusion therapy in acute
    >>>>>>>>> stroke [8
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B8>, 15
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B15>]. For
    >>>>>>>>> example, in a rat thromboembolic stroke model, UK-279276 treatment reduces
    >>>>>>>>> infarct size only in combination with tPA and prolongs the efficacy “time
    >>>>>>>>> window” for tPA from 2 h to 4 h [11
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B11>].
    >>>>>>>>> UK-279276 is a recombinant glycoprotein and is a selective antagonist of
    >>>>>>>>> the CD11b integrin of Mac-1 (CD11b/CD18) and has been shown to reduce
    >>>>>>>>> neutrophil infiltration and infarct volume in the transient MCAO model in
    >>>>>>>>> rats when administered within 4 h after onset of ischemia [119
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B119>].
    >>>>>>>>> These results raise the question of whether antileukocyte strategies
    >>>>>>>>> provide an effective therapy for stroke patients.
    >>>>>>>>>
    >>>>>>>>> Clinically, several drugs that target neutrophil recruitment have
    >>>>>>>>> been developed as potential therapies for ischemic stroke. Three such drugs
    >>>>>>>>> were tested in clinical trials: a mAb to ICAM-1 (Enlimomab, R6.5) [
    >>>>>>>>> 12 <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B12>],
    >>>>>>>>> a humanized antibody to the CD11b/CD18 (Hu23F2G or LeukArrest) [13
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B13>], and
    >>>>>>>>> the UK-279276 [120
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B120>].
    >>>>>>>>> All clinical trials with these drugs have been unsuccessful as a result of
    >>>>>>>>> lack of neuroprotective efficacy and side-effects such as leukopenia and
    >>>>>>>>> immunosuppression. These clinical outcomes further intensify the debate
    >>>>>>>>> over the role of neutrophils in ischemic stroke [74
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B74>,75
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B75>,76
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B76>,77
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B77>,78
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B78>,79
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B79>] and
    >>>>>>>>> raise the question of whether inflammation in general and neutrophils in
    >>>>>>>>> particular may serve as useful therapeutic targets in treatment of human
    >>>>>>>>> stroke.
    >>>>>>>>>
    >>>>>>>>> Despite intense investigation, it remains unclear why
    >>>>>>>>> anti-inflammatory therapy succeeded in animal models but not in clinical
    >>>>>>>>> application. Can animal models truly replicate human stroke? The main
    >>>>>>>>> limitations of the most current animal studies include at least the
    >>>>>>>>> following: limited clinical relevance of the experiments in animal stroke
    >>>>>>>>> models that are performed in young and healthy animals and normal
    >>>>>>>>> physiological conditions and targeting single-cell type (mainly
    >>>>>>>>> neutrophils) and single adhesion molecule (e.g., ICAM-1 or CD11b/CD18). It
    >>>>>>>>> is widely acknowledged that no single animal model replicates human stroke
    >>>>>>>>> perfectly, and the current animal models do not replicate the complexities
    >>>>>>>>> of human stroke. Nevertheless, animal models can provide mechanistic
    >>>>>>>>> insights that have correlated quite well with clinical findings in terms of
    >>>>>>>>> the pathophysiology of stroke [15
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B15>].
    >>>>>>>>>
    >>>>>>>>> In addition to neutrophils, in recent years, considerable research
    >>>>>>>>> has been devoted to understanding the roles of other cell types, in
    >>>>>>>>> particular, T lymphocyte subtypes in ischemic brain injury. Many relevant
    >>>>>>>>> questions remain largely unanswerable, at least at present; for example,
    >>>>>>>>> how different inflammatory cells work together in the brain after stroke
    >>>>>>>>> (in temporal and spatial domains with different time-dependent manners) and
    >>>>>>>>> whether (and how) these cells function in a common pathway contributing to
    >>>>>>>>> the pathogenesis of ischemic stroke. There are no definitive answers to
    >>>>>>>>> questions such as these, because of the complexity and multiplicity of the
    >>>>>>>>> mechanisms by which inflammatory cells contribute to ischemic brain damage.
    >>>>>>>>> Not only do different types of inflammatory cells contribute differentially
    >>>>>>>>> to the pathogenesis of ischemic stroke, but also, the same cell type may
    >>>>>>>>> play different roles in different stages of ischemic stroke. Moreover, the
    >>>>>>>>> same molecule produced by different cells (e.g., microglia- and
    >>>>>>>>> leukocyte-derived TNF-α) may play different roles [63
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B63>, 64
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B64>].
    >>>>>>>>> Nevertheless, oxidative stress might serve as a common pathway for
    >>>>>>>>> different inflammatory cells [56
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B56>].
    >>>>>>>>> Oxidative stress is an important mediator of tissue injury in acute
    >>>>>>>>> ischemic stroke. During ischemic stroke, ROS are generated by various types
    >>>>>>>>> of inflammatory cells and trigger the expression of a number of
    >>>>>>>>> proinflammatory genes, including cytokines and adhesion molecules, which
    >>>>>>>>> play an important role in leukocyte-endothelium interactions and secondary
    >>>>>>>>> brain damage after cerebral ischemia. These proinflammatory genes are
    >>>>>>>>> regulated by oxidant-sensitive transcription factors (e.g., NF-κB) [
    >>>>>>>>> 56 <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B56>].
    >>>>>>>>> Go to: <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#>
    >>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#B116>].
    >>>>>>>>> Go to: <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#>
    >>>>>>>>> AUTHORSHIP
    >>>>>>>>>
    >>>>>>>>> The concept, design, and writing of the manuscript: Guohong Li;
    >>>>>>>>> the literature search and discussion of the manuscript: Rong Jin and Guojun
    >>>>>>>>> Yang, who equally contributed to this work.
    >>>>>>>>> Go to: <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#>
    >>>>>>>>> ACKNOWLEDGMENTS
    >>>>>>>>>
    >>>>>>>>> The work was supported by the National Institutes of Health grant
    >>>>>>>>> HL087990 (G.L.) and by a Scientist Development grant (0530166N) from
    >>>>>>>>> American Heart Association (G.L.). We give special thanks to Dr. Michael
    >>>>>>>>> Wyss for critical review of this manuscript.
    >>>>>>>>> Go to: <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#>
    >>>>>>>>> Footnotes
    >>>>>>>>>
    >>>>>>>>> Abbreviations: BBB=blood-brain barrier, CT=computed tomography,
    >>>>>>>>> DC=dendritic cell, DCP=DC precursor, EC=endothelial cell, I/R=ischemia and
    >>>>>>>>> reperfusion, LFA-1=lymphocyte function associated antigen 1,
    >>>>>>>>> Mac-1=leucocyte integrin CD11B/CD18, MC=mast cell, MCA=middle cerebral
    >>>>>>>>> artery, MCAO=MCA occlusion, mDC=myeloid DC, MMP=matrix metalloproteinase,
    >>>>>>>>> MPO=myeloperoxidase, MRI=magnetic resonance imaging, pDC=plasmacytoid DC,
    >>>>>>>>> PSGL-1=P-selectin glycoprotein ligand-1, ROS=reactive oxygen species,
    >>>>>>>>> tPA=tissue plasminogen activator, Treg cell=T regulatory cell
    >>>>>>>>>
    >>>>>>>>> Go to: <https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2858674/#>
    >>>>>>>>>>>> <https://groups.google.com/> (H. Amini-Khoei).
