EDTA precipitation

[Anke Wichert]

Hi all,

in our lab, we have problems with precipitation of 0.5 M EDTA solutions,
although we do check for pH 8 regularly. That precipitation occurs
independent of autoclaving. What shall we do?

Thanks for any help!

[V.S. Gautam]

just warm it. It may be occuring because the temp may be going very low in
your lab or you must be keeping it in a place where the temp is low.

Or possibly the pH is not 8.00 what you think is 8.

Best of luck.
-----------------------------------------------------

---

[Chunxin Wang]

One simple way is to filtrate through Whatman paper just after the
solution is made.

Black

[R. Jayakumar]

that's a nice idea.. the craziest I have ever heard. I am sure filtering
off any undissolved EDTA is going to reduce the molarity rather than doing
anything else. EDTA always disolved in ph 8.0 and above. If it is
precipitating, it is only because of four reasons, 1) the pH is below 8.0,
2) the temp is low 3) the damn pH meter is hoodwinking you and 4)It is not
EDTA, maybe soappowder.:-)
jayakumar

---

[Betty Anne McBey]

You need to buy the correct EDTA. Make sure you buy the soluble salt,
otherwise you will never get it all in solution.
Betty-Anne

[Stephen Dahl]

"R. Jayakumar" <ja...@mrna.tn.nic.in> wrote in message
news:00c101bf0f5d$fbb3c120$8c01...@tn.nic.in...

>
> that's a nice idea.. the craziest I have ever heard. I am sure filtering
> off any undissolved EDTA is going to reduce the molarity rather than doing
> anything else. EDTA always disolved in ph 8.0 and above. If it is
> precipitating, it is only because of four reasons, 1) the pH is below
8.0,
> 2) the temp is low 3) the damn pH meter is hoodwinking you and 4)It is not
> EDTA, maybe soappowder.:-)

Not so fast nitro...

If the problem is due to low temperature, filtering after dissolving (and
prior to autoclaving) may remove lint, dirt and silica particles that help
serve as nucleation centers for precipitating out.

regards,
Steve Dahl
Dept. of Medicine/Renal
Johns Hopkins University

[V.S. Gautam]

I don't understand why such HOOLA-BOOLA about EDTA precipitation.
In my life time, I have been in science for 18 years now, and never did
EDTA precipitate. Neither did it happen with anyone I know of (of the 80
or so Ph.D. students in our dept). And we use local stuff, not SIGMA or
any such high grade EDTA.

The best solution if anyone of you out there has EDTA precipitating, just
warm it again and it will re-dissolve.

Best of luck all of you......

Gautam
Indian Institute of Science,
-----------------------------------------------------
Judge a person by his questions, not his answers.
-----------------------------------------------------

---

[Stephen Dahl]

"V.S. Gautam" <gau...@mcbl.iisc.ernet.in> wrote in message
news:Pine.LNX.4.10.99100...@mcbl.iisc.ernet.in...

> I don't understand why such HOOLA-BOOLA about EDTA precipitation.
> In my life time, I have been in science for 18 years now, and never did
> EDTA precipitate. Neither did it happen with anyone I know of (of the 80
> or so Ph.D. students in our dept). And we use local stuff, not SIGMA or
> any such high grade EDTA.

Agreed. I've never seen 0.5M EDTA pcpt. out either, but then again if I had
a penny for every thing I've never seen happen in the lab that DID happen in
a lab........ ;^)

[Caroline Szymeczek-Seay]

I've never seen 0.5 M EDTA precipitate, but i sure have had 10X TBE do
it like crazy. One collegue commiserated, and said it happened to her
all the time, and one said "that never happens to *my* TBE." Filtering
after complete dissolution of chemicals certainly helps, though, as does
very clean glassware. But mostly I just use TAE, now!
caroline

[Stephen Dahl]

Richard P. Grant <r_g...@see.sig.for.address> wrote in message
news:r_grant-0610...@192.168.0.84...

> You mean the hydrated Na+ salt? Nah, that's for wussies...

Wusssies???

Methinks someone spent some time on this side of the Atlantic.

Steve Dahl
JHMI

[Stephen Dahl]

Caroline Szymeczek-Seay <c...@med.unc.edu> wrote in message
news:37FB6E3C...@med.unc.edu...

> I've never seen 0.5 M EDTA precipitate, but i sure have had 10X TBE do
> it like crazy. One collegue commiserated, and said it happened to her
> all the time, and one said "that never happens to *my* TBE." Filtering
> after complete dissolution of chemicals certainly helps, though, as does
> very clean glassware. But mostly I just use TAE, now!

Actually, 10X TBE is a solution that benefits greatly from filtering.
Filtered 10x TBE is fairly stable, but you have to avoid creating any chunks
of dried material around the rim that can fall into the stock and create
nucleation centers (hmmm...this is becoming my word for this newsgroup).
Pipette out of the bottle and make it a clean draw...no drips or touching
the pipette to the inner sides of the bottle as you take it out. Learned
this from a long-lost pal I used to know on the Homewood campus.....Steve,
ya out there???

Rgards,
Steve Dahl

[Chris H Lindley]

On Wed, 06 Oct 1999 09:12:10 +0100, r_g...@see.sig.for.address wrote:
>In article <37FA431B...@ovc.uoguelph.ca>, Betty Anne McBey

>You mean the hydrated Na+ salt? Nah, that's for wussies, go for the
>anhydrous stuff. It'll take a year's supply of NaOH tablets, admittedly,
>but it will go.

Yeah, and all the "Caustic soda" pellets you have left can do
wonders for unblocking the drains!!!

(needed for all the precipitated EDTA you've chucked down the sink!)

Cheers
Chris

--
ATGCTGCTAGTCGTAGCATGCTGCTTGATCGATGCGGTACGTGATGATCGTAGCTAGCTGGGCTAGTGG
¦ Chris H. Lindley Yorkshire, UK ¦
¦ ch...@scotgate2.demon.co.uk Ferg on #os/2 and #os2uk, EFnet ¦
¦ WarpUK:UK OS/2 Users group www.warp.in-uk.net ¦
¦ Molecular Biology & OS/2 www.scotgate.demon.co.uk ¦
TACGACGATCAGCATCGTACGACGAACTAGCTACGCCATGCACTACTAGCATCGATCGACCCGATCACC