Google Groups no longer supports new Usenet posts or subscriptions. Historical content remains viewable.
Dismiss

UK G-NOME NEWSLETTER (long)

19 views
Skip to first unread message

Gary Williams x3294

unread,
Nov 22, 1990, 6:28:07 AM11/22/90
to

The UK Human Genome Mapping Project would welcome contributions from the
Human Genome community to their quarterly newsletter G-NOME NEWS. The
copy deadline for inclusion in the next edition is 10th January, 1991.
Please send your articles to:

Dr. Nigel Spurr,
ICRF,
Clare Hall Laboratories,
Blanche Lane,
South Mimms,
Herts,
EN6 3LD.

Contributions can be accepted in any form - written, fax (0707 49527),
on disk (any format) or by e-mail (N_S...@UK.AC.ICRF)

========================================================================


G-NOME NEWS
-----------

The Newsletter of the UK Human Genome Mapping Project

Number 3 February 1990

Editors:
Nigel K. Spurr
Martin J. Bishop

Enquiries to:
Nigel K. Spurr
ICRF Clare Hall Laboratories,
Blanche Lane
Potters Bar
Herts. EN6 3LD


Contents:

Page No.
1) Editorial- Nigel Spurr 3

Details of the forthcoming Human Genome Mapping Workshops.


2) A Note by the HGM Project Manager - Tony Vickers 4

3) MRC-funded projects:

a) MRC-supported Human Genome project - Michael Kemp 5
b) Human Genome Mapping Project short-term travelling 6
fellowships - Tim Ditchburn


4) UK DNA Probe Bank 8

How it will function - Nigel Spurr


5) Distribution of Hybrid DNAs 10

Proposals for discussion - Nigel Spurr


6) The European Human Genome Analysis Programme - Bronwen Loder 11

7) EC Human genome analysis programme: Call for expressions 12
of interest - Diane McLaren

8) Some computational aspects of the UK Human Genome Mapping 14
Project - Martin Bishop

9) Laboratory contributions - Human Genome Mapping in Edinburgh - 17
David Porteous

10) Oligonucleotide Primers for PCR - Nigel Spurr & Sue Povey 25

Introduction
Details of primers for RFLP analysis and gene mapping


11) Appendix - Committee Chairs and Co-chairs of HGM 34
Workshops 10.5 and 11

1. Editorial

Nigel Spurr
Imperial Cancer Research Fund
Clare Hall Laboratories
Blanche Lane
South Mimms, Potters Bar, Herts. EN6 3LD

This third edition of the UK Human Genome Mapping Project Newsletter
sees a number of changes to the format and content. We now have a newly
designed front cover and logo which I hope will meet with general approval.
Similarly a start has been made to develop the scope of the Newsletter and make
the content as relevant as possible.

The content of the Newsletter falls into three categories, one dealing
with the general management of the HGMP and information on funding, travel
fellowships etc. Secondly, how some of the centralised resources such as the
Probe Bank will function; and finally articles of more scientific value on PCR
primers and contributions from a number of laboratories in the Edinburgh area.
I hope that these last two sections will become a regular feature giving
technical information and also some background on the wide range of projects
based on genetics being carried out in this country. If you have any technical
data, particularly on the use of specific PCR oligonucleotide primers that you
would like included, please write to me. I hope that the next issue will
include a profile of genetics in the Oxford region. Any volunteers to help
with London?!

This year also sees the first of two Human Gene Mapping Workshops to be
held in the UK. The first HGM10.5 will be held in St. John's College, Oxford,
6th-10th September 1990, and is an intermediate meeting between the main
biennial meetings. This will be a closed meeting with only the committee
chairmen participating. The aim of this meeting will be to update the human
gene map and is also a chance for chairmen to learn the new computer database
system being developed in a collaboration between ICRF and the Welch Medical
Library at the Johns Hopkins University. An update of the HGM proceedings and
maps will be published after this meeting. After September it should be
possible to update the HGM database through on-line computer access. The next
main HGM meeting, HGM11, will be held in London in the period between 16th-25th
August 1991, and further information will be available shortly. This will be a
full meeting with posters, invited speakers and an opportunity to review the
updated map of the human genome. It is hoped by this time to have been able to
start to merge information from the genetic linkage maps and the physical maps
produced by YACS, pulse field, overlapping contigs, etc.

To help with the dataflow for these meetings the various committee
chairmen would be exceedingly grateful for any preprints including information
on new assignment update maps, both genetic and physical, as the earlier the
data is available the simpler the task for the chairmen in producing the most
up to date and accurate map. To help you in this task is attached a list of
names, addresses etc. of the committee chairmen who will be responsible for
processing and updating the human gene map in the next two years (see
Appendix).


2. A Note by the HGM Project Manager

Tony Vickers
Medical Research Council
20, Park Crescent
London W1N 4AL

We are nine months into the initial three-year period of the UK Human
Genome Mapping Project. Three weeks as Project Manager have been a time for
taking stock, both of what has been achieved here and of developments in the EC
and the US programmes. Other articles in this issue of G-String report in
detail. One priority is to ensure that the UK is acknowledged as a major
player in the international effort. A second priority is to implement the
plans for a Resource Centre. The next three months should see substantial
progress on both fronts.

The Resource Centre will be housed at the Clinical Research Centre at
Northwick Park, Harrow. Space there is being refurbished. Negotiations to
recruit key senior staff look promising. If all goes well, the Centre should
be operational by mid-April. Although the Resource Centre will use the CRC's
infrastructure and central services, it will be managerially entirely dependent
of the CRC and under the control of the Project Management Committee. Two
subcommittees of the Scientific Advisory Board have been identifying communal
resources that will be valuable for the UK programmes. The Subcommittee's
initial 'shopping lists' were published in the second issue of G-String. Good
progress is being made to establish some of these in other laboratories, ready
to be transferred to the Centre as service facilities as soon as possible. The
St. Louis YAC Library is a major example.

The Directed Programme Committee have used three meetings to begin the
expansion of key areas of activity and survey the lie of the land. They will
meet again soon to formulate a general strategy for the Directed Programme.

G-String, the Users Meetings (the next is planned for shortly after
Easter) and the activities of the two Resources Subcommittees are more-or-less
formal communication channels, and it's always open to anyone to bend the ears
of members of the various committees within the system. As policies and
initiatives are defined within the committee structure, news will be
circulated, either through G-String or, in the gaps between issues, by notes.
But I want to play an informal role both in explaining what is going on (or
not) and in finding out what is happening outside the confines of Park
Crescent. I'd very much like to be invited to visit laboratories to get to
know people (and renew old acquaintances) and be able to see things through
their eyes.

My office time is divided between Park Crescent (01-636 5422) and
Northwick Park (01-869 3446). Christine Bates at Northwick Park has my diary
and can fix provisional times - which I'll confirm or amend as soon as possible
- when people can drop in at one place or the other for a chat or when I can
come to see them. Or write to me (at Park Crescent) if that's simpler.


3. MRC-funded projects:

a) MRC-supported Human Genome project

Michael Kemp
Medical Research Council
20, Park Crescent
London W1N 4AL

The joint MRC/ICRF Scientific Advisory Board, which sponsors this
Newsletter, was set up in 1988 to help coordinate the activities of the MRC and
ICRF in human genome mapping and to act as an interface with work overseas.
One of its first actions was to help formulate and to support proposals for
additional public funding for research in this field. These were intended to
implement and facilitate ongoing research in the field, and were to be targeted
towards a Resource Centre and a Directed Programme of Research. In February
1989 the Secretary of State of Education and Science approved additional
funding for the MRC amounting to #11m in the first three years from April 1989.

The MRC has long recognised the desirability of having an overall
manager of this Mapping Project and very recently has been pleased to be able
to recruit Dr. Tony Vickers to fulfil this role, on a part-time basis. He
will play a major part in international relations, in liaison with other UK
interests in genome mapping and its uses, and in setting up and directing the
Resource Centre, as well as in coordinating Resource Centre and Directed
Programme activities.

A Directed Programme Committee was set up under the Chairmanship of
Professor Lewis Wolpert FRS and first met in July 1989. It has met again in
October and plans to meet roughly four times a year. Thirty-nine grants with a
total value of #3.6m have already been awarded and a large grant for a
feasibility study of sequencing, as a model system, the genome of the nematode
Caenorhabditis elegans is expected to be awarded as part of a collaboration
with a group at MIT. Under the auspices of the Directed Programme Committee,
there is also provision for research studentships, short-term fellowships and
attendance at relevant overseas meetings, but in all these cases it is
important to bear in mind that the aim of the system is to increase support for
the field, not to substitute for existing sources of funds. This applies
equally to the scope of awards under the Directed Programme. As advertised in
the MRC's "GTA Note 244" a major focus of such grants is intended to be on the
development and evaluation of techniques of relevance to mapping and sequencing
studies of the human genome, and to novel approaches into genome study that may
facilitate such work. However, central to the concept of a Directed Programme
is the notion of 'pro-activity' - that the Committee should seek out areas of
work that need to be stimulated and assisted through a coordinated approach.
One area already identified is the study of mouse genetics, with a particular
emphasis on the possibility for using the mouse to create transgenic models of
human disease.

Progress in developing a Resource Centre has been considerably
facilitated by the establishment by the joint MRC/ICRF Scientific Advisory
Board of two Working Groups - on Biological Resources and Computing. Their
interim reports, published in the previous issue of G-String, were commended by
the Advisory Board, who asked the Groups to consider the implementation of
their recommendations. In so far as these require substantial expenditure,
this is being taken up through the funding available to the MRC for a Resource
Centre.

A large award has recently been made to the ICRF to enable Dr. Nigel
Spurr to develop the probe bank resource which has been accumulating for ICRF's
own purposes, to continue to expand it and to make the probes available to the
UK research community. Details of this resource will be publicised separately.

As the first step is making available in the UK the YAC library
generated in the USA by Olsen and Schlessinger, an award has been made to
enable Dr. Kay Davies and Dr. David Bentley to bring it into the UK, and
proposals to set up a hybridization- and/or pcr-based resource are now being
formulated. Although this work will be pressed ahead with as soon as possible,
it will certainly take some time before this resource is available in the UK
(though a number of copies of the library will be made available to major
groups). As readers will appreciate, a key reason for this development is the
overload of demand on the St. Louis group, who will not be able to accept
future UK requests. Amongst other developments, proposals for a cell bank
facility, including the underpinning needed for immortalizing cell-lines, are
also being finalized. In Cambridge, Dr. Brenner is receiving support to
develop novel approaches to YAC libraries which it is hoped will lead to
systems that are easier to use.