    >>>>>>>>>>>>>> - In 2018, *1 in every 6 deaths* from cardiovascular
    >>>>>>>>>>>>>> disease was due to stroke.1
    >>>>>>>>>>>>>> - Someone in the United States has a stroke every *40
    >>>>>>>>>>>>>> seconds*. Every *4 minutes*, someone dies of stroke.2
    >>>>>>>>>>>>>> - Every year, more than *795,000 people* in the United
    >>>>>>>>>>>>>> States have a stroke. About 610,000 of these are first or new strokes.2
    >>>>>>>>>>>>>> - About 185,000 strokes—*nearly 1 of 4*—are in people who
    >>>>>>>>>>>>>> have had a previous stroke.2
    >>>>>>>>>>>>>> - About *87%* of all strokes are ischemic strokes
    >>>>>>>>>>>>>> <https://www.cdc.gov/stroke/types_of_stroke.htm>, in which
    >>>>>>>>>>>>>> blood flow to the brain is blocked.2
    >>>>>>>>>>>>>> - Stroke-related costs in the United States came to
    >>>>>>>>>>>>>> nearly *$46 billion* between 2014 and 2015.2 This total
    >>>>>>>>>>>>>> includes the cost of health care services, medicines to treat stroke, and
    >>>>>>>>>>>>>> missed days of work.
    >>>>>>>>>>>>>> - Stroke is a leading cause of serious long-term
    >>>>>>>>>>>>>> disability.2 Stroke reduces mobility in more than half of stroke survivors
    >>>>>>>>>>>>>> age 65 and over.2
    >>>>>>>>>>>>>>
    >>>>>>>>>>>>>> Stroke Statistics by Race and Ethnicity
    >>>>>>>>>>>>>>
    >>>>>>>>>>>>>> - Stroke is a leading cause of death for Americans, but
    >>>>>>>>>>>>>> the risk of having a stroke varies with race and ethnicity.
    >>>>>>>>>>>>>> - Risk of having a first stroke is *nearly twice *as high
    >>>>>>>>>>>>>> for blacks as for whites,2 and blacks have the highest rate of death due to
    >>>>>>>>>>>>>> stroke.1
    >>>>>>>>>>>>>> - Though stroke death rates have declined for decades
    >>>>>>>>>>>>>> among all race/ethnicities, Hispanics have seen an increase in death rates
    >>>>>>>>>>>>>> since 2013.1
    >>>>>>>>>>>>>>
    >>>>>>>>>>>>>> Stroke Risk Varies by Age
    >>>>>>>>>>>>>>
    >>>>>>>>>>>>>> - Stroke risk increases with age, but strokes can—and
    >>>>>>>>>>>>>> do—occur at any age.
    >>>>>>>>>>>>>> - In 2009, *34% *of people hospitalized for stroke were *less
    >>>>>>>>>>>>>> than 65 years old*.3
    >>>>>>>>>>>>>>
    >>>>>>>>>>>>>> Early Action Is Important for Stroke
    >>>>>>>>>>>>>>
    >>>>>>>>>>>>>> Know the warning signs and symptoms
    >>>>>>>>>>>>>> <https://www.cdc.gov/stroke/signs_symptoms.htm> of stroke so
    >>>>>>>>>>>>>> that you can act fast if you or someone you know might be having a stroke.
    >>>>>>>>>>>>>> The chances of survival are greater when emergency treatment begins quickly.
    >>>>>>>>>>>>>>
    >>>>>>>>>>>>>> - In one survey, most respondents—93%—recognized sudden
    >>>>>>>>>>>>>> numbness on one side as a symptom of stroke. Only *38%* were
    >>>>>>>>>>>>>> aware of all major symptoms and knew to call 9-1-1 when someone was having
    >>>>>>>>>>>>>> a stroke.4
    >>>>>>>>>>>>>> - Patients who arrive at the emergency room within 3
    >>>>>>>>>>>>>> hours of their first symptoms often have less disability 3 months after a
    >>>>>>>>>>>>>> stroke than those who received delayed care.4
    >>>>>>>>>>>>>>
    >>>>>>>>>>>>>> Americans at Risk for Stroke
    >>>>>>>>>>>>>>
    >>>>>>>>>>>>>> High blood pressure
    >>>>>>>>>>>>>> <https://www.cdc.gov/bloodpressure/index.htm>, high
    >>>>>>>>>>>>>> cholesterol <https://www.cdc.gov/cholesterol/index.htm>,
    >>>>>>>>>>>>>> smoking, obesity, and diabetes are leading causes of stroke
    >>>>>>>>>>>>>> <https://www.cdc.gov/stroke/risk_factors.htm>. 1 in 3 US
    >>>>>>>>>>>>>> adults has at least one of these conditions or habits.2
    >>>>>>>>>>>>>>
    >>>>>>>>>>>>>> You can take steps to prevent stroke
    >>>>>>>>>>>>>> <https://www.cdc.gov/stroke/prevention.htm>.
    >>>>>>>>>>>>>> More Information
    >>>>>>>>>>>>>>
    >>>>>>>>>>>>>> *From CDC:*
    >>>>>>>>>>>>>> <https://www.cdc.gov/dhdsp/programs/index.htm>
    >>>>>>>>>>>>>>
    >>>>>>>>>>>>>> Learn about CDC programs that address stroke
    >>>>>>>>>>>>>> <https://www.cdc.gov/dhdsp/programs/index.htm>.
    >>>>>>>>>>>>>>
    >>>>>>>>>>>>>> - Vital Signs: Preventing Stroke Deaths
    >>>>>>>>>>>>>> <https://www.cdc.gov/vitalsigns/stroke/>
    >>>>>>>>>>>>>> - Signs and Symptoms of Stroke
    >>>>>>>>>>>>>> <https://www.cdc.gov/stroke/signs_symptoms.htm>
    >>>>>>>>>>>>>> - High Blood Pressure
    >>>>>>>>>>>>>> <https://www.cdc.gov/bloodpressure/facts.htm>
    >>>>>>>>>>>>>> - High Cholesterol
    >>>>>>>>>>>>>> <https://www.cdc.gov/cholesterol/facts.htm>
    >>>>>>>>>>>>>> - Smoking
    >>>>>>>>>>>>>> <https://www.cdc.gov/tobacco/data_statistics/fact_sheets/index.htm>
    >>>>>>>>>>>>>> - Diabetes
    >>>>>>>>>>>>>> <https://www.cdc.gov/diabetes/basics/quick-facts.html>
    >>>>>>>>>>>>>> - Obesity <https://www.cdc.gov/obesity/data/adult.html>
    >>>>>>>>>>>>>>
    >>>>>>>>>>>>>> *From other organizations:*
    >>>>>>>>>>>>>>
    >>>>>>>>>>>>>> - What You Need to Know About Strokeexternal icon
    >>>>>>>>>>>>>> <http://www.ninds.nih.gov/disorders/stroke/stroke_needtoknow.htm>—National
    >>>>>>>>>>>>>> Institute of Neurological Disorders and Stroke
    >>>>>>>>>>>>>> - Know Stroke: Know the Signs, Act in Timeexternal icon
    >>>>>>>>>>>>>> <http://stroke.nih.gov/>–NINDS
    >>>>>>>>>>>>>> - Mind Your Risksexternal icon
    >>>>>>>>>>>>>> <https://mindyourrisks.nih.gov/>–National Institutes of
    >>>>>>>>>>>>>> Health
    >>>>>>>>>>>>>> - Strokeexternal icon
    >>>>>>>>>>>>>> <https://medlineplus.gov/stroke.html>–Medline Plus
    >>>>>>>>>>>>>> - Brain Attack Coalitionexternal icon
    >>>>>>>>>>>>>> <http://www.brainattackcoalition.org/>
    >>>>>>>>>>>>>> - Internet Stroke Centerexternal icon
    >>>>>>>>>>>>>> <http://www.strokecenter.org/>
    >>>>>>>>>>>>>> - Stroke Resource Centerexternal icon
    >>>>>>>>>>>>>> <http://www.strokeassociation.org/STROKEORG/Professionals/Stroke-Resources-for-Professionals_UCM_308581_SubHomePage.jsp>–American
    >>>>>>>>>>>>>> Heart Association/American Stroke Association
    >>>>>>>>>>>>>> - World Stroke Organizationexternal icon
    >>>>>>>>>>>>>> <http://www.world-stroke.org/>
    >>>>>>>>>>>>>>
    >>>>>>>>>>>>>> References
    >>>>>>>>>>>>>>
    >>>>>>>>>>>>>> 1. Centers for Disease Control and Prevention. Underlying
    >>>>>>>>>>>>>> Cause of Death, 1999–2018
    >>>>>>>>>>>>>> <http://wonder.cdc.gov/ucd-icd10.html>. CDC WONDER Online
    >>>>>>>>>>>>>> Database. Atlanta, GA: Centers for Disease Control and Prevention; 2018.
