reading of eland result files in quest

[pfa...@gmail.com]

Hi,

I am having some problem reading eland result files (hg18 genome alignment) into QuEST.
the following lines are:

FC30DTE_20080920:6:1:827:1827    GAGTGAACTCACAGAGTCTATTCCTAAC    U0    1    0    0    chr20.fa    33381235    R    ..   
FC30DTE_20080920:6:1:826:468    GGGACATTTCGTCTGCAGGAGATAGAGA    U0    1    0    0    chr20.fa    55692442    R    ..   
FC30DTE_20080920:6:1:1141:1944    GGAAACCCACCGATTATCTGCAGGAGCC    U0    1    0    0    chr20.fa    19672379    F    ..   
FC30DTE_20080920:6:1:512:1814    GTGATTCTGCATTCTACTCAAGAACTAA    U0    1    0    0    chr20.fa    5745302    F    ..   
FC30DTE_20080920:6:1:1587:1999    GTAATCTTTACTGAGTCATGAACTTTCC    U0    1    0    0    chr20.fa    50330018    R    ..   
FC30DTE_20080920:6:1:693:1768    GGAAAATCTACGGAAACAAAAAGTAAAT    U0    1    0    0    chr20.fa    55530335    F    ..   
FC30DTE_20080920:6:1:1281:1715    GAGATGACCCAGATGTTGGAATTAGTGT    U1    0    1    2    chr20.fa    28249932    R    ..    1G   
FC30DTE_20080920:6:1:993:315    GAGGAGAGTTAAGGAGCATAAAGATTTT    U0    1    0    0    chr20.fa    8432686    F    ..   

I have used them earlier for use with MACS 1.4 and I wanted to try QuEST as well and later for motif analysis (shall i use sed command to remove the fa and then run it ?)

Is there any way to convert them to default quest format and run them.
I will appreciate any help. ,as I also have some eland export formats as well for running the quest pipeline.

sincerely
suman

[Anton]

Hi Suman, 

eland files are no longer supported. The easiest is to convert to QuEST format using awk, or remap to obtain sam file, which is supported. QuEST format is described in the README file.

Best, Anton

[pfa...@gmail.com]

thanks for the reply i will waste no more time.
earlier i used samtools-0.1.7a/misc/export2sam.pl to convert eland export files to sam which is easier for me to use in quest .
I hope it works without any loss in resolution.

suman