In addition to the appointment of Dr. Tony Vickers as Project Manager,
the Secretariat at MRC Headquarters is being strengthened to enable the Project
to develop as effectively as possible. Dr. Diane McLaren has come on
secondment from the MRC National Institute for Medical Research and will be
able to spend up to half her time on the Project, taking over from Dr. Michael
Kemp who has assumed broader responsibilities as Executive Secretary of the MRC
Cell Board. Dr. Simon Warne, the Scientific Administrative Officer for the
MRC's long-term support in human genetics, will continue to be closely
associated with the Project, in particular the Directed Programme. Mr. Tim
Ditchburn, whose assistance in setting up the administrative systems needed for
the Project, especially the Directed Programme, has been invaluable, will
continue to be involved until Easter; he will then be succeeded by Dr. Furzan
Chaudry-Bayri. All day-to-day enquiries about support available under the
Project should be addressed to the HGMP Secretariat at Park Crescent.

b) Human Genome Mapping Project short-term travelling fellowships

T. Ditchburn
Medical Research Council
20, Park Crescent
London W1N 4AL

The purpose of this scheme is to enable individuals involved in human
genome research in the UK to undertake a period of intensive advanced
specialist training overseas of up to three months duration. Applications for
shorter collaborative visits, designed to enable individuals to learn specific
techniques, will also be considered in exceptional circumstances.

Eligibility

This scheme is open to individuals involved in human genome research in
the UK at any stage in their career; there are no restrictions on age. It is
generally expected that successful applicants will hold a fellowship during a
period of paid leave.

How to apply

Applications can be made at any time during the year. Team leaders
will normally apply on behalf of members of their team. Advice can be obtained
informally from members of the HGMP Directed Programme Committee and candidates
may be invited to attend an interview with a nominated member.

There are no application forms. Applicants should submit the following
to the MRC Head Office (HGMP Secretariat):

1. A full curriculum vitae and indication of current research support.

2. A summary of the work to be undertaken whilst on the fellowship.
Applicants will be expected to demonstrate that the training they seek is not
available within the UK, and to show its applicability to work to be pursued in
the UK.

3. A letter of support from the overseas host department.

4. An indication of any equipment requirements that are likely to arise if as
a result of the fellowship it is decided to set up a new technique in the
applicant's laboratory. Terms of the award

The award of an HGMP Travelling Fellowship will entitle an individual to:

a) Travel costs for the Fellow only of one journey to and from the centre where
the training will take place.

b) A subsistence payment (including a contribution towards the cost of
reasonable accommodation for the period of the award). This payment will be
based upon the geographical location of the overseas centre and the
individual's present circumstances.

It will be the individual's responsibility to make provision for any
medical insurance; visas (if needed); UK income tax, national insurance and
superannuation contributions, as appropriate; also to obtain any necessary
approval for the paid leave of absence from their employers and/or funding
body.

On return, Fellows will be expected to submit a short report of their
visit to the Directed Programme Committee.

4. UK DNA Probe Bank

Nigel K. Spurr
Imperial Cancer Research Fund
Clare Hall Laboratories
Blanche Lane
South Mimms, Potters Bar, Herts. EN6 3LD

The MRC have agreed to fund the DNA Probe Bank. This has now been
established at ICRF Clare Hall Laboratories and the functions are being
established.

a) The Probe Bank has two objectives:

(i) To supply upon request DNA markers. The majority of those held in the
Probe Bank detect RFLPs. We hope to circulate a catalogue of markers held
during March - April 1990. However, we are constantly updating the listings
and a full comprehensive catalogue will be available via JANET on the ICRF Vax
cluster by May - June 1990. Probes will be supplied in two possible formats:
as bacteria containing recombinant plasmids (currently using DH5a as host) or
as purified DNA (approximately 10mg of DNA).

In the past many groups have requested large numbers of probes for
particular studies for example defining the location of a genetic disease or
testing the genome for reduction to homozygosity in blood/tumour pairs. To
help with this work we aim to put together kits of DNA probes covering the
human genome. We hope to be able to use probes detecting fragment RFLPs with
at least one marker/chromosome arm.

There are numerous markers detecting RFLPs but these require the DNA
being tested to be digested with a wide range of restriction enzymes. We will
be aiming in our kits to keep the number of different enzymes required to a
minimum, ideally a single enzyme to screen the genome but more realistically we
hope to produce a kit requiring no more than six different enzyme/probe
combinations. As marker technology develops we will be testing new markers to
replace some of the existing ones and developing and testing oligonucleotide
primers for PCR analysis. Eventually our kits may solely consist of sets of
primers for PCR. The use and testing of primers will be published in each
edition of the Newsletter.

(ii) To isolate new DNA markers, particularly to bridge some of the gaps
seen in current genetic maps. We hope that this exercise can become an area of
collaboration with other groups in the UK Human Genome Project: If any group
has a particular interest in isolating new markers or wishes to develop new
strategies we will be pleased to hear from you. The aim of the Probe Bank is
to be interactive with the other groups in this project.

b) To obtain probes:

We have proposed to the MRC a charge structure for the DNA probes. The
details of this have not yet been decided and once further information is
available it will be circulated.

Requests for all probes should be in writing by letter or FAX. No
telephone requests will be accepted but we will be happy to discuss
requirements or possible collaborations by this means. Requests should be
addressed to:

Dr. Nigel K. Spurr Tel.No: 0707-44444 Ext. 353
UK DNA Probe Bank
ICRF Clare Hall Laboratories FAX No: 0707-49527
Blanche Lane
South Mimms
Potters Bar, Herts. EN6 3LD
U.K.

It is likely that the telephone extension and Fax numbers will change
and notification of these changes will be circulated. Before probes can be
sent out you will have to complete a form stating that you agree to the
conditions for use of probes. We have obtained permission from all originators
of probes in the Bank and have agreed with them certain conditions for
distribution to third-party users. Therefore, if you think you will need
probes soon, write and request a Conditions of Use form for the probes.

The DNA Probe Bank depends on the UK Human Genome user groups for its
success and, therefore, if you have any probes suitable for distribution,
requests for new probes or helpful comments on the use of markers eg. special
requirements for hybridising, washing off probes, etc., please do not hesitate
to contact us.

5. Distribution of Hybrid DNAs

Nigel K. Spurr
Imperial Cancer Research Fund
Clare Hall Laboratories
Blanche Lane
South Mimms, Potters Bar, Herts. EN6 3LD

One of the requests for resources from the questionnaire distributed at
the first general meeting of the participants in the UK Human Genome Project
was on the availability of somatic cell hybrids for gene mapping.

I have discussed this requirement with a number of groups who have
substantial numbers of hybrids and the general response is that limited amounts
of DNA from somatic cell hybrids could be made available. A number of criteria
for the culture and distribution of the DNA have been put forward; these are
listed below:

1) The hybrid cell lines will not be generally available. (Hybrids are
difficult to characterise and are unstable in culture. All the hybrids used in
DNA preparations are always characterised at the same passage for the presence
of human chromosomes.)

2) Hybrid DNA would be provided from well characterised hybrids. The cells
should be cultured and characterised by the originators of the hybrid and DNA
prepared by them or centrally.

3) DNA would be available only for bona fide gene mapping work and would not be
distributed "just in case".

4) All results must be communicated back to the central resource facility who
would check results and confirm hybrid characteristics with the originators,
all of whom should be acknowledged in any subsequent publications. No results
should be published using DNA supplied by the resource facility without having
the data checked.

We need to be able to gauge the interest in such a resource being made
available. Therefore, if you have hybrids and would like to participate in
growing and testing your hybrids for inclusion or if you would be interested as
a user of the DNA, please contact Dr. Nigel K. Spurr. This will enable us to
judge response and put in a suitable request for support to the MRC's Project
Management Committee.


6. The European Human Genome Analysis Programme

Bronwen Loder
Imperial Cancer Research Fund
Lincoln's Inn Fields
London WC2

The proposal for this programme, previously known as Predictive
Medicine, is still under consideration. Progress is being made, however; the
Council of Ministers reached a Common Position on the proposal on 15 December
1989 and it has now begun its second reading in the European Parliament. This
latter process will be completed by the end of May, after which the Council of
Ministers gives its final approval and formally awards the budget.

The programme will have a budget of 15 million ecus (#11m approx.) over
2 years (1990-1991). The provisional allocation of resources is as follows:

millions of ecus

Improvement of the human genetic map 3.3

Physical mapping 3.4

Data handling and data bases 2.2

Improvement of the methods and basis for the
study of the human genome 2.2

Training fellowships 1.9

Ethical, social and legal aspects 1.0

Management and staff 1.0

TOTAL 15.0

A Call for Proposals, accompanied by an Information Package, will be
launched in the next month or two. The closing date for applications is not
known at present, but can hardly be before 30 June 1990.

However, two areas of the programme (Improvement of the Genetic Map;
Physical Mapping) will be dealt with by different procedures. In these areas
the Commission is seeking "expressions of interest" in advance. In the UK,
this is being done through the MRC. Genetic mappers' and physical mappers'
attention is drawn to the item immediately below this.

7. EC human genome analysis programme: Call for expressions of interest

Diane J McLaren
Medical Research Council
20 Park Crescent
London W1N 4AL

As mentioned above, a Call for Proposals for this programme will be launched in
the next month or so. However, two areas will probably be dealt with by
different procedures. In order to make sure that they have the opportunity to
submit proposals, potential applicants in these two areas - improvement of the
Genetic Map and Physical Mapping - are asked to put forward expressions of
interest now, in writing, to the HGMP Secretariat.

A description of these two areas follows:

1. Improvement of the Genetic Map

An improved genetic map at the 5 centimorgan level is to be developed
by setting up a network of about 20 laboratories throughout Europe associated
with appropriate resource centres.

Resource Centres

Two resource centres are envisaged, a membrane resource centre and a
probe resource centre. These will be charged with the collection, preparation
and distribution to the network of laboratories of a variety of materials
including: (a) DNA probes and (b) samples from 60 anonymous families. The DNA
samples are to be distributed in the form of membranes.

Collaborating laboratories

Each collaborating laboratory will be expected to type the 60 families
(comprising about 750 members) with 100 probes. Following independent
confirmation of results, the laboratories will enter raw data into a
computerised database held at the membrane resource centre. It is hoped that
laboratories will be linked to this centre by a computer network which will
permit linkage analysis, access to linkage information and communication with
other databases. It is also hoped that each laboratory will be provided with a
grant to cover consumables and, where necessary, one full-time technician.

Conditions

Laboratories interested in submitting proposals for EC funding in this
area must be involved in human genetic mapping, must have experience in linkage
analysis using DNA probes and must have adequate computing expertise. It will
be necessary for each laboratory to provide details of their experience and
indicate if they have isolated DNA sequences which require mapping. A
description of existing computing facilities should also be included.

2. Physical Mapping and Ordered Clone Libraries

Laboratories will be required to act as resource centres for the
maintenance and distribution of gridded clone libraries and/or cDNA libraries;
they should be able to undertake either or both of the following:

(a) Construction of "normalised" cDNA libraries (ie. large-insert
[full-length] libraries where representation of mRNA species in a given tissue
is equalised). These libraries should serve as a resource for systematic cDNA
sequencing by interested laboratories. Sequences are to be submitted to the
EMBL database and clones are to be deposited in appropriate clone banks. A
database of clones identified, sequenced and/or distributed for sequencing is
to be maintained.