    >>>>>>>>>>>>>> Accessed March 12, 2020.
    >>>>>>>>>>>>>> 2. Virani SS, Alonso A, Benjamin EJ, Bittencourt MS,
    >>>>>>>>>>>>>> Callaway CW, Carson AP, et al. Heart disease and stroke
    >>>>>>>>>>>>>> statistics—2020 update: a report from the American Heart Associationexternal
    >>>>>>>>>>>>>> icon <https://doi.org/10.1161/CIR.0000000000000757>.
    >>>>>>>>>>>>>> *Circulation.* 2020;141(9):e139–e596.
    >>>>>>>>>>>>>> 3. Hall MJ, Levant S, DeFrances CJ. Hospitalization for
    >>>>>>>>>>>>>> stroke in U.S. hospitals, 1989–2009
    >>>>>>>>>>>>>> <http://www.cdc.gov/nchs/products/databriefs/db95.htm>.
    >>>>>>>>>>>>>> NCHS data brief, No. 95. Hyattsville, MD: National Center for Health
    >>>>>>>>>>>>>> Statistics; 2012.
    >>>>>>>>>>>>>> 4. Fang J, Keenan NL, Ayala C, Dai S, Merritt R, Denny
    >>>>>>>>>>>>>> CH. Awareness of stroke warning symptoms—13 states and
    >>>>>>>>>>>>>> the District of Columbia, 2005
    >>>>>>>>>>>>>> <http://www.cdc.gov/mmwr/preview/mmwrhtml/mm5718a2.htm>.
    >>>>>>>>>>>>>> *MMWR *2008;57:481–5.
    >>>>>>>>>>>>>>
    >>>>>>>>>>>>>>
    >>>>>>>>>>>>>> On Monday, May 3, 2021 at 2:49:56 AM UTC-7 Uhohinc wrote:
    >>>>>>>>>>>>>>
    >>>>>>>>>>>>>>> Long-Term Survival and Causes of Death After Stroke
    >>>>>>>>>>>>>>> Henrik Brønnum-Hansen
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#>
    >>>>>>>>>>>>>>> ,
    >>>>>>>>>>>>>>> Michael Davidsen
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#>
    >>>>>>>>>>>>>>> ,
    >>>>>>>>>>>>>>> Per Thorvaldsen
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#>
    >>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#>
    >>>>>>>>>>>>>>> and for the Danish MONICA Study Group
    >>>>>>>>>>>>>>> Originally published1 Sep 2001
    >>>>>>>>>>>>>>> https://doi.org/10.1161/hs0901.094253Stroke.
    >>>>>>>>>>>>>>> 2001;32:2131–2136
    >>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>> Abstract
    >>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>> *Background and Purpose—* As part of the Danish
    >>>>>>>>>>>>>>> contribution to the World Health Organization (WHO) MONICA (Monitoring
    >>>>>>>>>>>>>>> Trends and Determinants in Cardiovascular Disease) Project, a register of
    >>>>>>>>>>>>>>> patients with stroke was established in 1982. The purpose of the present
    >>>>>>>>>>>>>>> study was to analyze long-term survival and causes of death after a first
    >>>>>>>>>>>>>>> stroke and to compare them with those of the background population.
    >>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>> *Methods—* The study population comprised all subjects aged
    >>>>>>>>>>>>>>> 25 years or older who were resident in a geographically defined region in
    >>>>>>>>>>>>>>> Copenhagen County. All stroke events in the study population during
    >>>>>>>>>>>>>>> 1982–1991 were ascertained and validated according to standardized criteria
    >>>>>>>>>>>>>>> outlined for the WHO MONICA Project. After completion of the stroke
    >>>>>>>>>>>>>>> registry at the end of 1991, all patients were followed up by record
    >>>>>>>>>>>>>>> linkage to official registries. Standardized mortality ratios were
    >>>>>>>>>>>>>>> calculated for various causes of death and periods after the stroke.
    >>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>> *Results—* The estimated cumulative risks for death at 28
    >>>>>>>>>>>>>>> days, 1 year, and 5 years after onset were 28%, 41%, and 60%, respectively.
    >>>>>>>>>>>>>>> Compared with the general population, nonfatal stroke was associated with
    >>>>>>>>>>>>>>> an almost 5-fold increase in risk for death between 4 weeks and 1 year
    >>>>>>>>>>>>>>> after a first stroke and a 2-fold increase in the risk for death subsequent
    >>>>>>>>>>>>>>> to 1 year. The excess mortality rate in stroke patients was due mainly to
    >>>>>>>>>>>>>>> cardiovascular diseases but also to cancer, other diseases, accidents, and
    >>>>>>>>>>>>>>> suicide. The probability for long-term survival improved significantly
    >>>>>>>>>>>>>>> during the observation period for patients with ischemic or ill-defined
    >>>>>>>>>>>>>>> stroke.
    >>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>> *Conclusions—* Stroke is a medical emergency associated
    >>>>>>>>>>>>>>> with a very high risk for death in the acute and subacute phases and with a
    >>>>>>>>>>>>>>> continuous excess risk of death. Better prevention and management of
    >>>>>>>>>>>>>>> strokes may improve the long-term survival rate.
    >>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>> Knowledge of the epidemiology of stroke has increased over
    >>>>>>>>>>>>>>> the last decades, although it is well established that stroke is associated
    >>>>>>>>>>>>>>> with a high risk for death, especially in the first few
    >>>>>>>>>>>>>>> weeks after the attack. Studies of incidence and mortality
    >>>>>>>>>>>>>>> have shown that case fatality rates vary considerably among populations.
    >>>>>>>>>>>>>>> 1,2
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R1-094253>
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R2-094253> Few
    >>>>>>>>>>>>>>> studies have been published on the long-term prognosis after stroke, and
    >>>>>>>>>>>>>>> they are somewhat heterogeneous as regards study objectives, design, and
    >>>>>>>>>>>>>>> the subjects investigated.
