error running ./generate_QuEST_parameters.pl

[Theodore Georgomanolis]

./generate_QuEST_parameters.pl -solexa_align_ChIP '/media/trotos/4TB/WORK/archive/Sample_665_LIB3776_LDI3264/CHiP_0min_.fastq' -solexa_align_RX_noIP '/media/trotos/4TB/WORK/archiveSample_665_LIB3774_LDI3262/Input.fastq' -rp '/media/trotos/4TB/WORK/UCSC/hg18/Sequence/hg18_reference/' -ap '/media/trotos/4TB/WORK/archive/Sample_665_LIB3776_LDI3264/Quest/'


the above is the command line,
i'm using data from illumina

fastq format is as bellow

HWI-ST790:252:H0KH0ADXX:2:1101:1686:1991        16      chr15   99686177        60      50M     *       0       0       TTTGCTGAGCGGATGAGAGGAGGGTGGCTAGGAACAGGGAAAGTNCAGAT      IJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJIJJJHHHHFA2#FFCCC      NM:i:1  AS:i:48 XS:i:0

and then I get the following error

Your genome looks fine and does not appear to contain any
duplicated chromosome entries.

Estimated size of the genome is 50000789.9 Kb ( 50.00 Gbps ).

Converting ChIP reads file into the QuEST format.
If the counter below stays at zero, the program can't
match the ChIP alignments to the reference genome that you provided.
In this case check that the sequences you have provided match the formats
accepted by QuEST (see README.txt) and that names of contigs in the alignment
files are *exactly* the same as in your genome or genome table.

Warning:
couldn't parse the parameter: ChIP-seq
skipping
Warning:
couldn't parse the parameter: [CCC-113]/Sample_665_LIB3776_LDI3264/SMAD2-3_0min_LIB3776.trimmed-Q0L11.trimmed-Q0L11.fastq
skipping
Warning:
couldn't parse the parameter: ChIP-seq
skipping
Warning:
couldn't parse the parameter: [CCC-113]/Sample_665_LIB3776_LDI3264/Quest//data/ChIP_uncollapsed.QuEST
skipping
Warning:
couldn't parse the parameter: ChIP-seq
skipping
Warning:
couldn't parse the parameter: [CCC-113]/Sample_665_LIB3776_LDI3264/Quest//parameters/genome_table
skipping
Warning:
couldn't parse the parameter: ChIP-seq
skipping
Warning:
couldn't parse the parameter: [CCC-113]/Sample_665_LIB3776_LDI3264/Quest//data/ChIP_read_num_uncollapsed.txt
skipping
Warning:
couldn't parse the parameter: ChIP-seq
skipping
Warning:
couldn't parse the parameter: [CCC-113]/Sample_665_LIB3776_LDI3264/Quest//module_outputs/align_2_QuEST_ChIP.report.txt
skipping
Could not understand param:


Error during the execution of /home/trotos/Desktop/QuEST_2.4/align_2_QuEST align_file=/media/trotos/4TB/WORK/archive/SMADs ChIP-seq [CCC-113]/Sample_665_LIB3776_LDI3264/SMAD2-3_0min_LIB3776.trimmed-Q0L11.trimmed-Q0L11.fastq output_file=/media/trotos/4TB/WORK/archive/SMADs ChIP-seq [CCC-113]/Sample_665_LIB3776_LDI3264/Quest//data/ChIP_uncollapsed.QuEST genome_table=/media/trotos/4TB/WORK/archive/SMADs ChIP-seq [CCC-113]/Sample_665_LIB3776_LDI3264/Quest//parameters/genome_table align_type=solexa_align report_file=/media/trotos/4TB/WORK/archive/SMADs ChIP-seq [CCC-113]/Sample_665_LIB3776_LDI3264/Quest//data/ChIP_read_num_uncollapsed.txt error_report_file=/media/trotos/4TB/WORK/archive/SMADs ChIP-seq [CCC-113]/Sample_665_LIB3776_LDI3264/Quest//module_outputs/align_2_QuEST_ChIP.report.txt. Error code: 256.


Could you please give me a clue

[Anton]

Hi Theodore, 

from the line you provided it looks like a sam format. You can should use the following flags with these file formats:

-sam_align_ChIP

-sam_align_RX_noIP

Best, Anton

[Theodore Georgomanolis]

Dear Anton.

I've used those flags and still get the same error. The sam files have been created with the bwa mem aligner

Theodore

[Anton]

Hi Theodore,

can you post your QuEST command, the error message and a few lines from your input sam file?