(b) Construction and ordering of cosmid or YAC clones for specific regions of
the human genome; these should be organised for each recovery and analysis of
single clones (gridded libraries). The Laboratory involved should have
demonstrated expertise in both the cloning and analysis part of the project and
should make provision for the subsequent distribution of clones. Preference
will be given to laboratories that have established collaboration with other
European laboratories in the characterisation and use of the chromosome
specific library generated in the course of their work.

Potential applicants for areas 1 and/or 2 should write, expressing
their interest, to Dr. Chaudry-Bayri, HGMP Secretariat, MRC Headquarters, 20
Park Crescent, London W1N 4AL, before 18 March 1990.

Those interested in other areas of the programme, viz.

- data handling and databases

- basic technologies

- fellowships

are invited to register their interest with the HGMP Secretariat, which will
alert them when the official Call for Proposals appears.


8. Some computational aspects of the UK Human Genome Mapping Project


M.J. Bishop
MRC Molecular Genetics Unit
Hills Road, Cambridge CB2 2QH


Interim Training Course

It is expected that computers will be essential in handling the large
amount of information obtained in genome mapping. For this reason the Advisory
Board has requested that training courses involving the use of computers be
established as soon as possible. Initially the courses will be held in the
Computer Teaching Laboratory of the University of Cambridge, Council of the
School of Biological Sciences with the help of staff member David Judge. Four
modules are being designed, each to occupy seven hours teaching time, with
flexibility as to which are taken. It is expected that courses will be mounted
three times per year. It is hoped that the first courses will be run in March
1990.

Planned contents of the courses are as follows:

Module 1

Elementary use of Gnomenet computers (Unix operating system)
Electronic mail
Bulletin boards (BIOSCI, NISS)
Network fileservers (EMBL, Lancaster)

Module 2

Databases of cell lines and probes
Microbial Strain Data Network (MSDN)
Genetic maps (human, mouse)

Module 3

Human genetic linkage analysis
Physical mapping of DNA (Sulston software)

Module 4

DNA sequencing (Staden software)
DNA and protein sequence analysis (eg. GCG software, FASTA)

SEQNET

SEQNET is a UK national computing service for molecular biology
established by the Science and Engineering Research Council (SERC) at Daresbury
Laboratory. It is not part of the UK HGMP and serves a different need. Before
defining UK HGMP computing requirements we give a summary of the SEQNET
service. This is VAX/VMS based and implemented on a MicroVAX 3600. Software
includes the GCG package, the NBRF software, ISIS software, PHYLIP, FASTA etc.,
DNA and protein sequence databases, Brookhaven PDB structural database, EMBL
daily updates via DECNET (EMBNet) and a VAXNotes conference on sequence
analysis.

UK HGMP Computing Needs: GNOMENET

These needs are characterised by the ability to make use of and
cooperate in international developments of databases and software, and the
ability to make use of new high performance hardware and systems software. The
requirements are to be enabled by adherence to standards or use of multivendor
products:

Unix operating system
X-Windows visual interface (X11/News)
TCP/IP network protocol (migrating to ISO/OSI)
SQL for relational database applications

These considerations suggest that Gnomenet will be implemented as
distributed servers and workstations running Unix with high speed network
links. Computational requirements for human genome mapping and sequencing may
have been exaggerated. It is still a matter for biological research to develop
efficient methods of physical mapping and sequencing. If these are correctly
structured at the biological level the computational problems will be
controlled. Biological divide and conquer strategies mean that brute force
computer power will be unnecessary. Prior to this time, there is an urgent
need for coordinating and joining existing database efforts.

Databases for HGMP

A wide variety of databases are relevant to the HGMP. Many of these
already exist in some form and it is better to have databases with narrow scope
and expert control as this will lead to better quality than having monolithic
efforts. Subject areas amongst relevant discrete specialised databases can be
identified as follows:

Bibliography
Taxonomy
Biological materials
cell lines
probes
Genetic maps
linkage data
cytogenetic data
Physical maps
YAC contigs
cosmid contigs
DNA sequences
genomic
c-DNA
Proteins
experimentally confirmed
inferred from DNA sequences
Macromolecular structures
nuclear magnetic resonance
X-ray crystallography

Existing databases often have poor internal consistency with, for
example, what should be identical terms having incorrect spelling due to
typographical errors and lack of machine checking. These problems are being
resolved by the move to manage the data (at least at the database compilation
centres) in Relational Database Management Systems (RDMS) such as Oracle and
Sybase. There is also poor connectivity and consistency between databases
which contain related data eg. genetic maps, DNA sequences and protein
sequences. There has been a recent effort to improve these connections and as
a result errors have been discovered and corrected.

Some examples of relevant databases are:

Bibliography
Medline
Taxonomy
Biosys
Genetic variants
Online Mendelian Inheritance in Man (OMIM)
Genetic maps
Human Genome Mapping Library (HGML)
DNA sequences
DNA Database of Japan
EMBL
GenBank
NBRF Nucleic
Protein Sequences
Protein Identification Resource (PIR)
SwissProt
Protein Research Foundation
Structures
Brookhaven Protein Data Bank

Among these OMIM and HGML are mutually cross referenced and the same
has recently become true for HGML and GenBank (for human sequences). SwissProt
has pointers to both EMBL and Brookhaven. EMBL and SwissProt have gene names
which may enable links to HGML to be established. As yet, bibliography and
taxonomy are handled repetitively and internally to database entries.

The work to provide fields to enable existing databases to be joined
needs to be maintained and extended. Individual databases will then become
smaller and more consistent with others. This needs collaboration and
coordination on an unprecedented scale. In particular, a special effort to
agree on nomenclature will have to be established. Computers holding the data
need to be linked by an international network to ensure integrity and update.
New software will be developed to browse through databases and display texts
and graphics (eg. maps). This is therefore an undertaking which UK HGMP
cannot tackle alone but will wish to advance in collaboration with others.

9. Human Genome Mapping in Edinburgh

David J. Porteous
MRC Human Genetics Unit
Western General Hospital
Crewe Road
Edinburgh EH4 2XU

Edinburgh has long been at the forefront of the human genome mapping
effort, from early somatic cell and cytogenetic approaches and linkage studies
through to the full gamut of molecular techniques now being brought to bear on
the problem. HGM5, the fifth international Human Gene Mapping Workshop, held
in Edinburgh in 1979 under the chairmanship of Prof. H.J. Evans, marked the
first chromosomal assignment of human genes by recombinant DNA methodologies.
Since then, the MRC Human Genetics Unit alone has been responsible for the
molecular cloning and regional mapping of over two hundred DNA segments and the
primary or refined mapping of several major genetic disease and cancer
susceptibility loci.

The Medical Research Council, originally a Joint Project between the
MRC Mammalian Genome Unit (MGU, Dir. E.M. Southern) and MRC Cytogenetics and
Population Cytogenetics Unit (CAPCU, Dir. H.J. Evans), has been the main
sponsor of the Human Genome Mapping effort over the last decade. It was at
MGU, amongst many other sentinel discoveries, that the 'Southern' Blot was
born, the CpG 'islands' were discovered and recognised to mark the 5' ends of
most genes (Bird) and that the molecular nature of the pseudoautosomal region
of the human X and Y chromosomes was first described (Cooke). On the other
side of the city, MRC CAPCU (now Human Genetics Unit, HGU) pioneered staining
techniques essential to karyotype analysis, a tradition which has been
continued through the development of FACS chromosome analysis, automated
karyotyping, locus and chromosome specific in situ hybridisation and chromosome
painting by confocal microscopy. The Unit went 'molecular' in 1982 with the
recruitment of Dr. Nick Hastie, while Ed Southern's 'defection' to bolster
molecular biology in Oxford in 1987 prompted a further consolidation of the MRC
research programme on the Western General Hospital site.

Major contributions from MRC HGU over the last few years span the whole
range of mapping activities, from novel somatic cell genetic approaches
(including the first demonstration of functional transfer of Yeast chromosomes
to mammalian cells), through demonstration of the molecular nature of mammalian
telomeres and their functional cloning in Yeast, to physical and genetic
mapping of inherited disease and cancer, notably X-linked retinitus pigmentosa
(RP), Wilms' tumour and WAGR Syndrome, familial adenomatous polyposis coli
(FAPC), breast cancer and schizophrenia. While the strong tradition in
'enabling technologies' continues, the Unit has also emphasised the value of
comparative mapping and gene expression studies, notably of developmental
mutations in the mouse, and the importance of disease modelling through gene
targeting in embryonal stem cells.

However, the commitment to human genome mapping is far from confined to
the MRC. Many basic concepts and major discoveries in the pioneer years of
recombinant DNA technology stemmed from the Departments of Genetics and of
Molecular Biology, on the Kings' Building Science campus. For example, Prof.
N.E. Murray was instrumental in developing many of the E.coli hosts and lambda
cloning vectors we now take for granted. At the other end of the spectrum, a
joint initiative between the AFRC and the Department of Genetics established a
programme of transgenic research on which the successful application for an IRC
for transgenic animal biology was based (see AFRC CAGR below). The remit of
the IRC has been given a new focus with the first demonstration, by the groups
of Drs. Hooper (Dept. Path.) and Melton (Dept. Mol. Biol.), of germ line
transmission of gene targeted mutations created in cultured mouse embryonal
stem (ES) cells by homologous recombination.

Back on the Western General Hospital site, Prof. Brock (University
Dept. of Medicine, Human Genetics Unit) has made amongst the most important
medical contributions to immuno and molecular diagnostics, from spina bifida to
cystic fibrosis.

The following is a brief outline of current research in Edinburgh which
relates to the human genome mapping initiative:

1. MRC Human Genetics Unit, Western General hospital, EH4 2XU. (Dir.
Prof. H.J. Evans; Assistant Dir., Drs. D. Rutowitz & M. Steel; Heads of
Section, Drs. N. Hastie & H. Cooke)

The unit, with approximately 140 MRC and nearly 80 attached staff has
its MRC funding supplemented by a number of specific awards under the Human
Genome Mapping Programme and a variety of outside awards to individual
investigators and attached workers. These include the Cystic Fibrosis Trust,
the Wellcome Trust, the Retinitis Pigmentosa Society, The Leverhulme Trust, the
Lister Foundation, the Scottish Hospitals Endowment Research Trust, the
Scottish Home and Health Department and the EC. The majority of staff are
either largely or at least partly involved in human genome mapping activities.
The following is a brief summary of current research.

