Re: Steroids produced in/by the skin as a cause of inflammatory and autoimmune diseases

[JRStern]

On Sun, 24 Mar 2013 17:30:58 -0400, Susan <su...@nothanks.org> wrote:

>x-no-archive: yes
>
>Another interesting one:
>
>
>
>
>Am J Physiol Endocrinol Metab. 2011 September; 301(3): E484�E493.
>Published online 2011 June 14. doi: 10.1152/ajpendo.00217.2011
>PMCID: PMC3174533
>Cutaneous hypothalamic-pituitary-adrenal axis homolog: regulation by
>ultraviolet radiation
>Cezary Skobowiat,1,5 John C. Dowdy,2 Robert M. Sayre,3 Robert C.
>Tuckey,4 and Andrzej Slominski1
>Departments of 1Pathology and Laboratory Medicine and
>2Dermatology, University of Tennessee, Health Science Center, Memphis;
>3Rapid Precision Testing Laboratories, Cordova, Tennessee;
>4School of Biomedical, Biomolecular and Chemical Sciences, University of
>Western Australia, Crawley, Australia; and
>5Department of Clinical Physiology, University of Warmia and Mazury,
>Olsztyn, Poland
>Corresponding author.
>Address for reprint requests and other correspondence: A. Slominski,
>Dept. of Pathology and Laboratory Medicine, Univ. of Tennessee Health
>Science Center, 930 Madison Ave. Rm. 525, Memphis, TN 38163 (e-mail:
>aslo...@uthsc.edu).
>Received May 4, 2011; Accepted June 7, 2011.
>Copyright � 2011 the American Physiological Society
...

OMG, American Idol must be *seriously* boring this year!

:)

Kind of a long-winded article, if it's going to apply to psoriasis
you'd think they could just take a few skin samples and test for the
presence of suspected steroids.

J.

[Bohgosity BumaskiL]

Regarding a whole article posted by Susan, in which I quote from the
abstract:

"Furthermore the production of glucocorticoids is affected by
ultraviolet B radiation."

On 2013-03-24 6:30 PM, JRStern wrote:
(...)

> Kind of a long-winded article, if it's going to apply to psoriasis
> you'd think they could just take a few skin samples and test for the
> presence of suspected steroids.
>
> J.
>

Sometimes people miss the point when it iz not the last and first
sentence of an abstract. I gather from the article that UVC (which
iz used for killing bacteria in water) iz not necessary to jenerate
natural steroidal anti-inflammatories. UVA duz _not_ activate all of
that cortizone-like machinery. So, UVB iz the way to go when it
comes to lightbox therapy.

"Furthermore, local activity of CYP11A1 can produce novel
7Δ-steroids and secosteroids that are biologically active."

Novel iz not the right word when it comes to endojenous compounds.
It means that Vitamin D might not be the only anti-inflammatory that
sunlight and lightbox therapy are capable of jenerating.

[Bohgosity BumaskiL]

http://www.ncbi.nlm.nih.gov/pubmed/23435015

[randall]

On Mar 24, 2:18 pm, Susan <su...@nothanks.org> wrote:
> x-no-archive: yes

<snip>

Susan,

BAD, bad me said on LAST SIGN OFF:

"randall... it ONLY get's BETTER and BETTER... except for Susan and
hpa-
axis. LOL "

Do i now have to TAKE it back?

see
Tues, Mar 12 2013 5:51 pm
Subject: Vitiligo & HSP70i --> Evetsm ->15 Years AGO --QKRAA or QRAA
with HSP70 -- Salty MEAT & Paleodiet Questions -->Iodine? --Sodium &
Potassium PUMP --Mapk (Consequence)- Orange not RED? TCM meds! - Susan
and JXR hpa-axis?
https://groups.google.com/group/alt.support.skin-diseases.psoriasis/browse_thread/thread/eb11d8e0d9555994/0de69b9ae75f5936?hl=en#0de69b9ae75f5936


I'm so BAD!

Poooor randall he CAn't HELLLLPpPpP IT.. HE WAS born with a marxist
spoon in his..

shut your mouth... LoL


Hey! i was thinking LOWER....

Madamina, il catalogo e questo - Ferruccio Furlanetto
https://www.youtube.com/watch?v=mkjzTtz-lZQ
<5:52>

I know obama blames those who are LOWER to HIM.. LOL

But on Easter.. we should LOVE and get along?

I should try to go see him?

http://www.concertonet.com/scripts/edito.php?ID_edito=214
Ferruccio Furlanetto and Murder in the Cathedral


OK...while i lick my wounds of current trials...& someone has to do
them for causation SAKES btw. :)


It's a good thing you keep us on a ""cutaneous HPA axis" when not on
the OLD stand by.

What ELSE would we do on spring break besides bathe in uvb's?

Sorta nose to the grindSTONE while tanning Flesh in a bacchanalian
fest sans wine and the AGE of BEER & Tequila shooter's... LOL.

Forget under the bough...it's how many hookuP's with thou's on the
BEACH.

Not your grand FOLKs beach: MIND YOU...