    >>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>> Studies of the determinants and probabilities of survival
    >>>>>>>>>>>>>>> and at various times after the index stroke have included all strokes,
    >>>>>>>>>>>>>>> 3
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R3-094253> first
    >>>>>>>>>>>>>>> stroke,4–6
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R4-094253>
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R5-094253>
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R6-094253> or
    >>>>>>>>>>>>>>> ischemic stroke,7–10
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R7-094253>
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R8-094253>
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R9-094253>
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R10-094253> with
    >>>>>>>>>>>>>>> emphasis on stroke subtype,11
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R11-094253>
    >>>>>>>>>>>>>>> age,12
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R12-094253> or
    >>>>>>>>>>>>>>> place of management.13
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R13-094253> The
    >>>>>>>>>>>>>>> absolute risk for death after a stroke is an appropriate variable in
    >>>>>>>>>>>>>>> analyses of prognostic factors, but the inferences to be drawn from the
    >>>>>>>>>>>>>>> absolute survival probability may be limited because most stroke patients
    >>>>>>>>>>>>>>> were in their 70s or 80s. Few community-based studies have included
    >>>>>>>>>>>>>>> comparisons of mortality rates after stroke with the mortality rates and
    >>>>>>>>>>>>>>> causes of death in the general population of the same age and sex.
    >>>>>>>>>>>>>>> 4–6,14
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R4-094253>
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R5-094253>
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R6-094253>
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R14-094253>
    >>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>> In this article we describe the long-term absolute and
    >>>>>>>>>>>>>>> relative risks for death and the causes of death of a large, unselected,
    >>>>>>>>>>>>>>> community-based cohort of stroke patients registered in the Danish portion
    >>>>>>>>>>>>>>> of the World Health Organization (WHO) MONICA (Monitoring Trends and
    >>>>>>>>>>>>>>> Determinants in Cardiovascular Disease) Project and compare them with the
    >>>>>>>>>>>>>>> background population from which the cohort was drawn.
    >>>>>>>>>>>>>>> Subjects and Methods
    >>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>> A stroke register was established within the Glostrup
    >>>>>>>>>>>>>>> Population Studies in 1982, with the objective of monitoring stroke events
    >>>>>>>>>>>>>>> in the community over a 10-year period15
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R15-094253> and
    >>>>>>>>>>>>>>> contributing data to the WHO MONICA Project.1,2
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R1-094253>
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R2-094253>
    >>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>> The Danish MONICA population was defined as all residents
    >>>>>>>>>>>>>>> (approximately 330 000) of 11 municipalities in Copenhagen County. Stroke
    >>>>>>>>>>>>>>> events were registered among the subpopulation aged 25 years or older
    >>>>>>>>>>>>>>> (approximately 210 000), and validated, irrespective of survival status and
    >>>>>>>>>>>>>>> place of occurrence and management. Multiple and overlapping sources were
    >>>>>>>>>>>>>>> used to identify strokes among both hospitalized and nonhospitalized
    >>>>>>>>>>>>>>> patients. The details of case ascertainment were described recently.
    >>>>>>>>>>>>>>> 15
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R15-094253>
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R16-094253>
    >>>>>>>>>>>>>>> Results
    >>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>> A total of 4162 patients with a first stroke were eligible
    >>>>>>>>>>>>>>> for the analyses. Table 1
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#TBL1094253> shows
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#FIG1094253> shows
    >>>>>>>>>>>>>>> the Kaplan-Meier estimates of the survival probability for each stroke
    >>>>>>>>>>>>>>> subtype and ill-defined stroke. The short-term survival probability was
    >>>>>>>>>>>>>>> clearly best for cerebral infarct and poorest for primary intracerebral
    >>>>>>>>>>>>>>> hemorrhage. The patients with ill-defined stroke had survival probabilities
    >>>>>>>>>>>>>>> similar to those with known cerebral infarct, despite their markedly
    >>>>>>>>>>>>>>> greater age.
    >>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>> - Download figure
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/cms/asset/8ad30bd4-68a7-4fe4-8241-3fbcab975b11/g30ff1.jpeg>
    >>>>>>>>>>>>>>> - Download PowerPoint
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/action/downloadFigures?id=FIG1094253&doi=10.1161%2Fhs0901.094253>
    >>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>> Figure 1. Short-term survival probability (Kaplan-Meier
    >>>>>>>>>>>>>>> estimates) after a first stroke by subtype. SAH indicates subarachnoid
    >>>>>>>>>>>>>>> hemorrhage; PICH, primary intracerebral hemorrhage; CI, cerebral infarct;
    >>>>>>>>>>>>>>> and IDS, ill-defined stroke.
    >>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>> Long-Term Survival
    >>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>> A total of 2990 patients (72%) survived their first stroke
    >>>>>>>>>>>>>>> by >27 days, and 2448 (59%) were still alive 1 year after
    >>>>>>>>>>>>>>> the stroke; thus, 41% died after 1 year. The risk for death
    >>>>>>>>>>>>>>> between 4 weeks and 12 months after the first stroke was 18.1% (95% CI,
    >>>>>>>>>>>>>>> 16.7% to 19.5%). After the first year, the annual risk for death was
    >>>>>>>>>>>>>>> approximately 10% and remained almost constant.
    >>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>> The estimated cumulative risk for death was 60%, 76%, and
    >>>>>>>>>>>>>>> 86% at 5, 10, and 15 years after index stroke, respectively.
    >>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>> Figure 2
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#FIG2094253> shows
    >>>>>>>>>>>>>>> the long-term survival probability for a person aged 65 at the time of a
    >>>>>>>>>>>>>>> first nonfatal stroke. The prognosis was better for subarachnoid hemorrhage
    >>>>>>>>>>>>>>> than for the other 3 categories (*P*<0.001, adjusted for
    >>>>>>>>>>>>>>> the effect of sex and age). There were no differences in long-term survival
    >>>>>>>>>>>>>>> for the other 3 categories (*P*=0.16).
    >>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>> - Download figure
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/cms/asset/d66c94d7-0f1f-41bc-b56e-f67bb910f3ff/g30ff2.jpeg>
    >>>>>>>>>>>>>>> - Download PowerPoint
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/action/downloadFigures?id=FIG2094253&doi=10.1161%2Fhs0901.094253>
    >>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>> Figure 2. Long-term survival probability for patients aged
    >>>>>>>>>>>>>>> 65 years at first nonfatal stroke by subtype (Cox regression).
    >>>>>>>>>>>>>>> Abbreviations are as defined in Figure 1
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#FIG1094253>
    >>>>>>>>>>>>>>> .
    >>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>> Table 2
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#TBL2094253> shows
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#FIG3094253> shows,
    >>>>>>>>>>>>>>> as an example, the survival probability for a person aged 65 years with
    >>>>>>>>>>>>>>> onset of cerebral infarct or ill-defined stroke during 1982–1986 compared
    >>>>>>>>>>>>>>> with 1987–1991. The difference is statistically significant (
    >>>>>>>>>>>>>>> *P*<0.01). The survival curves show that the risks for
    >>>>>>>>>>>>>>> acute and early death did not differ, but the probability of long-term
    >>>>>>>>>>>>>>> survival increased after the first year beyond the index stroke.
    >>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>> - Download figure
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/cms/asset/97a8bb28-a5a9-45c8-96f1-050c4659dcdf/g30ff3.jpeg>
    >>>>>>>>>>>>>>> - Download PowerPoint
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/action/downloadFigures?id=FIG3094253&doi=10.1161%2Fhs0901.094253>
    >>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>> Figure 3. Long-term survival probability for patients aged
    >>>>>>>>>>>>>>> 65 years at first cerebral infarct or ill-defined stroke by period of
    >>>>>>>>>>>>>>> attack (Cox regression).