WAGR Syndrome (Hastie, van Heyningen, Porteous, Bickmore & Pritchard- Jones)

The analysis of WAGR (Wilms' tumour, Aniridia, Genitourinary
abnormalities and mental Retardation) Syndrome constituted the first major
molecular genetic project in the Unit and has served to pioneer and develop
many of the methods now being applied to other diverse projects. WAGR patients
are characterised by variable length constitutional hemizygous deletion of the
short arm of chromosome 11 which always include at least part of band 11p13.
Lymphoblastoid cell lines established from a large set of patients exhibiting
the complete or partial WAGR phenotype were fused to rodent cells and hybrids
retaining the deletion and normal chromosomes 11 segregated by FACS selection
for cell surface marker expression (van Heyningen). The genes for catalase and
the beta-subunit of follicle stimulating hormone were shown to map to the
centromere proximal and distal ends of 11p13 (approx. 6Mbp), but neither was
universally deleted. We derived reduced chromosome 11 hybrids by HRAS1-
selected chromosome mediated gene transfer (Porteous) and by tumour selected
fusion (Porteous & van Heyningen). We cloned and mapped over 200 human DNA
lambda and cosmid clones from these hybrids onto panels of WAGR deletion
hybrids (Porteous, Bickmore & van Heyningen). Closely linked markers were used
to construct a CpG island map of the WAGR region (Bickmore & Maule). Smallest
region of overlap markers analysed for species conservation (Brookes), and CpG
island 'end clones' have been isolated and are being assessed for patterns of
expression consistent with the appropriate partial phenotype of WAGR. We are
also isolating YAC clones for the region by preparative PFGE cloning; these
will be useful for fine structure mapping and isolation of other genes in the
region, and for functional testing, eg. of suppressor activity, by
reintroduction into appropriate mammalian cells (Arvelier & Maule). We have
confirmed by RNA in situ hybridisation of human and mouse fetal kidney and on
sections of Wilms' tumour (Pritchard-Jones) that a candidate gene (isolated by
Housman, Boston) has all the hall marks of the Wilms' tumour gene, essential
for normal nephrogenesis and, by implication, inductive development of the
genitourinary tract. Interestingly, we find that a patient with no visible
deletion, but with gonadal dysgenesis without Wilms' tumour is specifically
deleted for this candidate gene, suggesting that these two pathological states
are alternative manifestations of mutation of the same gene (van Heyningen &
Hastie). The gene is a member of the 'Zinc Finger' family of putative DNA
binding proteins; future experiments will aim to determine the nature and
spectrum of Wilms' mutations, test whether tumorigenicity can be suppressed by
introduction of the normal gene, establish whether this gene alone can account
for all of the associated anomalies of genitourinary development, and identify
the assumed cellular target (the Beckwith Weiderman gene at 11p15?). In
addition, we will use gene targeting at the cognate Wilms' tumour locus in
mouse ES cells to model neoplasia and development.

Breast, colon and ovarian cancer (Evans & Steel). We are carrying out linkage
studies in extended pedigrees with high incidences of breast (Thompson), colon
(Dunlop) or ovarian (Eccles) cancer, as well as allele loss studies in cases of
sporadic forms of these cancers, focusing particularly on 17p13-15 and 5q21-22
(supported in part by the Breast Cancer Research Trust, in collaboration with
the Depts. of Pathology and Surgery (CRC supported) and Dr. Nakamura, Cancer
Institute, Tokyo). We have shown that over 60% of sporadic breast tumours have
allele loss involving 17p and that about 70% of sporadic colon cancers show
hemizygosity of the region of 5q that includes the gene for familial
adenomatous polyposis coli. We are also using the polymerase chain reaction
and direct sequencing or the Hydroxylamine-Osmium Tetroxide (HOT) mis-match
detection technique to look at mutations in the p53 gene associated with these
cancers (Prosser).

Lymphomas and leukemias (Steel). We are investigating the region at and around
the retinoblastoma locus at 13q14 for possible rearrangement associated with
lymphoma and leukemia. Cell hybrid data (mainly from David Saltman, MRC
Canada) point to the existence of unidentified tumour suppressors relevant to
haemopoietic malignancies. We are currently focusing on 8p and 6q. In
addition, we are generating monoclonal antibodies that define new antigens
expressed at specific stages of B lymphocyte differentiation, then going on to
identify and map the genes encoding them. (Supported by the Kay Kendall
Leukemia Research Fund).

Cystic Fibrosis (van Heyningen, Dorin & Porteous). (Supported in large part by
the Cystic Fibrosis Research Trust). We have cloned and mapped the cystic
fibrosis associated calcium-binding proteins to chromosome 1q12-q21. These are
members of a large family of closely related proteins, almost all of which we
have shown to map to this region in man, and to a newly defined homologous
region in the mouse, which turns out to span the centromere in man (Dorin & van
Heyningen). On chromosome 7, we used gene targeting to introduce a dominant
selectable marker by homologous recombination into a CF-linked locus and then
chromosome mediated gene transfer to enrich for the CF locus (Dorin &
Porteous). With the CF gene now cloned and the major mutation identified, we
are using the gene targeting approach in mouse ES cells to introduce the human
mutation into the cognate mouse gene. Generation of germ line chimeras (in
collaboration with Dr. M. Hooper, Dept. of Pathology) and breeding to
homozygosity will provide a model for the human disease (Dorin, Dickinson &
Porteous).

DiGeorge Syndrome (Sharkey & Evans). DiGeorge Syndrome, a developmental field
defect in human embryogenesis, is thought to be due to monosomy of 22q1.1. We
are deriving new DNA probes for the region from a NotI library of ch22-only
human-mouse hybrid DNA and from FACS sorted derived chromosome 22 from a
patient with Cat Eye Syndrome. In addition, we are producing X-irradiation
fusion hybrids for reduced chromosome 22 fragments to aid mapping and as a
cloning source for new markers.

Retinal disease genes (Bhattacharya, Lindsay, Bower, Wright). We first showed
genetic linkage of X-linked retinitus pigmentosa to the short arm of the human
chromosome. At least two different forms of the X-linked disease are now
recognised and shown to map to distinct regions of the short arm. We have
isolated a battery of X-chromosome derived cosmids which have been mapped by in
situ hybridisation and to a panel of somatic cell hybrids carrying derived
X-chromosomes. Cosmids mapping to the relevant region are being assessed for
potential coding sequences by the criteria of restriction with endonucleases
diagnostic for CpG islands, by species conservation ('Zoo' blots) and by
detection of transcripts in retinal and other cell lines (Bhattacharya, Lindsay
& Bower). This work is supported in part by a Programme Grant from the
Wellcome Trust.

As an alternative approach towards enrichment cloning for the region, we aim to
introduce a dominant selectable marker into the relevant region of the X
chromosome by homologous recombination from which reduced X-hybrids will be
derived by CMGT or X-irradiation. YAC libraries have also been established by
conventional and novel means (see below) from FACS sorted X chromosomes and
from cell lines containing multiple copies of the X-chromosome, providing
probes for and complementary to the long range restriction map we are
constructing of the region (Wright).

Psychiatric Genetics (St. Clair, Muir, Evans). High density schizophrenic and
manic depressive families have been recruited in Scotland and all available
members interviewed and assessed clinically for major mental illness. We find
no evidence for linkage of a predisposing locus on chromosome 5 proposed by
others. We are therefore using available and previously mapped highly
polymorphic markers for inclusion and exclusion mapping, but certain regions of
the genome provide obvious focus. There are a number of candidate genes, for
example the dopamine D2 receptor, which will be examined for evidence of a
consistent mutation associated with major mental illness. In addition, we have
recently identified a family in which an autosomal translocation cosegregates
with schizophrenia. We will use our expertise in somatic cell genetics, in
situ hybridisation and YAC cloning to map and clone the breakpoint (with
Porteous, Arvelier, Gosden & van Heyningen). This work is supported in part by
the Wellcome Trust and the Leverhulme Trust.

Mouse genetics and development (Hill & Jackson). Mapping and sequencing the
human genome is not the end, but only the beginning of our efforts to
understand how genes control growth, development and homeostasis. The unique
opportunities for genetic and physiological experimentation strongly favour a
complementary study of the mouse. We have isolated a number of putative
developmental genes in the mouse from their sequence homology with known
homeotic genes in Drosophila. We have provided persuasive evidence for their
importance in determining body plan (Hill, Murphy & Davidson). These
approaches may provide useful insights into human dysmorphologies.

The genetic location of several developmental mutations is well established and
near cloned DNA markers. These we aim to exploit for the isolation of the
linked genes through long range mapping (PFGE) techniques and large DNA
fragment cloning technologies (YAC vectors) (Hill and others). In parallel,
candidate YAC clones for developmental mutations will be tested for function by
complementation, either by the direct transgenic route or by yeast spheroplast
fusion to mouse ES cells (Hill, Porteous, van Heyningen & Hastie).

We have determined the genomic organisation (more than 12 genes cloned and
mapped to a contiguous array extending over 250Kbp) and evolution (mutations at
the P1 site determine absolute specificity) of the serine protease inhibitor
gene family. Comparison of different sub-species of the mouse shows that for
the bulk of the protein, these genes are evolving at a normal rate, but that
there is accelerated evolution at the P1 site and surrounding amino acids,
possibly in response to new environmental factors, eg. viral infection (Hill,
Inglis & Hastie).

We are also studying the molecular genetics of pigmentation by examining a
number of alleles (including radiation induced deletions) of the brown locus
which encodes a tyrosine related protein. The aim is to construct a detailed
physical and genetic map of the locus which will serve as a model for other and
larger regions of the mouse and human genomes (Jackson, Johnson, in
collaboration with Rinchick, Oak Ridge National Laboratory).

Perhaps the most penetrating approach to understanding the function of genes is
to study the consequence of chosen mutations. Gene targeting by homologous
recombination provides a means for introducing precise mutations into cultured
mammalian cells (Dorin & Porteous). By targeting mouse embryonal stem (ES)
cells and reintroducing them into blastocytes, we can derive mutated germ line
chimeras for detailed study in vivo. A number of genes will be manipulated in
this way, including various Homeobox-containing genes isolated by us (with
Jones, Dorin & Sutherland), mouse homologues of the WAGR gene complex (with
Porteous, van Heyningen & Hastie) and the Cystic Fibrosis gene (Dorin,
Dickinson & Porteous). This work will be done in collaboration with the AFRC
CAGR (see below).

A variant on the gene targeting strategy is to use 'promotertrap' neo
constructs devoid of specific mammalian genome homology. Under these
conditions, almost all of the insertions are adjacent to CpG islands, thus
creating an insertion mutation as well as a probe for the flanking DNA. We aim
to develop this method to select for interesting mutations in the mouse and to
induce locus specific deletions after radiation or chemical mutagenesis
(Jackson & Macleod). A similar back selection approach will be taken to target
regions of the mouse orthologous with putative tumour suppressor regions in the
human (Hastie, Porteous & van Heyningen).

Chromosome Structure and Function

The relationship between chromosome banding and DNA sequence (Bickmore). How
does the distribution of dispersed repeated DNA sequences, of CpG islands and
genes, and of structural features such as replication origins and scaffold
attachment sites relate one to another and to the overall chromatin
organisation reflected in Giemsa banding? These questions are being approached
through detailed examination of the short arm of chromosome 11 for which we
have a considerable number of cloned DNA segments, a large number of chromosome
aberrations and a detailed long range restriction map. Allshire, Hastie &
Fantes described the introduction by spheroplast to cell fusion of 6Mbp of
S.pombe DNA into a mouse chromosome. The dramatic effects of this event on
chromosome topology and function may provide useful insight to these questions.

