Loading Data

[jeffrey....@gmail.com]

I am trying to load data using the Docker cBioPortal.  Within my network, I can see the website at: "http://cbioportal.cinj.rutgers.edu:8080", but the loading command keeps failing:

[rosenfj1@cbioportal ~]$ sudo docker run -it --rm --net cbio-net     -v /encdata/Docker-data/admin/portal.properties:/cbioportal/portal.properties:ro     -v "/encdata/home/rosenfj1/cBio:/study:ro"     -v "/encdata/home/rosenfj1/reports:/report"     cbioportal/cbioportal:latest     metaImport.py -u "http://cbioportal.cinj.rutgers.edu:8080" -s /study --html=/report/report.html 

Starting validation...

!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Error occurred during validation step:

INFO: -: Unable to read xml containing cBioPortal version.

Traceback (most recent call last):

  File "/usr/local/lib/python3.5/dist-packages/urllib3/connection.py", line 159, in _new_conn

    (self._dns_host, self.port), self.timeout, **extra_kw)

  File "/usr/local/lib/python3.5/dist-packages/urllib3/util/connection.py", line 80, in create_connection

    raise err

  File "/usr/local/lib/python3.5/dist-packages/urllib3/util/connection.py", line 70, in create_connection

    sock.connect(sa)

OSError: [Errno 113] No route to host

During handling of the above exception, another exception occurred:

Traceback (most recent call last):

  File "/usr/local/lib/python3.5/dist-packages/urllib3/connectionpool.py", line 600, in urlopen

    chunked=chunked)

  File "/usr/local/lib/python3.5/dist-packages/urllib3/connectionpool.py", line 354, in _make_request

    conn.request(method, url, **httplib_request_kw)

  File "/usr/lib/python3.5/http/client.py", line 1107, in request

    self._send_request(method, url, body, headers)

  File "/usr/lib/python3.5/http/client.py", line 1152, in _send_request

    self.endheaders(body)

  File "/usr/lib/python3.5/http/client.py", line 1103, in endheaders

    self._send_output(message_body)

  File "/usr/lib/python3.5/http/client.py", line 934, in _send_output

    self.send(msg)

  File "/usr/lib/python3.5/http/client.py", line 877, in send

    self.connect()

  File "/usr/local/lib/python3.5/dist-packages/urllib3/connection.py", line 181, in connect

    conn = self._new_conn()

  File "/usr/local/lib/python3.5/dist-packages/urllib3/connection.py", line 168, in _new_conn

    self, "Failed to establish a new connection: %s" % e)

urllib3.exceptions.NewConnectionError: <urllib3.connection.HTTPConnection object at 0x7fb35737a080>: Failed to establish a new connection: [Errno 113] No route to host

During handling of the above exception, another exception occurred:

Traceback (most recent call last):

  File "/usr/local/lib/python3.5/dist-packages/requests/adapters.py", line 449, in send

    timeout=timeout

  File "/usr/local/lib/python3.5/dist-packages/urllib3/connectionpool.py", line 638, in urlopen

    _stacktrace=sys.exc_info()[2])

  File "/usr/local/lib/python3.5/dist-packages/urllib3/util/retry.py", line 399, in increment

    raise MaxRetryError(_pool, url, error or ResponseError(cause))

urllib3.exceptions.MaxRetryError: HTTPConnectionPool(host='cbioportal.cinj.rutgers.edu', port=8080): Max retries exceeded with url: /api-legacy/cancertypes (Caused by NewConnectionError('<urllib3.connection.HTTPConnection object at 0x7fb35737a080>: Failed to establish a new connection: [Errno 113] No route to host',))

During handling of the above exception, another exception occurred:

Traceback (most recent call last):

  File "/usr/local/bin/metaImport.py", line 127, in <module>

    exitcode = validateData.main_validate(args)

  File "/cbioportal/core/src/main/scripts/importer/validateData.py", line 4953, in main_validate

    portal_instance = load_portal_info(server_url, logger)

  File "/cbioportal/core/src/main/scripts/importer/validateData.py", line 4607, in load_portal_info

    parsed_json = request_from_portal_api(path, api_name, logger)

