Using sequtils.Stitch

[aboffin]

Hi,

I am trying to use the Stitch function from sequtils following the example given in: biogo/seq/sequtils/example_test.go:

func ExampleStitch() {

        s := stringToConformRangeOffSlice("aAGTATAAgtcagtgcagtgtctggcagTGCTCGTGCgtagtgaagtagGGTTAGTTTa")
        f := fs{
                fe{s: 1, e: 8},
                fe{s: 28, e: 37},
                fe{s: 49, e: len(s.slice) - 1},
        }
        fmt.Printf("%s\n", s)
        if err := Stitch(s, s, f); err == nil {
                fmt.Printf("%s\n", s)
        }
        // Output:
        // aAGTATAAgtcagtgcagtgtctggcagTGCTCGTGCgtagtgaagtagGGTTAGTTTa
        // AGTATAATGCTCGTGCGGTTAGTTT
}

I am unable to determine how to assign the Start and End positions of the sequence. I tried reading seq/sequtils/utils.go and feat/feature.go, but it is unclear how to use feat.Set

Thanks in advance for any pointers and clue sticks.

Sincerely,
Senthil

[Dan Kortschak]

fs is defined here[1] and fe is defined here[2], so you need to define
types like them that satisfy feat.Feature[3] and feat.Set[4]. Note that
feat.Set is just a value that can return a set of feature with its
Features method.

The start and end are set in the provided sequence types by the
SetOffset method (or via the .Annotation.Offset field directly if you
have a concrete type). This specifies the start and the end is then
calculated based on the start and the length of the sequence.


[1]https://github.com/biogo/biogo/blob/master/seq/sequtils/utils_test.go#L187-L189
[2]https://github.com/biogo/biogo/blob/master/seq/sequtils/utils_test.go#L176-L185
[3]https://godoc.org/github.com/biogo/biogo/feat#Feature
[4]https://godoc.org/github.com/biogo/biogo/feat#Set

[aboffin]

Thank you Dan, I had overlooked the definitions of fs and fe! I am able to use Stitch with my test data now.

Senthil