Thanks, Anton

[Theodore Georgomanolis]

./generate_QuEST_parameters.pl -sam_align_ChIP 'PATH/$.sam' -sam_align_RX_noIP /PATH/input.sam -rp '/media/trotos/4TB/WORK/UCSC/hg18/Sequence/hg18_reference/' -ap '/PATH/Quest/'

typical SAM as created from bwa mem algorythm

@SQ     SN:chr1 LN:247249719
@SQ     SN:chr2 LN:242951149
@SQ     SN:chr3 LN:199501827
@SQ     SN:chr4 LN:191273063
@SQ     SN:chr5 LN:180857866
@SQ     SN:chr6 LN:170899992
@SQ     SN:chr7 LN:158821424
@SQ     SN:chr8 LN:146274826
@SQ     SN:chr9 LN:140273252
@SQ     SN:chr10        LN:135374737
@SQ     SN:chr11        LN:134452384
@SQ     SN:chr12        LN:132349534
@SQ     SN:chr13        LN:114142980
@SQ     SN:chr14        LN:106368585
@SQ     SN:chr15        LN:100338915
@SQ     SN:chr16        LN:88827254
@SQ     SN:chr17        LN:78774742
@SQ     SN:chr18        LN:76117153
@SQ     SN:chr19        LN:63811651
@SQ     SN:chr20        LN:62435964
@SQ     SN:chr21        LN:46944323
@SQ     SN:chr22        LN:49691432
@SQ     SN:chrX LN:154913754
@SQ     SN:chrY LN:57772954
HWI-ST790:267:H0KGMADXX:1:1101:1219:1981        0       chr11   84470026        60      51M     *       0       0       GATTATATTGAACACTTAGGATATATGTTGGGCCTCAAAAACAATACCGCA     BBBFFFFFHHHHHJJJJJJJJJIIJJJJJJJJJJIIJJJJJIJJJIJIJII     NM:i:0  AS:i:51 XS:i:0
HWI-ST790:267:H0KGMADXX:1:1101:1073:1993        0       chr5    171204091       30      51M     *       0       0       CCTGGCTTCAAGCAATCCCTCCCACCTCAGCCTCTCAAAGCACTGGGATTA     B@BFFFFFHHHHHJJJIJJJJJIIJJJJJJJJJJJJJJJIIIJJJJJJJJJ     NM:i:0  AS:i:51 XS:i:38
HWI-ST790:267:H0KGMADXX:1:1101:1263:1978        16      chr11   7331266 60      51M     *       0       0       TTTTCCTAGCACCTAGATGGCAGATTTCCGGTAAGTTCTACTGGTGCAGTA     JJJJIIJIHGBJJJJJJJJJJJJJJJJJJJJIJJJIJJHHHGHFFFFFCCC     NM:i:0  AS:i:51 XS:i:0
HWI-ST790:267:H0KGMADXX:1:1101:1281:1996        0       chr7    35054871        60      51M     *       0       0       GATATTTTAGGGCCAGTGTGCTTTTCCTCATCCTGAGCCTCTCTCAATACT     @BBBDFFFFHHGFBGGFGJJIFHHHAHHHIHACG9EHGHIGFFHEHGFDHH     NM:i:0  AS:i:51 XS:i:0

the error message was the same:

Warning:
couldn't parse the parameter: ChIP-seq
skipping
Warning:

couldn't parse the parameter: [CCC-113]/Sample_665_LIB3776_LDI3264/2-3_0min_LIB3776.fastq

I hope this is enough info.

Theodore

[Anton]

Hi Theodore,

you don't need to put quotation marks in your QuEST command.

It seems that you are still providing QuEST with fastq rather than with sam file. I can see this because of the following error: "[CCC-113]/Sample_665_LIB3776_LDI3264/2-3_0min_LIB3776.fastq"

I would suggest to remove any QuEST analysis directories and do this again with the new analysis directory.

Post any other error messages with your run commands here. Please don't substitute anything in your run command when you post it here.

Best, Anton

[Theodore Georgomanolis]

Anton

I'll try it again tomorrow and come back to you.