  File "/cbioportal/core/src/main/scripts/importer/validateData.py", line 4477, in request_from_portal_api

    response = requests.get(service_url)

  File "/usr/local/lib/python3.5/dist-packages/requests/api.py", line 75, in get

    return request('get', url, params=params, **kwargs)

  File "/usr/local/lib/python3.5/dist-packages/requests/api.py", line 60, in request

    return session.request(method=method, url=url, **kwargs)

  File "/usr/local/lib/python3.5/dist-packages/requests/sessions.py", line 524, in request

    resp = self.send(prep, **send_kwargs)

  File "/usr/local/lib/python3.5/dist-packages/requests/sessions.py", line 637, in send

    r = adapter.send(request, **kwargs)

  File "/usr/local/lib/python3.5/dist-packages/requests/adapters.py", line 516, in send

    raise ConnectionError(e, request=request)

requests.exceptions.ConnectionError: HTTPConnectionPool(host='cbioportal.cinj.rutgers.edu', port=8080): Max retries exceeded with url: /api-legacy/cancertypes (Caused by NewConnectionError('<urllib3.connection.HTTPConnection object at 0x7fb35737a080>: Failed to establish a new connection: [Errno 113] No route to host',))

[Ino de Bruijn]

Hi Jeffrey Rosenfeld,

Thanks for reaching out!

It seems like it can't make a connection to the cBioPortal API

It would be good to determine whether you can access that URL from inside the Docker container.

Try for instance to see if you can reach the internet from within the container:

 docker run --rm -it cbioportal/cbioportal:latest curl https://www.google.com

Then see if you can reach your cBioPortal website:

docker run --rm -it cbioportal/cbioportal:latest curl http://cbioportal.cinj.rutgers.edu:8080

If that doesn't work maybe search for reasons why the local network might not work inside docker (it should) e.g.:

https://forums.docker.com/t/accessing-local-network-from-docker-container/48062/3

Hope that helps!

Best wishes,

Ino

--
You received this message because you are subscribed to the Google Groups "cBioPortal for Cancer Genomics Discussion Group" group.
To unsubscribe from this group and stop receiving emails from it, send an email to cbioportal+...@googlegroups.com.
To view this discussion on the web visit https://groups.google.com/d/msgid/cbioportal/fd5f9558-dfa1-4ec0-8331-e3f5bb83be36%40googlegroups.com.

[Ino de Bruijn]

Hi Jeffrey,

Could you elaborate on your setup?

If the importer is running in the same docker network (cbio-net) you should be able to reach it via 

-u http://cbioportal-container:8080 

or with curl:

sudo docker run --rm -it --net=cbio-net cbioportal/cbioportal:latest curl http://cbioportal-container:8080

Best wishes,

Ino

On Thu, Jan 23, 2020 at 4:39 PM Jeffrey Rosenfeld <rose...@cinj.rutgers.edu> wrote:

Hi Ino,

I started my cbioportal using this command:

 docker run -d --restart=always --name=cbioportal-container --net=cbio-net -v /encdata/Docker-data/admin/portal.properties:/cbioportal/portal.properties:ro -e JAVA_OPTS=' -Xms16g  -Xmx16g  -Dauthenticate=ldap  -Dsession.service.url=http://cbio-session-service:5000/api/sessions/my_portal ' -p 8081:8080 cbioportal/cbioportal:latest /bin/sh -c 'java ${JAVA_OPTS} -jar webapp-runner.jar /cbioportal-webapp'

and got the errors you saw on the forum.  You are correct that it seems to be a network issue:

[rosenfj1@cbioportal ~]$ sudo docker run --rm -it cbioportal/cbioportal:latest curl http://cbioportal.cinj.rutgers.edu:8081

curl: (7) Failed to connect to cbioportal.cinj.rutgers.edu port 8081: No route to host

[rosenfj1@cbioportal ~]$ 

[rosenfj1@cbioportal ~]$ sudo docker run --rm -it cbioportal/cbioportal:latest curl http://cbioportal.cinj.rutgers.edu:8080

curl: (7) Failed to connect to cbioportal.cinj.rutgers.edu port 8080: No route to host

[rosenfj1@cbioportal ~]$ 

What are your suggestions?