    >>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>> Causes of Death
    >>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>> Two thirds of the patients with nonfatal stroke subsequently
    >>>>>>>>>>>>>>> died from vascular diseases (Table 3
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#TBL3094253>).
    >>>>>>>>>>>>>>> The mortality rate due to all cardiovascular diseases was almost 4 times
    >>>>>>>>>>>>>>> higher than that in the background population (Table 4
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#TBL4094253>).
    >>>>>>>>>>>>>>> More patients died from cerebrovascular disease than from heart disease,
    >>>>>>>>>>>>>>> particularly women. The risk for cerebrovascular death was 8 to 9 times
    >>>>>>>>>>>>>>> that of the general population, but the excess mortality was not confined
    >>>>>>>>>>>>>>> to vascular diseases since the rates for cancer, other diseases, accidents,
    >>>>>>>>>>>>>>> and suicide were also significantly higher than expected. Ischemic heart
    >>>>>>>>>>>>>>> disease and other vascular diseases were more than twice as often the cause
    >>>>>>>>>>>>>>> of death than expected, but vascular diseases other than stroke contributed
    >>>>>>>>>>>>>>> only slightly more than other diseases to the overall excess mortality. The
    >>>>>>>>>>>>>>> frequency of other diseases, accidents, and suicide as the cause of death
    >>>>>>>>>>>>>>> was approximately double that for the general population, and stroke
    >>>>>>>>>>>>>>> survivors also had a statistically significant 26% increase in the risk for
    >>>>>>>>>>>>>>> dying from cancer.
    >>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>> Causes of Death of Patients With Nonfatal Stroke Who Died
    >>>>>>>>>>>>>>> Before January 1, 1996
    >>>>>>>>>>>>>>> Cause of Death*MenWomenAllNo.%No.%No.%
    >>>>>>>>>>>>>>> *International Classification of Diseases* (*ICD*) codes:
    >>>>>>>>>>>>>>> 8th edition for deaths before January 1, 1994; 10th edition for deaths
    >>>>>>>>>>>>>>> after January 1, 1994.
    >>>>>>>>>>>>>>> *Unknown in 11 cases.
    >>>>>>>>>>>>>>> Cardiovascular diseases *ICD-8*: 390–458; *ICD-10*: I00–I99
    >>>>>>>>>>>>>>> 626
    >>>>>>>>>>>>>>> 63.4
    >>>>>>>>>>>>>>> 608
    >>>>>>>>>>>>>>> 72.3
    >>>>>>>>>>>>>>> 1234
    >>>>>>>>>>>>>>> 67.5
    >>>>>>>>>>>>>>>     Ischemic heart disease *ICD-8*: 410–414; *ICD-10*:
    >>>>>>>>>>>>>>> I20–I25
    >>>>>>>>>>>>>>> 242
    >>>>>>>>>>>>>>> 24.5
    >>>>>>>>>>>>>>> 173
    >>>>>>>>>>>>>>> 20.6
    >>>>>>>>>>>>>>> 415
    >>>>>>>>>>>>>>> 22.7
    >>>>>>>>>>>>>>>     Cerebrovascular disease *ICD-8*: 430–438; *ICD-10*:
    >>>>>>>>>>>>>>> I60–I69
    >>>>>>>>>>>>>>> 268
    >>>>>>>>>>>>>>> 27.2
    >>>>>>>>>>>>>>> 318
    >>>>>>>>>>>>>>> 37.8
    >>>>>>>>>>>>>>> 586
    >>>>>>>>>>>>>>> 32.1
    >>>>>>>>>>>>>>> Cancer *ICD-8*: 140–209; *ICD-10*: C00–D09
    >>>>>>>>>>>>>>> 133
    >>>>>>>>>>>>>>> 13.5
    >>>>>>>>>>>>>>> 83
    >>>>>>>>>>>>>>> 9.9
    >>>>>>>>>>>>>>> 216
    >>>>>>>>>>>>>>> 11.8
    >>>>>>>>>>>>>>> Other diseases *ICD-8*: 0–136, 210–389, 460–796; *ICD-10*:
    >>>>>>>>>>>>>>> A00–B99, D10–H95, J00–R99
    >>>>>>>>>>>>>>> 205
    >>>>>>>>>>>>>>> 20.8
    >>>>>>>>>>>>>>> 130
    >>>>>>>>>>>>>>> 15.4
    >>>>>>>>>>>>>>> 335
    >>>>>>>>>>>>>>> 18.3
    >>>>>>>>>>>>>>> Accidents and suicide *ICD-8*: E800–E999; ICD-10: V00–Y99
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R5-094253> 675
    >>>>>>>>>>>>>>> patients with a first stroke were followed up for up to 6.5 years, and the
    >>>>>>>>>>>>>>> relative risk of death was found to vary between 1.1 and 2.9 at 2 to 6
    >>>>>>>>>>>>>>> years after the stroke. In the Perth Community Stroke Study,
    >>>>>>>>>>>>>>> 4
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R4-094253> in
    >>>>>>>>>>>>>>> which 362 patients with a first stroke were followed up for 5 years, the
    >>>>>>>>>>>>>>> relative risk for death beyond 1 year after the stroke was between 2.0 and
    >>>>>>>>>>>>>>> 2.3. Loor et al6
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R6-094253> followed
    >>>>>>>>>>>>>>> up 221 patients up to 3 years and reported the relative risk for death to
    >>>>>>>>>>>>>>> be 2.0 in the interval 2 to 3 years after the stroke. We found a SMR ≥2.0
    >>>>>>>>>>>>>>> for as long as 10 to 15 years after the initial stroke. Hence, we conclude
    >>>>>>>>>>>>>>> that persons who survive a stroke have a continuing excess risk of death,
    >>>>>>>>>>>>>>> which remains at least double that of the background population.
    >>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>> Case fatality rates vary considerably among populations,1
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R1-094253> and
    >>>>>>>>>>>>>>> it has been found frequently that the age-standardized case fatality rates
    >>>>>>>>>>>>>>> are higher for women than for men. We found that, after 4 weeks, women
    >>>>>>>>>>>>>>> continued to have a higher risk for death than men for as long as 1 year
    >>>>>>>>>>>>>>> after the stroke. The female stroke victims were older than the men, but
    >>>>>>>>>>>>>>> the effect of age was controlled for in the analyses, and our data do not
    >>>>>>>>>>>>>>> offer any explanation for the difference. A similar difference was found in
    >>>>>>>>>>>>>>> a study in the Netherlands6
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R6-094253>;
    >>>>>>>>>>>>>>> in other community-based studies, risk estimates were not reported by sex.
    >>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>> The most frequent cause of death in patients with nonfatal
    >>>>>>>>>>>>>>> strokes was cardiovascular disease (either cerebrovascular disease or heart
    >>>>>>>>>>>>>>> disease). The distribution of causes of death is similar to that found
    >>>>>>>>>>>>>>> among 30-day survivors in other studies: cerebrovascular diseases accounted
    >>>>>>>>>>>>>>> for 43% and other vascular causes for 26% of deaths in the Netherlands,
    >>>>>>>>>>>>>>> 6
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R6-094253> and
    >>>>>>>>>>>>>>> the corresponding figures were 36% and 34% in Oxfordshire5
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R5-094253> and
    >>>>>>>>>>>>>>> 27% and 31% in Perth, Australia.4
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R4-094253> We
    >>>>>>>>>>>>>>> found that 32.1% of deaths after nonfatal stroke were due to
    >>>>>>>>>>>>>>> cerebrovascular disease and 22.7% to ischemic heart disease. In comparison
    >>>>>>>>>>>>>>> with the background population, the risk for death from cardiovascular
    >>>>>>>>>>>>>>> diseases other than stroke was more than double that expected (Table
    >>>>>>>>>>>>>>> 4
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#TBL4094253>),
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R6-094253> it
    >>>>>>>>>>>>>>> was found that 5 of 62 deceased patients (8%) died of complications after a
    >>>>>>>>>>>>>>> fracture of the femur. It can only be speculated that poststroke depression
    >>>>>>>>>>>>>>> might lead to suicide.