Telomeres and fragile sites (Allshire & Hastie). We first showed that the DNA
sequences which constitute mammalian telomeres are closely related to those of
previously cloned lower eukaryotes. Additionally, we showed that the same
sequences are present internally and may correspond to ancient sites of
chromosome fusion and to fragile sites. Our observations suggest a role for
telomere fusion in the development of neoplasia. The highly polymorphic nature
of both terminal and internal 'telomeres' can be exploited for genetic mapping
in the mouse and human.

A Mammalian Artificial Chromosome (Cooke). Our long term aim is to create a
mammalian artificial chromosome, or, given our geographical location, a 'MAC'.
So far, our attention has centred on a structural analysis of human telomeres
cloned in yeast and selected by complementation. Subterminal repeats are
shared between many human chromosomes and consist of a variable number of short
and long subrepeats. We are analysing mouse telomeres in an attempt to
understand the significance of these regions and to provide material for
manipulation in transgenic animals. We are now focusing on functional aspects
by constructing linear versions of vectors which replicate autonomously in
mammalian cells and by targeting telomeres to defined sites in the genome to
produce artificially shortened chromosomes as a test for function and for
mapping purposes.

Enabling Technologies

Somatic cell genetics. a) Immortalisation of blood lymphocytes or skin
fibroblasts for patients, establishing rodent fusion hybrids and selecting for
chromosome segregation by FACS analysis of cell surface expressed markers (van
Heyningen), b) tumour selection for single component hybrids on fusion of
tumorigenic human with non-tumorigenic rodent cells (Porteous & van Heyningen),
c) chromosome mediated gene transfer with endogenous selectable markers, eg.
activated oncogenes, or gene targeted exogenous markers, eg. neomycin
(Porteous & Dorin), d) X-irradiation fusion hybrids (van Heyningen & Sharkey),
d) targeted introduction of exogenous selectable markers (Dorin, Brookes,
Porteous & Wright), e) transfer of YAC clones to mammalian cells by spheroplast
fusion, electroporation, chromosome transfer or microinjection (Jones, van
Heyningen, Arvelier, Porteous & Hastie).

Flow cytometry for a) bulk sorting of specific human chromosomes, b) human
chromosome spot blotting and c) sorting of cells exhibiting specific gene
expression (Green, Fantes & van Heyningen).

Automated microscope image processor developed for detecting and scoring
aberrant human chromosomes (Rutowitz & Piper).

In situ hybridisation and confocal laser scanning microscopy for high
resolution mapping of fluorochrome labelled DNA probes; chromosome-specific
alphoid sequences for chromosome identification, chromosome painting with
X-irradiation fusion and CMGT hybrids, high resolution mapping of single and
multiple unique sequence probes, chromosome aberration and 'contig' mapping
with YAC recombinants (Perry, Fantes, Gosden & Porteous).

Computer controlled scanner and analysis package for analysis of DNA
restriction fragment, hybridisation and sequence data (Green).

Computer controlled pulse field gel electrophoresis (Maule & Green).

YAC technology. Size selected (+250kbp), partial digest libraries of human
chromosome 11 and the mouse genome, preparative YAC libraries of the WAGR locus
(Arvelier, Maule & Porteous); Alu-PCR, 'microgenome' PCR for human specific and
restriction site specific probes, inverse PCR for end-clones (Porteous &
Arvelier); gamma-irradiation of human chromosomes followed by end repair and
linker tailing to increase insert size and improve representation, independent
of restriction site distribution (Wright & Brown).

PCR Technology. Coincident cloning by PCR selective for heteroduplex
amplification (Brookes & Porteous); Alu-PCR for fingerprinting reduced
chromosome hybrids and YAC clones and isolation of human specific DNA fragments
form complex mixtures (Porteous); 'microgenome' PCR for representative or
selective amplification of limited DNA material (Porteous); multiplex
amplification of short tandem repetitive loci, eg. (CA)n repeats, for
efficient inclusion/exclusion linkage analysis, eg. in ophthalmological and
psychiatric disorders (Wright & Evans), and for identification of
microdeletions in tumour samples which might indicate the location of loci
important in tumour initiation or progression (Dunlop & Evans); amplification
from single sperm to assay for mutation rates and for haploid genome mapping
(Evans & Inglis).


2. Department of Medicine, Human Genetics Unit, Western General Hospital,
Edinburgh EH4 2XU. (Prof. David Brock)

a) Identifying susceptibility genes in diabetes and hypertension (post-doc
supported by Scottish Hospitals Endowment Research Trust, technician by
Ludovici Bequest).

b) Mapping familial susceptibility to preeclampsia (hormonally induced
hypertension in pregnancy associated with edema and proteinuria) (post-doc,
research assistant and technician, supported by the Wellcome Trust).

c) Improved diagnosis of cystic fibrosis through development and application of
PCR-based mutation detection (post-doc, supported by the Cystic Fibrosis
Research Trust).

d) Regional molecular diagnostics laboratory (post-doc, 2 research assistants,
1 MLSO, supported by the Scottish Home and Health Department).

3. Department of Genetics, King's Buildings, West Mains Road, EH9 3JQ.

Prof. Adrian Bird, on leave of absence from MRC HGU, returns from the
Institute for Molecular Pathology, Vienna to take up the Buchanan Chair in
1990. His group will continue studies on DNA methylation, methylation
sensitive DNA binding proteins, genome organisation and expression.

4. Department of Molecular Biology, King's Buildings, Mayfield Road, EH9 3JR.

a) Dr. David Leach: DNA libraries propagated in wild type and recA E.coli
hosts are not fully representative, as long palindromes and other non-random
sequences are not maintained. Having established that sbcC hosts permit the
propagation of such sequences, hosts with an improved potential for maintenance
of normally under- represented human DNA sequences are being developed
(post-doc, MRC supported).

b) Dr. David Melton: gene targeting of murine HGPRT by homologous
recombination in ES cells as a model for Lesch-Nyhan disease and of DNA repair
genes as a model for cancer susceptibility and carcinogen/mutagen testing.

c) Drs. John Collins and Andrew Coulson, Biocomputing Research Unit:
Development of rapid searching of DNA and protein databases using parallel
array processors, with special emphasis on local and global searches not just
for direct homology, but also for functional relationship through the
recognition of shared features and DNA/protein domains.

5. Department of Zoology, King's Buildings, West Mains Road, EH9 3JQ. Dr.
Peter Fantes

The main aim of the group is to understand the genetics of cell cycle control
in the fission yeast Schizosaccharomyces pombe. However, given the
similarities between S. pombe and mammalian cells in general aspects of genome
organisation and chromosome structure and function, the distinct advantages of
S.pombe for genetic analysis have suggested a number of approaches for
mammalian genome analysis. These include development of S.pombe strains for
cloning and manipulation of large DNA fragments of mammalian genomes and the
functional analysis of eukaryotic chromosomes by fusion of S.pombe spheroplasts
with cultured mammalian cells. (Supported by Cancer Research Campaign, in
collaboration with Dr. Nick Hastie and others, MRC HGU).

6. Imperial Cancer Research Fund, Laboratory of Molecular Pharmacology and
Drug Metabolism, Hugh Robson Building, George Square, EH9 9XD. Dr. C.R.
Wolf.

The major aims of this group are to understand the structure, function and
regulation of genes which protect normal and tumour cells from toxic, mutagenic
or carcinogenic effects of environmental chemicals and cancer chemotherapeutic
agents. A variety of projects involving the molecular genetics of genes
involved in these processes are currently in progress. Studies are focussing
on the cytochrome P450, glutathione transferase and the multidrug resistant P-
glycoprotein genes. These are all multigene families scattered through the
genome. The P450's for example are known to map to at least ten distinct
genome regions. One main aim is to obtain fine genetic maps of these gene loci
in man and mouse. Other studies are focussing on the gene function and
mechanisms of regulation by foreign compounds and hormones. These studies will
involve expression or deletion of genes in transgenic mice. We are also
studying whether genetic polymorphisms in these gene loci play a role in
susceptibility to diseases where environmental factors are known to play a
role. In addition to diseases such as cancer the group is also studying
whether such polymorphisms are a factor in determining germ cell mutation
frequency.

Several aspects of the work are being undertaken in close collaboration with
Dr. Nigel Spurr, ICRF, Clare Hall Laboratories, South Mimms.

7. Department of Pathology, Teviot Place, EH8 9AG. Prof. Colin Bird, Drs.
Andrew Wyllie & Martin Hooper.

The study of allele losses in sporadic colon carcinomas and familial
adenomatous polyposis coli is being used to define the position of the APC
susceptibility locus on a fine-structure map of chromosome band 5q21. Similar
studies are in progress to define other genes in which mutations and allele
losses are implicated in colon cancer (eg. on 17p and 18q).

Building on earlier success with HPRT, gene targeting by homologous
recombination in mouse embryonal stem cells is being used to develop mouse
models of human familial cancers, in particular retinoblastoma, APC and Wilms'
tumour.

(3 post-docs, supported by the Cancer Research Campaign).

In collaboration with: Prof. H.J. Evans & Drs. M. Steel and N. Hastie and
others, MRC HGU; Dr. A. Berns, Amsterdam; Dr. Y. Nakamura, Tokyo; Dr. J.
Jenkins, Oxted; Dr. B. Vogelstein, Baltimore.

8. AFRC Institute of Animal Physiology and Genetics Research, Roslin,
Midlothian, EH25 9PS. (Dir. Dr. G. Bullfield).

The Institute has an international reputation for transgenic research in
livestock, notably through the ectopic production of important biomolecules in
sheep milk. However, it also has a broad interest in quantitative genetics and
molecular genetics and their use to improve farm livestock. Current
comparative mapping studies of relevance to the human genome effort include:

a) Drs. C. Haley & A. Archibald: Mapping the Hal gene which controls
sensitivity to the anaesthetic halothane and stress susceptibility, thought to
be orthologous with the locus controlling malignant hypothermia in man.
Segregation analysis and RFLP mapping to detect major genes affecting
quantitative traits in farm animals (Supported by MAFF and AFRC-DES). A major
collaboration between 16 European laboratories (initiated on AFRC funding, but
seeking EC support) will attempt to construct a low resolution genetic and
physical map of the porcine genome, based on a cross between Chinese Meishan
and European Large Whites and initially using previously cloned and mapped
human sequences. The purpose of the map construction is to locate and
eventually clone genes controlling economically valuable quantitative trait
loci. (Current staffing: 3 research workers, increasing to 5).

b) Dr. J.L. Williams: the Institute runs a cattle blood typing service from
which tentative linkage to production traits has been established. It is
intended to extend this to a complete bovine mapping project by testing known
markers from other genomes and by the isolation of new VNTR markers from
cattle.

9. AFRC Centre for Animal Genome Research (CAGR), King's Buildings EH9 3JQ.
(Director Prof. R. Lathe; Associate Dir. Prof. J.O. Bishop; Assistant
Dirs. Drs. J. Ansell & M. Hooper; Associate Research Staff Drs. A.J.
Clark, D. Melton & N. Hastie).