Thanks,

Jeffrey

------------------------------------------------------
Jeffrey Rosenfeld, Ph. D

Manager, Biomedical Informatics Shared Resource

Assistant Professor of Pathology and Laboratory Medicine
Rutgers Cancer Institute of New Jersey

jeffrey....@rutgers.edu
732-235-8918 (voice)

[John Reeves]

I experienced a similar problem after I added SAML authentication.

Using cached portal side data fixed the issue for me.

John

--
You received this message because you are subscribed to the Google Groups "cBioPortal for Cancer Genomics Discussion Group" group.
To unsubscribe from this group and stop receiving emails from it, send an email to cbioportal+...@googlegroups.com.

To view this discussion on the web visit https://groups.google.com/d/msgid/cbioportal/CAOMQCYEnmT%2B6FtcpSuU5CREWna%2B%3DHhTknRmv62%2BOvUHHdCLysw%40mail.gmail.com.

[jeffrey....@gmail.com]

I ran those commands and did not get positive response, so I think there is a network problem.  I did the full installation following your recommendations on https://docs.cbioportal.org/  for using Docker.  What do you suggest?

To unsubscribe from this group and stop receiving emails from it, send an email to cbiop...@googlegroups.com.

[Jeffrey Rosenfeld]

Hi John,

Thank you for the advice.  I think I am almost there, but I am still getting a few errors.  Please tell me what else I need to do.  I am not sure if this error is still related to the loading or to the files generated by the FMI converted which seem to be lacking in the meta_ files  My data files are in: 

/encdata/home/rosenfj1/cBio

[rosenfj1@cbioportal cBio]$ ls -lh

total 3.0M

-rw-r--r--. 1 rosenfj1 rosenfj1 174K Jan 14 16:05 data_clinical.txt

-rw-r--r--. 1 rosenfj1 rosenfj1 596K Jan 14 16:01 data_CNA.txt

-rw-r--r--. 1 rosenfj1 rosenfj1  34K Jan 14 16:05 data_fusions.txt

-rw-r--r--. 1 rosenfj1 rosenfj1  16K Jan 14 16:05 data_gene_matrix.txt

-rw-r--r--. 1 rosenfj1 rosenfj1 2.2M Jan 14 16:05 data_mutations_extended.txt

-rw-r--r--. 1 rosenfj1 rosenfj1  414 Jan 14 16:06 meta_CNA.txt

-rw-r--r--. 1 rosenfj1 rosenfj1  259 Jan 14 16:06 meta_fusions.txt

-rw-r--r--. 1 rosenfj1 rosenfj1   70 Jan 14 16:06 meta_gene_matrix.txt

-rw-r--r--. 1 rosenfj1 rosenfj1  282 Jan 14 16:06 meta_mutations_extended.txt

sudo docker run --rm --net cbio-net    -v /encdata/Docker-data/admin/portal.properties:/cbioportal/portal.properties:ro    -v "/encdata/home/rosenfj1/portalinfo:/portalinfo"     -w /cbioportal/core/src/main/scripts     cbioportal/cbioportal:latest     ./dumpPortalInfo.pl /portalinfo

sudo docker run -it --rm --net cbio-net     -v /encdata/Docker-data/admin/portal.properties:/cbioportal/portal.properties:ro    -v "/encdata/home/rosenfj1/cBio:/study:ro"     -v "/encdata/home/rosenfj1/reports:/report"  -v "/encdata/home/rosenfj1/portalinfo:/portalinfo:ro"     cbioportal/cbioportal:latest    metaImport.py -p /portalinfo -s /study --html=/report/report.html

I get the errors:

[rosenfj1@cbioportal ~]$ sudo docker run -it --rm --net cbio-net     -v /encdata/Docker-data/admin/portal.properties:/cbioportal/portal.properties:ro    -v "/encdata/home/rosenfj1/cBio:/study:ro"     -v "/encdata/home/rosenfj1/reports:/report"  -v "/encdata/home/rosenfj1/portalinfo:/portalinfo:ro"     cbioportal/cbioportal:latest    metaImport.py -p /portalinfo -s /study --html=/report/report.html

Starting validation...

INFO: -: Unable to read xml containing cBioPortal version.