    >>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>> In view of the definition in the protocol of the WHO MONICA
    >>>>>>>>>>>>>>> Project of a stroke event, we analyzed survival probability after a fatal
    >>>>>>>>>>>>>>> stroke by stroke subtype and not by direct or indirect causes of death. In
    >>>>>>>>>>>>>>> studies in which the direct cause of death within 30 days after a first
    >>>>>>>>>>>>>>> stroke was examined,4–6
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R4-094253>
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R5-094253>
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R6-094253> death
    >>>>>>>>>>>>>>> was due to cerebrovascular disease in 91% of patients in the Oxfordshire
    >>>>>>>>>>>>>>> Community Stroke Project and in 85% in the Perth Community Stroke Study.
    >>>>>>>>>>>>>>> Loor et al6
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R6-094253> found
    >>>>>>>>>>>>>>> that only 1 of 58 patients did not die of the index stroke. A study in
    >>>>>>>>>>>>>>> Rochester, Minn, 10
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R10-094253> included
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R17-094253> In
    >>>>>>>>>>>>>>> previous analyses of all strokes,15
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R15-094253> we
    >>>>>>>>>>>>>>> found no positive time trend in short-term survival: the age-adjusted
    >>>>>>>>>>>>>>> 28-day case fatality rates did not change significantly during 1982–1991,
    >>>>>>>>>>>>>>> and the improvement was restricted to those who survived longer. Our data
    >>>>>>>>>>>>>>> do not offer any specific explanation because we had no information on
    >>>>>>>>>>>>>>> stroke severity or comorbidity. We know, however, that the incidence rates
    >>>>>>>>>>>>>>> of stroke declined.15
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R15-094253> We
    >>>>>>>>>>>>>>> consider this to be in part the result of improved primary prevention, in
    >>>>>>>>>>>>>>> particular control of hypertension. Awareness of means for preventing
    >>>>>>>>>>>>>>> cardiovascular diseases in general increased during the 1980s, and it was
    >>>>>>>>>>>>>>> at the end of this decade that warfarin was shown to be effective in
    >>>>>>>>>>>>>>> preventing stroke in patients with arterial fibrillation; this was also the
    >>>>>>>>>>>>>>> time when the concept of dedicated stroke units was introduced. No such
    >>>>>>>>>>>>>>> unit was available to the patients included in the present study, but we
    >>>>>>>>>>>>>>> strongly believe that the focus on appropriate stroke management has had a
    >>>>>>>>>>>>>>> positive influence on patient care.
    >>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>> We have pointed to stroke-related disability as a possible
    >>>>>>>>>>>>>>> explanation for the excess mortality from other diseases, cancer,
    >>>>>>>>>>>>>>> accidents, and suicide. If this assumption is true, it emphasizes the need
    >>>>>>>>>>>>>>> for improved rehabilitation to minimize poststroke disability. The most
    >>>>>>>>>>>>>>> important risk of stroke survivors is recurrent cerebrovascular disease,
    >>>>>>>>>>>>>>> which was >8 times higher than that of the background population and much
    >>>>>>>>>>>>>>> more pronounced than the excess risk for death from other causes, including
    >>>>>>>>>>>>>>> ischemic heart disease. In our opinion, this is a strong argument in favor
    >>>>>>>>>>>>>>> of continuing and increasing efforts in the field of secondary stroke
    >>>>>>>>>>>>>>> prevention.
    >>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>> The incidence of stroke declined,15
    >>>>>>>>>>>>>>> <https://www.ahajournals.org/doi/full/10.1161/hs0901.094253#R15-094253> and
    >>>>>>>>>>>>>>> the present results suggest that long-term survival improved in Denmark
    >>>>>>>>>>>>>>> during a time when it became clear that stroke is a public health issue.
    >>>>>>>>>>>>>>> This improvement may be the result of better prevention, better management
    >>>>>>>>>>>>>>> or, more likely, a combination of the two.
    >>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>> The DAN-MONICA Stroke Project was supported in part by
    >>>>>>>>>>>>>>> grants from the Danish Heart Foundation. The authors wish to acknowledge
    >>>>>>>>>>>>>>> the work of all members of the Danish MONICA team and the support received
    >>>>>>>>>>>>>>> from collaborating institutions and organizations.
    >>>>>>>>>>>>>>> Footnotes
    >>>>>>>>>>>>>>> Correspondence to Henrik Brønnum-Hansen, National Institute
    >>>>>>>>>>>>>>> of Public Health, 25 Svanemøllevej, DK 2100 Copenhagen Ø, Denmark. E-mail
    >>>>>>>>>>>>>>> h...@dike.dk
    >>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>> References
    >>>>>>>>>>>>>>> On Sunday, May 2, 2021 at 11:02:57 PM UTC-7 Uhohinc wrote:
    >>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>>> Oxid Med Cell Longev
    >>>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>>> -
    >>>>>>>>>>>>>>>> -
    >>>>>>>>>>>>>>>> <https://www.ncbi.nlm.nih.gov/nlmcatalog?term=%22Oxid+Med+Cell+Longev%22%5BTitle+Abbreviation%5D>
    >>>>>>>>>>>>>>>> - <https://pubmed.ncbi.nlm.nih.gov/33274009/#>
    >>>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>>> . 2020 Nov 12;2020:8864100.
    >>>>>>>>>>>>>>>> doi: 10.1155/2020/8864100. eCollection 2020.