Best
THeodore

[Theodore Georgomanolis]

there you go.

new with proper sam files... same error

./generate_QuEST_parameters.pl -sam_align_ChIP /media/trotos/4TB/WORK/archive/0min_LIB3778/0min.sam -sam_align_RX_noIP /media/trotos/4TB/WORK/archive/Input.sam -rp /media/trotos/4TB/WORK/UCSC/hg18/Sequence/WholeGenomeFasta/ -ap /media/trotos/4TB/WORK/archive/0min_LIB3778/Quest/
QuEST ChIP-Seq analysis pipeline version 2.422
Last modified on 06-03-2012

For questions, suggestions, bugs please post into the Google QuEST
discussion group: http://groups.google.com/group/chipseq

Please cite the following publication when using QuEST:

Valouev A, Johnson DS, Sundquist A, Medina C, Anton E, Batzoglou S,
Myers RM, Sidow A (2008). Genome-wide analysis of transcription
factor binding sites based on ChIP-Seq data.
Nat Methods 5, 829-834 (2008)

=====================

parameters:

ChIP_name:                     ChIP
ChIP_align_file:               /media/trotos/4TB/WORK/archive/0min.sam
ChIP_file_type:                sam_align

RX_noIP_align_file:            /media/trotos/4TB/WORK/archive/Input.sam
RX_noIP_file_type:             sam_align

reference path:                /media/trotos/4TB/WORK/UCSC/hg18/Sequence/WholeGenomeFasta/
genome_table:                  ** missing **

analysis_path:                 /media/trotos/4TB/WORK/archive/0min_LIB3778/Quest/

silent:                        off
advanced:                      off

=====================

creating necessary directories.

- - - - - - - - - - - - - - - -

analysis directory: /media/trotos/4TB/WORK/archive/0min_LIB3778/Quest/:   created
logs directory: /media/trotos/4TB/WORK/archive/0min_LIB3778/Quest//logs: created
module outputs directory: /media/trotos/4TB/WORK/archive/0min_LIB3778/Quest//module_outputs: created
parameters directory: /media/trotos/4TB/WORK/archive/0min_LIB3778/Quest//parameters: created
calls directory: /media/trotos/4TB/WORK/archive/0min_LIB3778/Quest//calls: created
data directory: /media/trotos/4TB/WORK/archive/0min_LIB3778/Quest//data: created
scores directory: /media/trotos/4TB/WORK/archive/_0min_LIB3778/Quest//scores: created
tracks directory: /media/trotos/4TB/WORK/archive/0min_LIB3778/Quest//tracks: created
bin_align directory: /media/trotos/4TB/WORK/archive/0min_LIB3778/Quest//bin_align: created
bin_align ChIP directory: /media/trotos/4TB/WORK/archive/0min_LIB3778/Quest//bin_align/ChIP: created
bin_align background directory: /media/trotos/4TB/WORK/archive/0min_LIB3778/Quest//bin_align/background: created
bin_align RX_noIP directory: /media/trotos/4TB/WORK/archive/0min_LIB3778/Quest//bin_align/RX_noIP: created
bin_align pseudo_ChIP directory: /media/trotos/4TB/WORK/archive/0min_LIB3778/Quest//bin_align/pseudo_ChIP: created
bed graph tracks directory: /media/trotos/4TB/WORK/archive/0min_LIB3778/Quest//tracks/bed_graph: created
bed graph tracks by chromosome directory: /media/trotos/4TB/WORK/archive/0min_LIB3778/Quest//tracks/bed_graph/by_chr: created
bed graph tracks by chromosome ChIP directory: /media/trotos/4TB/WORK/archive/0min_LIB3778/Quest//tracks/bed_graph/by_chr/ChIP: created
data bed tracks directory: /media/trotos/4TB/WORK/archive/0min_LIB3778/Quest//tracks/data_bed_files: created
data bed tracks by chromosome directory: /media/trotos/4TB/WORK/archive/0min_LIB3778/Quest//tracks/data_bed_files/by_chr: created
ChIP bed tracks by chromosome directory: /media/trotos/4TB/WORK/archive/0min_LIB3778/Quest//tracks/data_bed_files/by_chr/ChIP: created
RX_noIP bed tracks by chromosome directory: /media/trotos/4TB/WORK/archive/0min_LIB3778/Quest//tracks/data_bed_files/by_chr/RX_noIP: created
wig tracks directory: /media/trotos/4TB/WORK/archive/0min_LIB3778/Quest//tracks/wig_profiles: created
wig tracks by chromosome directory: /media/trotos/4TB/WORK/archive/0min_LIB3778/Quest//tracks/wig_profiles/by_chr: created
wig tracks by chromosome directory for normalized ChIP profiles: /media/trotos/4TB/WORK/archive/0min_LIB3778/Quest//tracks/wig_profiles/by_chr/ChIP_normalized: created
wig tracks by chromosome directory for unnormalized ChIP profiles: /media/trotos/4TB/WORK/archive/0min_LIB3778/Quest//tracks/wig_profiles/by_chr/ChIP_unnormalized: created
wig tracks by chromosome directory for normalized backround profiles: /media/trotos/4TB/WORK/archive/0min_LIB3778/Quest//tracks/wig_profiles/by_chr/background_normalized: created
wig tracks by chromosome directory for unnormalized background profiles: /media/trotos/4TB/WORK/archive/0min_LIB3778/Quest//tracks/wig_profiles/by_chr/background_unnormalized: created
ChIP scores directory: /media/trotos/4TB/WORK/archive/0min_LIB3778/Quest//scores/ChIP: created
background scores directory: /media/trotos/4TB/WORK/archive/0min_LIB3778/Quest//scores/background: created
pseudo_ChIP scores directory: /media/trotos/4TB/WORK/archive/0min_LIB3778/Quest//scores/pseudo_ChIP: created