The Centre is a joint venture between the University and the AFRC, established
under the government's Interdisciplinary Research Centre initiative and
focusing on transgenic animal biology. With a recurrent budget in excess of
#1.5M over the next 10 years and a core staff of 45 within 2 years, rising to
100 in the longer term, this is a major new initiative which has an important
role to play in translating the real aim of the human genome mapping initiative
which must be to understand gene function and dysfunction.

While the bulk of the Centre's activities will focus on 'traditional'
transgenic research, much of this will relate back to developmental
abnormalities and genetic disease in man, eg. rats transgenic for the human
renin gene as a model for hypertension, cell ablation studies using tissue
specific promoters hooked up to cell lethal toxins, and gene (ectopic)
expression/ ablation studies on homeobox genes and candidate tumour
suppressor/differentiation genes. Building on the work of Drs. Hooper and
Melton, the Centre intends to place special emphasis on mouse embryonal stem
(ES) cell research, which offers the unique opportunity to modify precisely the
germ line and thus model developmental and genetic abnormalities in vivo. This
will be achieved by exploiting methods developed at MRC HGU (Dorin et al.) and
elsewhere, for precise gene targeting by homologous recombination. Correctly
mutagenised ES cells (at eg. the cystic fibrosis, Wilms' tumour or a homeobox
gene) will be reintroduced into mouse blastocytes and germ line transmitting
chimeras identified for further analysis and experimentation. This aspect of
the CAGR programme will involve a significant imput from MRC HGU.

In conclusion, Edinburgh is perhaps uniquely placed in having local expertise
in the widest possible spectrum of research relating to the Human Genome
Mapping initiative. In this fertile atmosphere, Edinburgh in the 1990's is
certain to be an exciting and productive centre for human genome research.

10. Oligonucleotide Primers for PCR

Nigel K. Spurr
Imperial Cancer Research Fund
Clare Hall Laboratories
Blanche Lane
South Mimms, Potters Bar, Herts. EN6 3LD

Sue Povey
MRC Human Biochemical Genetics Unit
The Galton Laboratory
University College London
Wolfson House
4, Stephenson Way
London NW1 2HE

Introduction
The combination of oligonucleotide primers with PCR amplification of
DNA are now being used in all areas of molecular biology. However, there are a
number of variables in the conditions of use for the primers. Through the
Newsletter, we would like to pool information on the use of primers
particularly those of value in RFLP analysis and gene mapping. The aim is to
give enough information on the appropriate conditions of use particularly any
variations in nucleotide, magnesium or primer concentration which may affect
the optimal use of a set of primers. Some of the primers used are already
published but we have found it necessary to modify the conditions of use to
obtain the best results, and others are novel primers developed recently.

The information presented in this edition of the Newsletter comes from
Nigel Spurr and Sue Povey and is a pooling of our experiences with primers and
PCR. It is hoped to make this section a regular feature of the Newsletter and
any contributions should be sent to Nigel Spurr at ICRF Clare Hall for
inclusion in future editions.

Details of primers for RFLP analysis and gene mapping

Oligonucleotide Primers for PCR


Name (sequence identified):

YNZ22 (D17S5)


Primer Sequence: 1 5' - CGAAGAGTGAAGTGCACAGG - 3'


2 5' - CACAGTCTTTATTCTTCAGCG - 3'

Chromosomal location:

17p13.3


Conditions of use:

94oC 1 min 1mg DNA 10mM Triphosphates
55oC 1 min 300ng each primer
72oC 2 min 1.5mM Mg Total reaction volume
25-30 cycles of 100ml.

Detection system:

On 12% neutral acrylamide gels


Comments:

Primer concentration appears to be critical.


Use (eg. AS0, RFLP, gene mapping):

Hypervariable probe detecting numerous alleles in size range from 150bp
- 1,000 kbp. Heterozygosity of over 86%.


References:

Horn et al. Nucl. Acids Res. (1989) 17 2140.

Oligonucleotide Primers for PCR


Name (sequence identified):

p68

Primer Sequence: 1 5' - CAACAAGAGCGTGACTGGGTT - 3'


2 5' - ATCCTCTGAGGAGTTAGGGTA - 3'

Chromosomal location:

17q23-q25


Conditions of use:

15 seconds 92oC 500ng each primer
30 seconds 55oC 25 cycles 300mM Triphosphates
120 seconds 72oC (final conc.)
in total volume of
100ml

Detection system:

2% agarose


Comments:

Human specific band detected at approximately 1.5kb
Mouse specific band detected at approximately 1.55kb

Use (eg. AS0, RFLP, gene mapping):

Gene mapping, detects rodent sequences


References:

Iggo, R., Gough, A., Wu, X., Lane, D.P. and Spurr, N.K. (1989) Chromosome
mapping of the human gene encoding the 68kDa nuclear antigen (p68) by using the
polymerase chain reaction. Proc. Natl. Acad. Sci. USA., 86, 6211-6214.

Oligonucleotide Primers for PCR


Name (sequence identified):

AT3 (antithrombin III)

Primer Sequence: 1 5' AT3-L CCACAGGTGTAACATTGTGT -3'


2 5' AT3-R GAGATAGTGTGATCTGAGGC - 3'

Chromosomal location:

1q23-q25.1


Conditions of use:

1 minute 94oC 100pmol of each primer
1 minute 55oC 10mM Triphosphates
2 minute 72oC + 5 minute extension of last cycle
at 72oC in a total reaction volume
25-30 cycles of 100ml

Detection system:

8% neutral polyacrylamide gel


Comments:

Detects two bands at 496bp
572bp

Use (eg. AS0, RFLP, gene mapping):

Gene mapping and RFLP analysis (5' length polymorphism)
Frequency of polymorphisms 0.25 (496bp) and 0.75 (572bp)

References:

Wu, S., Seino, S. and Bell, G.I. (1989) Human antithrombin III (AT3) gene
length polymorphism revealed by the polymerase chain reaction. Nucl. Acids
Res., 17, 6433.


Oligonucleotide Primers for PCR

Name (sequence identified):

APOA2 (Mfd3)

Primer Sequence: 1 5' - GGTCTGGAAGTACTGAGAAA - 3'


2 5' - GATTCACTGCTGTGGACCCA - 3'

Chromosomal location:

1q21-23

Conditions of use:

1 minute 94oC 600ng each primer
1 minute 50oC 20ul 10mM triphosphates
2 minute 72oC 10ul DMSO
10ul buffer (1.5mM Mg++)
20-30 cycles Total reaction volume of
100ml

Detection system:

20% polyacrylamide gel (20-30 cycles of amplification)


Comments:


Use (eg. AS0, RFLP, gene mapping):

RFLP analysis, detects multiple alleles at least 6 described at a
heterozygosity of 74%.


References:

Weber, J.L. and May, P.E. (1989) Abundant class of human DNA polymorphisms
which can be typed using the polymerase chain reaction. Am. J. Hum. Genet.,
44, 388-396.


Oligonucleotide Primers for PCR


Name (sequence identified):

C9 (complement component 9)

Primer Sequence: 1 5' - TAGATACATTGAGTCTCTCCTGATT - 3'


2 5' - CAGTCTATCACAATGAGAGAGATGG - 3'


Chromosomal location:

5p14-p12


Conditions of use:

30 seconds at 90oC 15mM Triphosphates
30 seconds at 55oC 50pmol each primer
30 seconds at 70oC in a total reaction volume of
20-30 cycles 100ml

Detection system:

2% agarose gel

Comments:

Detects a 255bp fragment. Human specific no cross hybridisation to
rodent sequences.


Use (eg. AS0, RFLP, gene mapping):

Suitable for gene mapping, analysing somatic cell hybrids for presence
of chromosome 5


References:

Abbott, C., West, L., Povey, S., Jeremiah, S., Murad, Z., Discipin, R. and
Fey, G. (1989) The gene for human complement component C9 mapped to chromosome
5 by polymerase chain reaction. Genomics 4, 606-609.

Oligonucleotide Primers for PCR


Name (sequence identified):

PGAM2 (phosphoglycerate mutase 2 (muscle) )

Primer Sequence: 1 5' - GGTCCTAGACTCAACTCCGTGCCAC - 3'


2 5' - TCTGGCCTTGTGGAAGGTACCAGGC - 3'

Chromosomal location:

7p13-p12


Conditions of use:

30 seconds at 90oC 15mM Triphosphates
30 seconds at 55oC 50pmol each primer
30 seconds at 70oC in a total reaction volume of
20-30 cycles 100ml


Detection system:

2% agarose gel


Comments:

Detects a ****bp fragment. Human specific no cross hybridisation to
rodent sequences.


Use (eg. AS0, RFLP, gene mapping):

Suitable for gene mapping, analysing somatic cell hybrids for presence
of chromosome 7

References:

Edwards, Y., Saburo, S., Schon, E. and Povey, S. (1989) The gene for human
muscle-specific phosphoglycerate mutase PGAM2, mapped to chromosome 7 by PCR.
Genomics 5, 948-951.

Oligonucleotide Primers for PCR

Name (sequence identified):

ALDOB (Aldolase B)

Primer Sequence: 1 5' - GTTGTTATATGATGAGACTG - 3'


2 5' - GAGCCACCCATGGTTCTGTG - 3'


Chromosomal location:

9q21.3-q22.2


Conditions of use:

30 seconds at 90oC 15mM Triphosphates
30 seconds at 55oC 50pmol each primer
30 seconds at 70oC in a total reaction volume of
20-30 cycles 100ml

Detection system:

2% agarose gel

Comments:

Detects a 201bp fragment. Human specific no cross hybridisation to
rodent sequences.


Use (eg. AS0, RFLP, gene mapping):

Suitable for gene mapping, analysing somatic cell hybrids for presence
of chromosome 9

References:

Cross, N., Tolan, D. and Cox, T.M. (1988) Catalytic deficiency of human
aldolase B in hereditary fructose intolerance caused by a common missense
mutation. Cell 53, 881-885.


Oligonucleotide Primers for PCR


Name (sequence identified):

P1 (a1 antitrypsin)

Primer Sequence: 1 5' - CTGGTGATGCCCACCTTCCCCTCTC - 3'


2 5' - GTCACCCTCAGGTTGGGGAATCACC - 3'

Chromosomal location:

14q32.1


Conditions of use:

30 seconds at 90oC 15mM Triphosphates
30 seconds at 55oC 50pmol each primer
30 seconds at 70oC in a total reaction volume of
20-30 cycles 100ml

Detection system:

2% agarose gel


Comments:

Detects a 325bp fragment. Human specific no cross hybridisation to
rodent sequences.

Use (eg. AS0, RFLP, gene mapping):

Suitable for gene mapping, analysing somatic cell hybrids for presence
of chromosome 14

References:

Abbott, C., Povey, S., Vivian, N. and Lovell-Badge, R. (1988) PCR as a rapid
screening method for transgenic mice. Trends in Genet. 4, 325.