WARNING: -: Skipping validations relating to treatment identifiers

ERROR: meta_CNA.txt: Invalid stable id for genetic_alteration_type 'COPY_NUMBER_ALTERATION', data_type 'DISCRETE'; expected one of [cna, cna_rae, cna_consensus, gistic]; value encountered: 'Foundation_cna'

ERROR: meta_fusions.txt: Invalid stable id for genetic_alteration_type 'FUSION', data_type 'FUSION'; expected one of [fusion]; value encountered: 'Foundation_mutations'

ERROR: meta_gene_matrix.txt: Could not determine the file type. Did not find expected meta file fields. Please check your meta files for correct configuration.

ERROR: meta_mutations_extended.txt: Invalid stable id for genetic_alteration_type 'MUTATION_EXTENDED', data_type 'MAF'; expected one of [mutations]; value encountered: 'Foundation_mutations'

ERROR: -: Cancer type needs to be defined for a study. Verify that you have a study file and have defined the cancer type correctly.

ERROR: -: No valid study file detected

Thanks,

Jeffrey

------------------------------------------------------
Jeffrey Rosenfeld, Ph. D

Manager, Biomedical Informatics Shared Resource

Assistant Professor of Pathology and Laboratory Medicine
Rutgers Cancer Institute of New Jersey

jeffrey....@rutgers.edu
732-235-8918 (voice)

[Jeffrey Rosenfeld]

Hi Ino,

I run that command:

[rosenfj1@cbioportal ~]$ sudo docker run --rm -it --net=cbio-net cbioportal/cbioportal:latest curl http://cbioportal-container:8080

[rosenfj1@cbioportal ~]$ 

and get no response.  I followed other advice from John who said I should try using a portal info file, and I think that is helping.

Thanks,

Jeffrey

------------------------------------------------------
Jeffrey Rosenfeld, Ph. D

Manager, Biomedical Informatics Shared Resource

Assistant Professor of Pathology and Laboratory Medicine
Rutgers Cancer Institute of New Jersey

jeffrey....@rutgers.edu
732-235-8918 (voice)

[Benjamin Gross]

Hi Jeffrey,

I think you have made progress - getting back to the last error messages you reported - I think they may be caused because the FMI data converter and the validator may be out of sync.  Specifically, errors like the following:

ERROR: meta_CNA.txt: Invalid stable id for genetic_alteration_type 'COPY_NUMBER_ALTERATION', data_type 'DISCRETE'; expected one of [cna, cna_rae, cna_consensus, gistic]; value encountered: ‘Foundation_cna'

I would modify the meta_CNA.txt file (and any other meta files flagged by the validator output) and replace the stable id “Foundation_cna” with “cna”.

Let us know how it goes.

Best,

Benjamin

--
You received this message because you are subscribed to the Google Groups "cBioPortal for Cancer Genomics Discussion Group" group.
To unsubscribe from this group and stop receiving emails from it, send an email to cbioportal+...@googlegroups.com.

To view this discussion on the web visit https://groups.google.com/d/msgid/cbioportal/519A1D89-3C70-4012-915E-89D74A29221D%40cinj.rutgers.edu.

[jeffrey....@gmail.com]

I have gotten closer, and made it through the validation, but I am still getting some errors.  I think this may be due to the way the FMI-converter works:

INFO: data_clinical_sample.txt: Read 928 lines. Lines with warning: 0. Lines with error: 0

WARNING: data_CNA.txt: lines [101, 290]: Entrez gene id exists, but gene symbol specified is not known to the cBioPortal instance. The gene symbol will be ignored. Might be wrong mapping, new or deprecated gene symbol.; values encountered: ['H3-3A', 'CILK1']

INFO: data_CNA.txt: Validation of file complete

INFO: data_CNA.txt: Read 324 lines. Lines with warning: 2. Lines with error: 0

WARNING: data_clinical_patient.txt: Columns OS_MONTHS and/or OS_STATUS not found. Overall survival analysis feature will not be available for this study.

WARNING: data_clinical_patient.txt: Columns DFS_MONTHS and/or DFS_STATUS not found. Disease free analysis feature will not be available for this study.