    >>>>>>>>>>>>>>>> Activation of the Melanocortin-1 Receptor by NDP-MSH
    >>>>>>>>>>>>>>>> Attenuates Oxidative Stress and Neuronal Apoptosis through PI3K/Akt/Nrf2
    >>>>>>>>>>>>>>>> Pathway after Intracerebral Hemorrhage in Mice
    >>>>>>>>>>>>>>>> Siming Fu
    >>>>>>>>>>>>>>>> <https://pubmed.ncbi.nlm.nih.gov/?term=Fu+S&cauthor_id=33274009>
    >>>>>>>>>>>>>>>> 1
    >>>>>>>>>>>>>>>> <https://pubmed.ncbi.nlm.nih.gov/33274009/#affiliation-1>, Xu
    >>>>>>>>>>>>>>>> Luo
    >>>>>>>>>>>>>>>> <https://pubmed.ncbi.nlm.nih.gov/?term=Luo+X&cauthor_id=33274009>
    >>>>>>>>>>>>>>>> 1
    >>>>>>>>>>>>>>>> <https://pubmed.ncbi.nlm.nih.gov/33274009/#affiliation-1>, Xuan
    >>>>>>>>>>>>>>>> Wu
    >>>>>>>>>>>>>>>> <https://pubmed.ncbi.nlm.nih.gov/?term=Wu+X&cauthor_id=33274009>
    >>>>>>>>>>>>>>>> 1
    >>>>>>>>>>>>>>>> <https://pubmed.ncbi.nlm.nih.gov/33274009/#affiliation-1>, Tongyu
    >>>>>>>>>>>>>>>> Zhang
    >>>>>>>>>>>>>>>> <https://pubmed.ncbi.nlm.nih.gov/?term=Zhang+T&cauthor_id=33274009>
    >>>>>>>>>>>>>>>> 2
    >>>>>>>>>>>>>>>> <https://pubmed.ncbi.nlm.nih.gov/33274009/#affiliation-2>, Linggui
    >>>>>>>>>>>>>>>> Gu
    >>>>>>>>>>>>>>>> <https://pubmed.ncbi.nlm.nih.gov/?term=Gu+L&cauthor_id=33274009>
    >>>>>>>>>>>>>>>> 1
    >>>>>>>>>>>>>>>> <https://pubmed.ncbi.nlm.nih.gov/33274009/#affiliation-1>, Yiying
    >>>>>>>>>>>>>>>> Wang
    >>>>>>>>>>>>>>>> <https://pubmed.ncbi.nlm.nih.gov/?term=Wang+Y&cauthor_id=33274009>
    >>>>>>>>>>>>>>>> 3
    >>>>>>>>>>>>>>>> <https://pubmed.ncbi.nlm.nih.gov/33274009/#affiliation-3>, Meng
    >>>>>>>>>>>>>>>> Gao
    >>>>>>>>>>>>>>>> <https://pubmed.ncbi.nlm.nih.gov/?term=Gao+M&cauthor_id=33274009>
    >>>>>>>>>>>>>>>> 3
    >>>>>>>>>>>>>>>> <https://pubmed.ncbi.nlm.nih.gov/33274009/#affiliation-3>, Yuan
    >>>>>>>>>>>>>>>> Cheng
    >>>>>>>>>>>>>>>> <https://pubmed.ncbi.nlm.nih.gov/?term=Cheng+Y&cauthor_id=33274009>
    >>>>>>>>>>>>>>>> 1
    >>>>>>>>>>>>>>>> <https://pubmed.ncbi.nlm.nih.gov/33274009/#affiliation-1>, Zongyi
    >>>>>>>>>>>>>>>> Xie
    >>>>>>>>>>>>>>>> <https://pubmed.ncbi.nlm.nih.gov/?term=Xie+Z&cauthor_id=33274009>
    >>>>>>>>>>>>>>>> 1
    >>>>>>>>>>>>>>>> <https://pubmed.ncbi.nlm.nih.gov/33274009/#affiliation-1>
    >>>>>>>>>>>>>>>> Affiliations expand
    >>>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>>> - PMID: 33274009
    >>>>>>>>>>>>>>>> - PMCID: PMC7676969
    >>>>>>>>>>>>>>>> <http://www.ncbi.nlm.nih.gov/pmc/articles/pmc7676969/>
    >>>>>>>>>>>>>>>> - DOI: 10.1155/2020/8864100
    >>>>>>>>>>>>>>>> <https://doi.org/10.1155/2020/8864100>
    >>>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>>> Free PMC article
    >>>>>>>>>>>>>>>> Abstract
    >>>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>>> Oxidative stress and neuronal apoptosis play crucial roles
    >>>>>>>>>>>>>>>> in secondary brain injury (SBI) after intracerebral hemorrhage (ICH).
    >>>>>>>>>>>>>>>> Recently, Nle4-D-Phe7-*α*-melanocyte-stimulating hormone
    >>>>>>>>>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/instance/7676969/bin/OMCL2020-8864100.001.jpg>
    >>>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>>> *Figure 1 *
    >>>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>>> Experimental design and animal groups.…
    >>>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/instance/7676969/bin/OMCL2020-8864100.002.jpg>
    >>>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>>> *Figure 2 *
    >>>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>>> Endogenous expression of Mc1r after…
    >>>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/instance/7676969/bin/OMCL2020-8864100.003.jpg>
    >>>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>>> *Figure 3 *
    >>>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>>> The administration of NDP-MSH improved…
    >>>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/instance/7676969/bin/OMCL2020-8864100.004.jpg>
    >>>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>>> *Figure 4 *
    >>>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>>> Oxidative stress-related proteins were detected…
    >>>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/instance/7676969/bin/OMCL2020-8864100.005.jpg>
    >>>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>>> *Figure 5 *
    >>>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>>> Effects of NDP-MSH on neuronal…
    >>>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>>> <https://www.ncbi.nlm.nih.gov/pmc/articles/instance/7676969/bin/OMCL2020-8864100.006.jpg>
    >>>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>>> *Figure 6 *
    >>>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>>> Knockdown of Mc1r expression abolished…
    >>>>>>>>>>>>>>>> All figures (7)
    >>>>>>>>>>>>>>>> Similar articles
    >>>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>>> - NDP-MSH binding melanocortin-1 receptor ameliorates
    >>>>>>>>>>>>>>>> neuroinflammation and BBB disruption through CREB/Nr4a1/NF-κB pathway after
    >>>>>>>>>>>>>>>> intracerebral hemorrhage in mice.
    >>>>>>>>>>>>>>>> <https://pubmed.ncbi.nlm.nih.gov/31660977/>
    >>>>>>>>>>>>>>>> Wu X, Fu S, Liu Y, Luo H, Li F, Wang Y, Gao M, Cheng Y,
    >>>>>>>>>>>>>>>> Xie Z.J Neuroinflammation. 2019 Oct 28;16(1):192. doi:
    >>>>>>>>>>>>>>>> 10.1186/s12974-019-1591-4.PMID: 31660977 Free PMC article.
    >>>>>>>>>>>>>>>> - TREM2 activation attenuates neuroinflammation and
    >>>>>>>>>>>>>>>> neuronal apoptosis via PI3K/Akt pathway after intracerebral hemorrhage in
    >>>>>>>>>>>>>>>> mice. <https://pubmed.ncbi.nlm.nih.gov/32466767/>
    >>>>>>>>>>>>>>>> Chen S, Peng J, Sherchan P, Ma Y, Xiang S, Yan F, Zhao
    >>>>>>>>>>>>>>>> H, Jiang Y, Wang N, Zhang JH, Zhang H.J Neuroinflammation. 2020 May
    >>>>>>>>>>>>>>>> 28;17(1):168. doi: 10.1186/s12974-020-01853-x.PMID: 32466767 Free PMC
    >>>>>>>>>>>>>>>> article.
    >>>>>>>>>>>>>>>> - Recombinant CCL17-dependent CCR4 activation
    >>>>>>>>>>>>>>>> alleviates neuroinflammation and neuronal apoptosis through the
    >>>>>>>>>>>>>>>> PI3K/AKT/Foxo1 signaling pathway after ICH in mice.
    >>>>>>>>>>>>>>>> <https://pubmed.ncbi.nlm.nih.gov/33648537/>
    >>>>>>>>>>>>>>>> Deng S, Jin P, Sherchan P, Liu S, Cui Y, Huang L, Zhang
    >>>>>>>>>>>>>>>> JH, Gong Y, Tang J.J Neuroinflammation. 2021 Mar 1;18(1):62. doi:
    >>>>>>>>>>>>>>>> 10.1186/s12974-021-02112-3.PMID: 33648537 Free PMC article.
    >>>>>>>>>>>>>>>> - Recombinant OX40 attenuates neuronal apoptosis
    >>>>>>>>>>>>>>>> through OX40-OX40L/PI3K/AKT signaling pathway following subarachnoid
    >>>>>>>>>>>>>>>> hemorrhage in rats.