- - - - - - - - - - - - - - - -


The following fasta files were found in your reference path:

hg18_genome.fa

Evaluating the size of the genome. This may take several minutes.

Found the following contigs:

chr1: 247249719 bps
chr2: 490200868 bps
chr3: 689702695 bps
chr4: 880975758 bps
chr5: 1061833624 bps
chr6: 1232733616 bps
chr7: 1391555040 bps
chr8: 1537829866 bps
chr9: 1678103118 bps
chr10: 1813477855 bps
chr11: 1947930239 bps
chr12: 2080279773 bps
chr13: 2194422753 bps
chr14: 2300791338 bps
chr15: 2401130253 bps
chr16: 2489957507 bps
chr17: 2568732249 bps
chr18: 2644849402 bps
chr19: 2708661053 bps
chr20: 2771097017 bps
chr21: 2818041340 bps
chr22: 2867732772 bps
chrX: 3022646526 bps
chrY: 3080419480 bps

Your genome looks fine and does not appear to contain any
duplicated chromosome entries.

Estimated size of the genome is 46920353.9 Kb ( 46.92 Gbps ).

Converting ChIP reads file into the QuEST format.
If the counter below stays at zero, the program can't
match the ChIP alignments to the reference genome that you provided.
In this case check that the sequences you have provided match the formats
accepted by QuEST (see README.txt) and that names of contigs in the alignment
files are *exactly* the same as in your genome or genome table.

Warning:
couldn't parse the parameter: ChIP-seq
skipping
Warning:

couldn't parse the parameter: [CCC-113]/0min.sam

skipping
Warning:
couldn't parse the parameter: ChIP-seq
skipping
Warning:

couldn't parse the parameter: [CCC-113]/0min_LIB3778/Quest//data/ChIP_uncollapsed.QuEST

skipping
Warning:
couldn't parse the parameter: ChIP-seq
skipping
Warning:

couldn't parse the parameter: [CCC-113]/0min_LIB3778/Quest//parameters/genome_table

skipping
Warning:
couldn't parse the parameter: ChIP-seq
skipping
Warning:

couldn't parse the parameter: [CCC-113]/0min_LIB3778/Quest//data/ChIP_read_num_uncollapsed.txt

skipping
Warning:
couldn't parse the parameter: ChIP-seq
skipping
Warning:

couldn't parse the parameter: [CCC-113]/0min_LIB3778/Quest//module_outputs/align_2_QuEST_ChIP.report.txt

skipping
Could not understand param:

Error during the execution of /media/trotos/4TB/Quest/QuEST_2.4/align_2_QuEST align_file=/media/trotos/4TB/WORK/archive/0min.sam output_file=/media/trotos/4TB/WORK/archive/0min_LIB3778/Quest//data/ChIP_uncollapsed.QuEST genome_table=/media/trotos/4TB/WORK/archive/0min_LIB3778/Quest//parameters/genome_table align_type=sam report_file=/media/trotos/4TB/WORK/archive/0min_LIB3778/Quest//data/ChIP_read_num_uncollapsed.txt error_report_file=/media/trotos/4TB/WORK/archive/0min_LIB3778/Quest//module_outputs/align_2_QuEST_ChIP.report.txt. Error code: 256.

Thanks, Anton

couldn't parse the parameter: [CCC-113]/Sample_665_LIB3776_LDI3264/0min_LIB3776.trimmed-Q0L11.trimmed-Q0L11.fastq

[Anton]

Hi Theodore,

thank you for your patience. 

It seems I found a small bug in genome table generation, but I am not sure if it is related to your issue. 

Please download the new QuEST: download source and re-run to see if there are remaining issues.

What OS are you using?

It seems your issue may be related to parsing a path to your data. Can you try copying your ChIP and Input sam files in the same directory, changing to that director and running QuEST from there?

I tried running QuEST with your SAM file. Tabs are replaced by spaces when I copy-paste, so I had to replace them again with tabs. After that QuEST parsed your sam files correctly.

Keep us posted.

Thanks, Anton