APPENDIX

Committee Chairs and Co-chairs of HGMWorkshops 10.5 and 11

Dr Gail A Bruns Chrom./Comm.: 1 [Chair]
Address: Children's Hospital Medical Center, Department of Clinical Genetics,
300 Longwood Avenue, Boston MA 02115, USA
Tel:(1-617) 735-7575 Fax: (1-617) 735-7588

Dr Nicholas C Dracopoli Chrom./Comm.: 1 [Co-Chair]
Address: Massachussetts Institute of Technology, Center for Cancer Research
E17-536, 77 Massachusetts Avenue, Cambridge MA 02139, USA
Tel:(1-617) 253-3020 Fax: (1-617) 253-8000

Dr Ray White Chrom./Comm.: 2 [Chair]
Address: Howard Hughes Medical Institute, University of Utah School of
Medicine, 603 Wintrobe Building, Salt Lake City UT 84132, USA
Tel:(1-801) 581-4330 Fax: (1-801) 581-7796

Dr Nigel K. Spurr Chrom./Comm.: 2 [Co-Chair]
Address: Imperial Cancer Research Fund, Clare Hall Laboratories, Blanche Lane,
South Mimms, Potters Bar, Hertfordshire EN6 3LD, United Kingdom
Tel:(44-707) 44444 Fax: (44-707) 46332

Dr Sue Naylor Chrom./Comm.: 3 [Chair]
Address: The University of Texas , Health Science Center at San Antonio,
Department of Cellular and Structural Biology, 7703 Floyd Curl Drive, San
Antonio TX 78284, USA
Tel:(1-512) 567-3842 Fax: (1-512) 567-6781

Dr Ben Carritt Chrom./Comm.: 3 [Co-Chair]
Address: MRC Human Biochemical Genetics Unit, University College London, 4
Stephenson Way, London NW1 2HE, United Kingdom
Tel:(44-1) 387-7050 x 5051 Fax: (44-1) 387-3496

Dr Jeffrey C Murray Chrom./Comm.: 4 [Chair]
Address: University of Iowa, Department of Pediatrics, Division of Medical
Genetics, Iowa City , IA 52242, USA
Tel:(1-319) 356-3508 Fax: (1-319) 335-0008

Dr G J B Van Ommen Chrom./Comm.: 4 [Co-Chair]
Address: Sylvius Laboratories, University of Leiden, Department of Human
Genetics, PO Box 9503, NL-2300 RA Leiden, The Netherlands
Tel:(31-71) 276-065/276-000 Fax: (31-71) 276-075

Dr John J Wasmuth Chrom./Comm.: 5 [Chair]
Address: University of California at Irvine, California College of Medicine,
Department of Biological Chemistry, Irvine , CA 92717, USA
Tel:(1-714) 856-6792/7067 Fax:

Dr D Timothy Bishop Chrom./Comm.: 5 [Co-Chair]
Address: Genetic Epidemiology Laboratory, Imperial Cancer Research Fund, 3K
Springfield House, Hyde Terrace, Leeds LS2 9JU, United Kingdom
Tel:(44-532) 423-617 Fax: (44-532) 340-183

Dr Andreas Ziegler Chrom./Comm.: 6 [Chair]
Address: Institute for Experimental Oncology and Transplantation Medicine,
Universit
130, D-1000 Berlin 19, Federal Republic of Germany
Tel:(49-30) 303-54-86/303-52-617 Fax: (49-30) 30-35-29-00

Dr Alan Sakaguchi Chrom./Comm.: 6 [Co-Chair]
Address: Dept of Cellular and Structural Biology, Univ. of Texas Health
Sciences Center, 7703 Floyd Curl Drive, San Antonio, Texas 78284-7762, USA
Tel:(1-512) 567-3857 Fax: (1-512) 567-6781


Dr Lap-Chee Tsui Chrom./Comm.: 7 [Chair]
Address: Hospital for Sick Children, University of Toronto, 555 University
Avenue, Toronto, Ontario , Canada M5G 1X8
Tel:(1-416) 598-6015 Fax: (1-416) 598-7505

Dr Martin Farrall Chrom./Comm.: 7 [Co-Chair]
Address: Clinical Research Centre, Division of Molecular Medicine, Watford
Road, Harrow, Middx HA1 3UJ, United Kingdom
Tel:(44-1) 869-3244 Fax: (44-1) 423-1275

Dr Helen R Donis-Keller Chrom./Comm.: 8 [Chair]
Address: Washington Univ. Sch. of Medicine, Center for Genetics in Medicine,
Human Genetics Linkage Lab, Box 8232 660 S. Euclid, St Louis MO 63110, USA
Tel:(1-314) 362-8629 Fax: (1-314) 362-8630

Dr Veronica J Buckle Chrom./Comm.: 8 [Co-Chair]
Address: Institute of Molecular Medicine, John Radcliffe Hospital, Headington,
Oxford OXE 9DU, United Kingdom
Tel:(44-865) 752-391 Fax: (44-865) 752-500

Dr Moyra Smith Chrom./Comm.: 9 [Chair]
Address: University of California at Irvine, Department of Pediatrics/Human
Genetics, Medical Sciences I. C-234, Irvine CA 92717, USA
Tel:(1-714) 856-6684 Fax: (1-714) 725-2089

Dr Catherine T Falk Chrom./Comm.: 9 [Co-Chair]
Address: The New York Blood Center, 310 East 67th Street, New York NY10021, USA
Tel:(1-212) 570-3234 Fax: (1-212) 581-7880

Dr Nancy E Simpson Chrom./Comm.: 10 [Chair]
Address: Queen's University, Department of Pediatrics, Kingston, Ontario,
Canada K7L 3N6
Tel:(1-613) 545-6310 Fax: (1-613) 545-6617

Dr Howard Cann Chrom./Comm.: 10 [Co-Chair]
Address: Centre d'Etude du Polymorphisme Humain (CEPH), 27 rue Juliette Dodu,
F-75010 Paris, France
Tel:(33-1) 42-49-98-62 Fax: (33-1) 40-18-01-55

Dr Claudine Junien Chrom./Comm.: 11 [Chair]
Address: INSERM U73, Unite de Recherches de Biologie Prenatale, Chateau de
Longchamp, Bois de Boulogne, F-75016 Paris, France
Tel:(33-1) 42-24-13-57 Fax: (33-1) 46-47-95-01

Dr Veronica Van Heyningen Chrom./Comm.: 11 [Co-Chair]
Address: MRC Human Genetics Unit, Western General Hospital, Crewe Road,
Edinburgh EH4 2XU, United Kingdom
Tel:(44-31) 332-2471 x 3307 Fax: (44-31) 343-2620

Dr Ian W Craig Chrom./Comm.: 12 [Chair]
Address: University of Oxford, Genetics Laboratory, South Parks Road, Oxford
OX1 3QU, United Kingdom
Tel:(44-865) 275327 Fax: (44-865) 275215

Dr O W McBride Chrom./Comm.: 12 [Co-Chair]
Address: National Cancer Institute, Laboratory of Biochemistry, Building 37,
Room 40 - 06, Bethesda MD 20205, USA
Tel:(1-301) 496-5520 Fax:

Dr Anne M Bowcock Chrom./Comm.: 13 [Chair]
Address: Stanford University School of Medicine, Department of Genetics,
Stanford CA 94305, USA
Tel:(1-415) 723-3575 Fax: (1-415) 725-1534

Dr R T Taggart Chrom./Comm.: 13 [Co-Chair]
Address: Wayne State University Medical School, Department of Molecular Biology
and Genetics, 3216 Scott Hall, 540 East Canfield, Detroit MI 48201, USA
Tel:(1-313) 577-5753 Fax: (1-313) 577 5218

Dr Diane W Cox Chrom./Comm.: 14 [Chair]
Address: The Hospital for Sick Children, 555 University Avenue, Toronto,
Ontario, Canada M5G 1X8
Tel:(1-416) 598-6384 Fax: (1-416) 598-6897

Dr Yusuke Nakamura Chrom./Comm.: 14 [Co-Chair]
Address: Japanese Foundation for Cancer Research, Kami-Ikebukro, Toshima-ku ,
Tokyo 170, Japan
Tel:(81-3) 918-0342 Fax: (81-3) 918-0167

Dr Timothy A Donlon Chrom./Comm.: 15 [Chair]
Address: Stanford University Hospital, Molecular and Clinical Cytogenetics Unit
H1517, Stanford CA 94305, USA
Tel:(1-415) 723-4923 Fax: (1-415) 723-6902

Dr Susan Malcolm Chrom./Comm.: 15 [Co-Chair]
Address: Institute of Child Health, Mothercare Department of Paediatric
Genetics, 30 Guilford Street, London WC1 N1EH, United Kingdom
Tel:(44-1) 242-9789 x 2221 Fax: (44-1) 831-0488

Dr Stephen Reeders Chrom./Comm.: 16 [Chair]
Address: Yale University School of Medicine, Department of Nephrology, 333
Cedar Street 2073 LMP, P.O.Box 3333, New Haven CT 06510-0856, USA
Tel:(1-203) 785-6737 Fax: (1-203) 624-0920

Dr C Edgar Hildebrand Chrom./Comm.: 16 [Co-Chair]
Address: Los Alamos National Library, Genetics Group M886, Los Alamos NM 87545,
USA
Tel:(1-505) 667-2746 Fax:

Dr Grant R Sutherland Chrom./Comm.: 16 [Co-Chair]
Address: Adelaide Children's Hospital, Department of Histopathology,
Cytogenetics Unit, 72 King William Road, North Adelaide, South Australia 5006,
Australia
Tel:(61-8) 267-7284 wrk/ 272-5218 home Fax: (61-8) 267-7342

Dr Ellen Solomon Chrom./Comm.: 17 [Chair]
Address: Somatic Cell Genetics Lab, Imperial Cancer Research Fund Lab, PO Box
123, Lincoln's Inn Fields, London WC2A 3PX, United Kingdom
Tel:(44-1) 269-3332
426 Fax: (44-1) 269-3469

Dr David H Ledbetter Chrom./Comm.: 17 [Co-Chair]
Address: Baylor College of Medicine, Institute for Molecular Genetics, One
Baylor Plaza, Houston TX 77030, USA
Tel:(1-713) 798-6511 Fax: (1-713) 798-6521

Dr Michelle Le Beau Chrom./Comm.: 18 [Chair]
Address: University of Chicago, Department of Medicine, Joint Section of
Hematology/Oncology, 5841 S.Maryland Avenue Box 420, Chicago IL 60637, USA
Tel:(1-312) 702-0795 Fax: (1-312) 702-3163

Dr A H M Geurts Van Kessel Chrom./Comm.: 18 [Co-Chair]
Address: Clinical Genetics Center Nijmegen, University Hospital Nijmegen, PO
Box 9101, NL-6500 HB Nijmegen, The Netherlands
Tel:(31-80) 51-41-07 Fax: (31-80) 54-05-76

Dr Hans-Hilger Ropers Chrom./Comm.: 19 [Chair]
Address: Katholieke Universiteit, Anthropogenetisch Instituut, Geert
Grooteplein Zuid 20, NL-6525 GA Nijmegen, The Netherlands
Tel:(31-80) 51-40-17 Fax: (31-80) 54-05-76

Dr Margaret A Pericak-Vance Chrom./Comm.: 19 [Co-Chair]
Address: Duke University Medical Center, Division of Neurology, PO Box 2900,
Research Park Building #1 Room 103, Durham NC 27710, USA
Tel:(1-919) 684-3422 Fax: (1-919) 684-6514


Dr Karl-Heinz Grzeschik Chrom./Comm.: 20 [Chair]
Address: Institut fur Humangenetik, Banhnhofstrasse 7A, D-3550 Marburg, Federal
Republic of Germany
Tel:(49-6421) 28-40-80 Fax: (49-6421) 5630

Dr Mark Skolnick Chrom./Comm.: 20 [Co-Chair]
Address: Room 105, 410 Chipeta Way, Salt Lake City , Utah 84108, USA
Tel:(1-801) 581-5070 Fax: (1-801) 581-6052

Dr David R Cox Chrom./Comm.: 21 [Chair]
Address: Univ. of California at San Francisco, Department of
Pediatrics/Psychiatry & Biochemistry, Box 0106, San Francisco CA 94143, USA
Tel:(1-415) 476-4212 Fax: (1-415) 476-8001

Dr Nobuyoshi Shimizu Chrom./Comm.: 21 [Co-Chair]
Address: Keio University School of Medicine, 35 Shinanomachi, Shinjuku-ku,
Tokyo 160, Japan
Tel:(81-3) 351-2370 Fax: (81-3) 351-2370 (?)