    >>>>>>>>>>>>>>>> <https://pubmed.ncbi.nlm.nih.gov/31930990/>
    >>>>>>>>>>>>>>>> Wu LY, Enkhjargal B, Xie ZY, Travis ZD, Sun CM, Zhou
    >>>>>>>>>>>>>>>> KR, Zhang TY, Zhu QQ, Hang CH, Zhang JH.Exp Neurol. 2020 Apr;326:113179.
    >>>>>>>>>>>>>>>> doi: 10.1016/j.expneurol.2020.113179. Epub 2020 Jan
    >>>>>>>>>>>>>>>> 10.PMID: 31930990 Review.
    >>>>>>>>>>>>>>>> - The α-Melanocyte Stimulating Hormone/Melanocortin-1
    >>>>>>>>>>>>>>>> receptor interaction: a driver of pleiotropic effects beyond pigmentation.
    >>>>>>>>>>>>>>>> <https://pubmed.ncbi.nlm.nih.gov/33884776/>
    >>>>>>>>>>>>>>>> Herraiz C, Martínez-Vicente I, Maresca V.Pigment Cell
    >>>>>>>>>>>>>>>> Melanoma Res. 2021 Apr 21. doi: 10.1111/pcmr.12980. Online ahead of
    >>>>>>>>>>>>>>>> print.PMID: 33884776 Review.
    >>>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>>> See all similar articles
    >>>>>>>>>>>>>>>> References
    >>>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>>> 1.
    >>>>>>>>>>>>>>>> 1. Hemphill J. C., Adeoye O. M., Alexander D. N., et
    >>>>>>>>>>>>>>>> al. Clinical performance measures for adults hospitalized with
    >>>>>>>>>>>>>>>> intracerebral hemorrhage: performance measures for healthcare professionals
    >>>>>>>>>>>>>>>> from the American Heart Association/American Stroke Association. Stroke.
    >>>>>>>>>>>>>>>> 2018;49(7):e243–e261. doi: 10.1161/STR.0000000000000171. -
    >>>>>>>>>>>>>>>> DOI <https://doi.org/10.1161/str.0000000000000171>-
    >>>>>>>>>>>>>>>> PubMed <https://pubmed.ncbi.nlm.nih.gov/29786566/>
    >>>>>>>>>>>>>>>> 2.
    >>>>>>>>>>>>>>>> 1. Hemphill JC 3rd, Greenberg S. M., Anderson C. S.,
    >>>>>>>>>>>>>>>> et al. Guidelines for the management of spontaneous intracerebral
    >>>>>>>>>>>>>>>> hemorrhage: a guideline for healthcare professionals from the American
    >>>>>>>>>>>>>>>> Heart Association/American Stroke Association. Stroke.
    >>>>>>>>>>>>>>>> 2015;46(7):2032–2060. doi: 10.1161/STR.0000000000000069. -
    >>>>>>>>>>>>>>>> DOI <https://doi.org/10.1161/str.0000000000000069>-
    >>>>>>>>>>>>>>>> PubMed <https://pubmed.ncbi.nlm.nih.gov/26022637/>
    >>>>>>>>>>>>>>>> 3.
    >>>>>>>>>>>>>>>> 1. Wang Z., Zhou F., Dou Y., et al. Melatonin
    >>>>>>>>>>>>>>>> alleviates intracerebral hemorrhage-induced secondary brain injury in rats
    >>>>>>>>>>>>>>>> via suppressing apoptosis, inflammation, oxidative stress, DNA damage, and
    >>>>>>>>>>>>>>>> mitochondria injury. Translational Stroke Research. 2018;9(1):74–91. doi:
    >>>>>>>>>>>>>>>> 10.1007/s12975-017-0559-x. - DOI
    >>>>>>>>>>>>>>>> <https://doi.org/10.1007/s12975-017-0559-x>- PMC
    >>>>>>>>>>>>>>>> <http://www.ncbi.nlm.nih.gov/pmc/articles/pmc5750335/>
    >>>>>>>>>>>>>>>> - PubMed <https://pubmed.ncbi.nlm.nih.gov/28766251/>
    >>>>>>>>>>>>>>>> 4.
    >>>>>>>>>>>>>>>> 1. Xie R. X., Li D. W., Liu X. C., et al. Carnosine
    >>>>>>>>>>>>>>>> Attenuates Brain Oxidative Stress and Apoptosis After Intracerebral
    >>>>>>>>>>>>>>>> Hemorrhage in Rats. Neurochemical Research. 2017;42(2):541–551. doi:
    >>>>>>>>>>>>>>>> 10.1007/s11064-016-2104-9. - DOI
    >>>>>>>>>>>>>>>> <https://doi.org/10.1007/s11064-016-2104-9>- PubMed
    >>>>>>>>>>>>>>>> <https://pubmed.ncbi.nlm.nih.gov/27868153/>
    >>>>>>>>>>>>>>>> 5.
    >>>>>>>>>>>>>>>> 1. Duan X., Wen Z., Shen H., Shen M., Chen G.
    >>>>>>>>>>>>>>>> Intracerebral hemorrhage, oxidative stress, and antioxidant therapy.
    >>>>>>>>>>>>>>>> Oxidative Medicine and Cellular Longevity. 2016;2016:17. doi:
    >>>>>>>>>>>>>>>> 10.1155/2016/1203285.1203285 - DOI
    >>>>>>>>>>>>>>>> <https://doi.org/10.1155/2016/1203285>- PMC
    >>>>>>>>>>>>>>>> <http://www.ncbi.nlm.nih.gov/pmc/articles/pmc4848452/>
    >>>>>>>>>>>>>>>> - PubMed <https://pubmed.ncbi.nlm.nih.gov/27190572/>
    >>>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>>> Show all 49 references
    >>>>>>>>>>>>>>>> Related information
    >>>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>>> - MedGen
    >>>>>>>>>>>>>>>> <https://www.ncbi.nlm.nih.gov/medgen/?linkname=pubmed_medgen&from_uid=33274009>
    >>>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>>> LinkOut - more resources
    >>>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>>> - Full Text Sources
    >>>>>>>>>>>>>>>> - Europe PubMed Central
    >>>>>>>>>>>>>>>> <http://europepmc.org/abstract/MED/33274009>
    >>>>>>>>>>>>>>>> - Hindawi Limited
    >>>>>>>>>>>>>>>> <https://doi.org/10.1155/2020/8864100>
    >>>>>>>>>>>>>>>>>>>>>>>>>> In pathology and anatomy the *penumbra* is the
    >>>>>>>>>>>>>>>>>>>>>>>>>> area surrounding an ischemic event such as thrombotic or embolic stroke.
    >>>>>>>>>>>>>>>>>>>>>>>>>> Immediately following the event, blood flow and therefore oxygen transport
    >>>>>>>>>>>>>>>>>>>>>>>>>> is reduced locally, leading to hypoxia of the cells near the location of
    >>>>>>>>>>>>>>>>>>>>>>>>>> the original insult.
    >>>>>>>>>>>>>>>>>>>>>>>>>>
    >>>>>>>>>>>>>>>>>>>>>>>>>> <https://en.m.wikipedia.org/wiki/Penumbra_(medicine)>
    >>>>>>>>>>>>>>>>>>>>>>>>>>>>> limitation in speech. The centre of the brain injury is called the *necrotic
    >>>>>>>>>>>>>>>>>>>>>>>>>>>>> core* (dead brain tissue), and the larger
    >>>>>>>>>>>>>>>>>>>>>>>>>>>>> surrounding brain injury is known as the
    >>>>>>>>>>>>>>>>>>>>>>>>>>>>> *penumbra* (meaning shadow around the core).
    Reply all
    Reply to author
    Forward
    0 new messages