INFO: data_clinical_patient.txt: Validation of file complete

INFO: data_clinical_patient.txt: Read 928 lines. Lines with warning: 0. Lines with error: 0

WARNING: data_fusions.txt: lines [115, 116]: Duplicate entry in fusion data.; value encountered: 'EGFR  1956    TRF079015       EGFR-intragenic (already defined on line 114)'

INFO: data_fusions.txt: Validation of file complete

INFO: data_fusions.txt: Read 438 lines. Lines with warning: 2. Lines with error: 0

WARNING: data_mutations_extended.txt: line 2: Including the SWISSPROT column is recommended to make sure that the UniProt canonical isoform is used when drawing Pfam domains in the mutations view

WARNING: data_mutations_extended.txt: lines [8, 22, 23, (1572 more)]: Given value for Variant_Classification column is not one of the expected values. This can result in mapping issues and subsequent missing features in the mutation view UI, such as missing COSMIC information.; values encountered: ['promoter', 'Frame_Shift_DEL', 'In_Frame_INS', '(3 more)']

ERROR: data_mutations_extended.txt: lines [531, 670, 778, (122 more)]: column 40: Unexpected ';' or '+' in amino acid change, multi-variant allele notation is not supported; values encountered: ['R1608fs*1+', 'P1597fs*13+', 'N1439fs*53+', '(96 more)']

WARNING: data_mutations_extended.txt: lines [794, 1432, 1760, (15 more)]: Allele Based column Tumor_Seq_Allele1 contains invalid character.; values encountered: ['NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN', 'NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN', 'NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN', '(4 more)']

WARNING: data_mutations_extended.txt: lines [1731, 1857, 2037, (69 more)]: Start_Position should be smaller than or equal to End_Position.; values encountered: ['(50450256.0, 50450255.0)', '(31144698.0, 31144697.0)', '(66766357.0, 66766356.0)', '(35 more)']

WARNING: data_mutations_extended.txt: lines [1731, 1857, 2080, (50 more)]: Variant_Type indicates deletion, but length of Reference_Allele is smaller than the length of Tumor_Seq_Allele1 and/or Tumor_Seq_Allele2, indicating an insertion.; value encountered: '(, -, )'

WARNING: data_mutations_extended.txt: lines [2037, 6174, 6177, (15 more)]: Variant_Type indicates deletion, but the difference between Start_Position and End_Position are not equal to the length of the Reference_Allele.; values encountered: ['(66766357.0, 66766356.0, GGCGGCGGCGGCGGCGGCGGCGGCGGC)', '(108160400.0, 108160399.0, CAGAATTCTTAAAATATATCACCTGTTTGTTAGTTTATTACTGAAAGATATAAAAA)', '(66766357.0, 66766356.0, GGCGGCGGCGGCGGCGGCGGCGGCGGCGGC)', '(9 more)']

WARNING: data_mutations_extended.txt: lines [2219, 2463, 3254, (30 more)]: Entrez gene id exists, but gene symbol specified is not known to the cBioPortal instance. The gene symbol will be ignored. Might be wrong mapping, new or deprecated gene symbol.; values encountered: ['H1-3', 'H2AC17', 'CILK1', '(5 more)']

WARNING: data_mutations_extended.txt: lines [3120, 3577, 4202, (11 more)]: Variant_Type indicates insertion, but difference in Start_Position and End_Position does not equal to 1 or the length or the Reference_Allele.; values encountered: ['(50450237.0, 50450247.0, -)', '(112175677.0, 112175682.0, -)', '(7578480.0, 7578499.0, -)', '(10 more)']

WARNING: data_mutations_extended.txt: lines [5230, 11288]: Variant_Type indicates a ONP, but length of Reference_Allele, Tumor_Seq_Allele1 and 2 are not bigger than 3 or are of unequal lengths.; values encountered: ['(CCCTG, TTCTC, )', '(CCGTGG, TCGTGT, )']

ERROR: data_mutations_extended.txt: line 9012: column 9: Value in column 'Variant_Classification' is invalid; value encountered: ''

INFO: data_mutations_extended.txt: Validation of file complete

INFO: data_mutations_extended.txt: Read 12023 lines. Lines with warning: 1615. Lines with error: 126

INFO: -: No directory named 'case_lists' found, so assuming no custom case lists.