Dr Beverly S Emanuel Chrom./Comm.: 22 [Chair]
Address: The Children's Hospital of Philadelphia, Department of Pediatrics and
Human Genetics, 34th Street and Civic Center Boulevard, Philadelphia PA 19104,
USA
Tel:(1-215) 590-3855 Fax: (1-215) 590-3850

Dr Bernd Seizinger Chrom./Comm.: 22 [Co-Chair]
Address: Massachussetts General Hospital, Neurogenetics Unit, Boston MA 02114,
USA
Tel:(1-617) 726-5510 Fax: (1-617) 726-5079

Dr Kay E Davies Chrom./Comm.: X [Chair]
Address: John Radcliffe Hospital, Institute of Molecular Medicine, Molecular
Genetics Unit, Headington, Oxford OX3 9DU, United Kingdom
Tel:(44-865) 75-24-03 Fax: (44-865) 75-25-00

Dr Huntington F Willard Chrom./Comm.: X [Co-Chair]
Address: Department of Genetics, Stanford University School of Medicine,
Stanford CA 94305, USA
Tel:(1-415) 725-8818 Fax: (1-415) 725-1534

Dr Jean-Louis Mandel Chrom./Comm.: X [Co-Chair]
Address: Laboratoire de Genetique Moleculaire des Eucaryotes, INSERM Unite 184,
Universite Louis Pasteur, 11 rue Humann , F-67085 Strasbourg Cedex, France
Tel:(33) 88-37-12-55 Fax: (33) 88-37-01-48

Dr Robert L Nussbaum Chrom./Comm.: X [Co-Chair]
Address: University of Pennsylvania Medical School, Howard Hughes Medical
Institute, Department of Human Genetics, 37th and Hamilton Walk, Philadelphia
PA 19104-6072, USA
Tel:(1-215) 898-1012 Fax: (1-215) 898-2671

Dr Tony Monaco Chrom./Comm.: X [Co-Chair]
Address: Imperial Cancer Research Fund, PO Box 123, Lincoln's Inn Fields,
London WC2A 3PX, United Kingdom
Tel:(44-1) 269-3300 Fax: (44-1) 405-1556

Dr Jean Weissenbach Chrom./Comm.: Y [Chair]
Address: Unite de Recombinaison et Expression Genetique, Institut Pasteur, 28
rue du Docteur Roux, F-75724 Paris Cedex 15, France
Tel:(33-1) 45-68-88-50 Fax: (33-1) 45-68-87-90

Dr Peter Goodfellow Chrom./Comm.: Y [Co-Chair]
Address: Imperial Cancer Research Fund, PO Box 123, Lincoln's Inn Fields,
London WC2A 3PX, United Kingdom
Tel:(44-1) 269-3484 Fax: (44-1) 269-3469

Dr Douglas C Wallace Chrom./Comm.: Mitochondrial DNA [Chair]
Address: Department of Biochemistry, 109 Woodruff Memorial Building, 1639
Pierce Drive, Emory University School of Medicine, Atlanta GA 30322, USA
Tel:(1-404) 727-5624 Fax: (1-404) 727-2738(emory)/831-6265

Dr Jean Frezal Chrom./Comm.: Clinical Disorders and
Chromosomal Abnormalities [Chair]
Address: Hopital des Enfants Malades, Clinique de Genetique Medicale, 149 rue
de Sevres, F-75743 Paris Cedex 15, France
Tel:(33-1) 45-67-30-88 Fax: (33-1) 42-73-81-80

Dr Albert Schinzel Chrom./Comm.: Clinical Disorders and
Chromosomal Abnormalities [Co-Chair]
Address: Institut fur Medizinische Genetik, Raemistrasse 74, CH-8001 Zurich,
Switzerland
Tel:(41-1) 257-2521 Fax: (41-1) 257-2304

Dr Felix Mitelman Chrom./Comm.: Neoplasia &
Re-Arrangements [Chair]
Address: University Hospital, Department of Clinical Genetics, S-221 85 Lund,
Sweden
Tel:(46-46) 17-33-60 Fax: (46-46) 13-10-61

Dr Jeffrey M. Trent Chrom./Comm.: Neoplasia &
Re-Arrangements [Co-Chair]
Address: University of Arizona, Arizona Cancer Center, 1515 N. Campbell, Room
3945, Tucson AZ 85724, USA
Tel:(1-602) 626-6408 Fax: (1-602) 626-4848/626-2284 (backup)

Dr Yasuhiko Kaneko Chrom./Comm.: Neoplasia &
Re-Arrangements [Co-Chair]
Address: Department of Laboratory Medicine, Saitama Cancer Center, 818 Komuro,
Ina Saitama 362, Japan
Tel:(81-48) 722-1111 Fax: (81-48) 722-1739

Dr Muriel T Davisson Chrom./Comm.: Comparative Mapping
(Mouse) [Chair]
Address: The Jackson Laboratory, 600 Main Street, Bar Harbor ME 04609-0800, USA
Tel:(1-207) 288-3371 x 340 Fax: (1-207) 288-5079

Dr Peter A Lalley Chrom./Comm.: Comparative Mapping
(Mouse) [Co-Chair]
Address: Wayne State University, Center for Molecular Biology, Gordon Scott
Hall 1201, 540 East Canfield, Detroit M1 48201, USA
Tel:(1-313) 577-0025 Fax: (1-313) 577-5218

Dr Josephine Peters Chrom./Comm.: Comparative Mapping
(Mouse) [Co-Chair]
Address: MRC Radiology Unit, Chilton, Didcot, Oxon OX11 ORD, United Kingdom
Tel:(44-235) 834-393 Fax: (44-235) 834-918

Dr Stephen J O'Brien Chrom./Comm.: Comparative Mapping
(Non-Mouse) [Chair]
Address: National Cancer Institute, Laboratory of Viral Carcinogenesis,
Building 560 Room 21 - 105, Frederick MD 21701-1013, USA
Tel:(1-301) 698-1296 Fax: (1-301) 698-1686

Dr Jennifer A M Graves Chrom./Comm.: Comparative Mapping
(Non-Mouse) [Co-Chair]
Address: La Trobe University, Department of Genetics, Bundoora, Victoria 3083,
Australia
Tel:(61-3) 479-2589 Fax: (61-3) 478-5814

Dr Bronya J B Keats Chrom./Comm.: Linkage & Gene Order
[Chair]
Address: Louisiana State University Medical Center, Department of Biometry and
Genetics, 1901 Perdido Street, New Orleans LA 70112, USA
Tel:(1-504) 568-8088 Fax: (1-504) 568-2026

Dr Stephanie Lee Sherman Chrom./Comm.: Linkage & Gene Order
[Co-Chair]
Address: Emory University, Division of Medical Genetics, Department of
Pediatrics, 200 Ridgewood Drive N.E., Atlanta GA 30322, USA
Tel:(1-404) 727-5862 Fax:

Dr Jurg Ott Chrom./Comm.: Linkage & Gene Order
[Co-Chair]
Address: Columbia University, Department of Psychiatry, Box 58, 722 West 168th
St, New York NY 10032, USA
Tel:(1-212) 960-2504 Fax: (1-212) 568-2750 or 960-5624

Dr Phyllis J McAlpine Chrom./Comm.: Nomenclature [Chair]
Address: University of Manitoba, Department of Human Genetics, T250 - 770
Bannatyne Avenue, Winnipeg Manitoba, Canada R3E OW3
Tel:(1-204) 788-6227 Fax: (1-204) 786-8712

Dr Thomas B Shows Chrom./Comm.: Nomenclature [Co-Chair]
Address: Roswell Park Memorial Institute, Department of Human Genetics, 666 Elm
Street, Buffalo NY 14263, USA
Tel:(1-716) 845-3108 Fax: (1-716) 845-8449

Professor Bob Williamson Chrom./Comm.: DNA [Chair]
Address: Department of Biochemistry & Molecular Genetics, St Mary's Hospital
Medical School, Norfolk Place, London W2 1PD, United Kingdom
Tel:(44-1) 723 1252 x 5499 Fax: (44-1) 706 3272

Dr Kenneth K Kidd Chrom./Comm.: DNA [Co-Chair]
Address: Yale University School of Medicine, Department of Human Genetics, 333
Cedar Street, New Haven CT 06510, USA
Tel:(1-203) 786-5515 Fax: (1-203) 786-5534

Professor Peter L Pearson Chrom./Comm.: DNA [Co-Chair]
Address: Welch Medical Library, 3rd Floor, Johns Hopkins University, 1830 East
Monument Street, Baltimore MD 21205, USA
Tel:(1-301) 955-9705 Fax: (1-301) 955-0054

Dr Jorg Schmidtke Chrom./Comm.: DNA [Co-Chair]
Address: Freie Universit
D-1000 Berlin 19, Federal Republic of Germany
Tel:(49-30) 32-03-37 x 312 Fax: (49-30) 3035-2900

Dr Chris Rawlings Chrom./Comm.: Informatics
[Chair]
Address: Imperial Cancer Research Fund, PO Box 123, Lincoln's Inn Fields,
London WC2A 3PX, United Kingdom
Tel:(44-1) 269-3639 Fax: (44-1) 831-6265

Mr Richard Lucier Chrom./Comm.: Informatics
[Co-Chair]
Address: The William H.Welch Medical Library, The Johns Hopkins University,
1830 E Monument Street, Room 3015, Baltimore, Maryland 21205, USA
Tel:(1-301) 955-9705 or 955-3411/3412 Fax: (1-301) 955-0054 (pte); 955-8020

0 new messages