ERROR: -: No case list found with stable_id 'Foundation_all', consider adding 'add_global_case_list: true' to the meta_study.txt file

ERROR: -: No case list found with stable_id 'Foundation_sequenced', please add this case list to specify which samples are profiled for mutations. This is required for calculation of samples with mutations in OncoPrint and Study Summary.

ERROR: -: No case list found with stable_id 'Foundation_cna', please add this case list to specify which samples are profiled for mutations. This is required for calculation of samples with CNA in OncoPrint and Study Summary.

WARNING: -: No case list found with stable_id 'Foundation_cnaseq', please add this case list to specify which samples are profiled for this data type. On the query page, this case list will be selected by default when both mutation and CNA data are available.

Traceback (most recent call last):

  File "/usr/local/bin/metaImport.py", line 127, in <module>

    exitcode = validateData.main_validate(args)

  File "/cbioportal/core/src/main/scripts/importer/validateData.py", line 4960, in main_validate

    validate_study(study_dir, portal_instance, logger, relaxed_mode, strict_maf_checks)

  File "/cbioportal/core/src/main/scripts/importer/validateData.py", line 4832, in validate_study

    validators_by_meta_type[cbioportal_common.MetaFileTypes.GENE_PANEL_MATRIX][0].validate()

  File "/cbioportal/core/src/main/scripts/importer/validateData.py", line 386, in validate

    self._validate_file()

  File "/cbioportal/core/src/main/scripts/importer/validateData.py", line 520, in _validate_file

    self.checkLine(fields)

  File "/cbioportal/core/src/main/scripts/importer/validateData.py", line 3178, in checkLine

    if sample_id not in mutation_sample_ids:

TypeError: argument of type 'NoneType' is not iterable

[rosenfj1@cbioportal ~]$ 

Benjamin

To unsubscribe from this group and stop receiving emails from it, send an email to cbiop...@googlegroups.com.

[Justin Levens]

Hello Jeffrey, did you ever get this figured out? I am receiving several of the same errors that you were receiving, however, I am using the FMI Converter but rather converting the data to MAF using SQL because we we have the FM XML reports parsed into a relational database.

Here's what I'm getting:

WARNING: data_mutations_extended.txt: line 1: Including the SWISSPROT column is recommended to make sure that the UniProt canonical isoform is used when drawing Pfam domains in the mutations view

ERROR: data_mutations_extended.txt: lines [38, 98, 169, (43 more)]: column 39: Unexpected ';' or '+' in amino acid change, multi-variant allele notation is not supported; values encountered: ['4711+2T>C', '1121_1122+14del16', '3951_3951+1GG>TT', '(43 more)']

WARNING: data_mutations_extended.txt: lines [45, 64, 98, (26 more)]: Allele Based column Reference_Allele contains invalid character.; values encountered: ['NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN', 'NNNNNNNNNNNNNNNNNNNNNNNN', 'NNNNNNNNNNNNNNNN', '(18 more)']

WARNING: data_mutations_extended.txt: lines [45, 64, 98, (28 more)]: Variant_Type indicates deletion, but the difference between Start_Position and End_Position are not equal to the length of the Reference_Allele.; values encountered: ['(39713070.0, 39713109.0, NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN)', '(21974765.0, 21974789.0, NNNNNNNNNNNNNNNNNNNNNNNN)', '(25469906.0, 25469922.0, NNNNNNNNNNNNNNNN)', '(26 more)']

WARNING: data_mutations_extended.txt: lines [517, 591, 807, (4 more)]: Variant_Type indicates a ONP, but length of Reference_Allele, Tumor_Seq_Allele1 and 2 are not bigger than 3 or are of unequal lengths.; values encountered: ['(TCAA, CCAG, )', '(CGGC, AGGA, )', '(GAATTC, TAATTG, )', '(4 more)']

INFO: data_mutations_extended.txt: Validation of file complete

INFO: data_mutations_extended.txt: Read 3768 lines. Lines with warning: 41. Lines with error: 46

[Jeffrey Rosenfeld]

Hi,

Sorry for the delay in responding.  We are still looking for a good way to convert the files from Foundation for the portal.  Did you find a way to do it?

-Jeffrey