On the Beach - Gregory Peck e Ava Gardner (1959)
http://www.youtube.com/watch?v=FRf-g9aSdfU
<8:08>

59 was a time to be ERNEST:
http://en.wikipedia.org/wiki/Ava_Gardner#Relationships

An epigenetic smoking downFALL. & we ALL FALL down!

http://en.wikipedia.org/wiki/Ring_a_Ring_o'_Roses

OK doth cutaneous HPA- AXIAL miens hold up under skin conditions and/
or interact with the main organs?

Or is is ONLY Th1 in the SKIN and not systemic?

Do i mean we don't have SFB in the lamina propria and that translates
or inducts Th17 and thus
IL-22 or IL-17 and with gene's in the game we get hyper
Proliferations?

Enough to change or create epigenetic effects?

With negative feedBACK:
http://en.wikipedia.org/wiki/File:HPA_Axis_Diagram_(Brian_M_Sweis_2012).png

Does SKIN cort over-rule the hypothalamus and adrenal cort that much
we STILL poop out energy WISE?

BAD and LIsTLESS!

I'll go with the adNeX(T)a one this TIME.

How hairy is that? LOL

Did i nail it?

pregnenolone 18 hits - p ng
https://groups.google.com/group/alt.support.skin-diseases.psoriasis/search?hl=en&q=pregnenolone+&start=0&hl=en&


http://en.wikipedia.org/wiki/Skin_appendage

As mentioned in your abstract:

http://www.ncbi.nlm.nih.gov/pubmed/?term=PMID%3A+23435015
J Steroid Biochem Mol Biol. 2013 Feb 19. pii: S0960-0760(13)00027-7.
doi: 10.1016/j.jsbmb.2013.02.006. [Epub ahead of print]
Steroidogenesis in the skin: Implications for local immune functions.
PMID: 23435015

Good one.. & thank-you Susan

you nailed the skin this time back to your main theme

http://en.wikipedia.org/wiki/Adnexa

And with:

No dearth of testosterone in the p ng <w>
199 hits no LESS: a good starting point
https://groups.google.com/group/alt.support.skin-diseases.psoriasis/search?hl=en&q=testosterone&start=0&hl=en&

John_24 got his up via a OZ site and didn't come back to COMMENT: LoL
https://groups.google.com/group/alt.support.skin-diseases.psoriasis/search?hl=en&q=testosterone+john24&start=0&hl=en&

I think he did "hyperimmune egg i26" iirc:
https://groups.google.com/group/alt.support.skin-diseases.psoriasis/browse_thread/thread/34946724fcfa7d6f/5b5fd429078eb89e?hl=en&lnk=gst&q=testosterone+john_24#5b5fd429078eb89e


YET ACTIONs sPeak louder then words!


Is john24 clear or NOT? <w>

OK back to cyp450 stuff:

Cyp11a1 is P450scc and mito related:
P450scc
http://en.wikipedia.org/wiki/Cholesterol_side-chain_cleavage_enzyme
Cholesterol side-chain cleavage enzyme is commonly referred to as
P450scc, where "scc" is an acronym for side-chain cleavage. P450scc is
a mitochondrial enzyme that catalyzes conversion of cholesterol to
pregnenolone. This is the first reaction in the process of
steroidogenesis in all mammalian tissues that specialize in the
production of various steroid hormones.[2]

P450scc is a member of the cytochrome P450 superfamily of enzymes
(family 11, subfamily A, polypeptide 1). The gene name is CYP11A1.[3]

http://en.wikipedia.org/wiki/Cytochrome_P450

[...] Mitochondrial P450 systems, that employ adrenodoxin reductase
and adrenodoxin to transfer electrons from NADPH to P450.
Bacterial P450 systems, that employ a ferredoxin reductase and a
ferredoxin to transfer electrons to P450.
CYB5R/cyb5/P450 systems in which both electrons required by the CYP
come from cytochrome b5.

[...] P450s in humans
Human CYPs are primarily membrane-associated proteins[13] located
either in the inner membrane of mitochondria or in the endoplasmic
reticulum of cells.
<snip>

ER,,, STAT to the ER time?

not yet heart attack But pass the YAK Butter:
http://en.wikipedia.org/wiki/Yak_butter

[...] Whole yak's milk has about twice the fat content of whole cow's
milk, producing a butter with a texture closer to cheese.
<snip>

Will that be one or two LUMPs of YAK CREAM in your TEA?

http://en.wikipedia.org/wiki/Clotted_cream#Cream_tea

Looks like french vanilla ykw..

NO... what?

IC -- http://upload.wikimedia.org/wikipedia/commons/4/41/Yak_butter_1000.jpg

Forget the butter and pass the bLUE Cheese..

ok.. duck... .. or heads UP?

And do we require butter to uPtake vitamin K2?

http://www.ncbi.nlm.nih.gov/pubmed/8813897
pmid: 8813897

15 hits on JUST your second post for p450(scc) albeit full TEXT what
would one expect? P450 goes Postal! LOL

159 hits for P450 on the p ng
https://groups.google.com/group/alt.support.skin-diseases.psoriasis/search?hl=en&q=p450&start=0&hl=en&

<note: P450 3A4 (also called CYP3A4)>

cyp450 we've got enough: (never enough till cured OTH?)

YET only two with the new NAME: CYP11A1

CYP11A1 - one hit besides yours which isn't showing yet :(
https://groups.google.com/group/alt.support.skin-diseases.psoriasis/search?hl=en&q=CYP11A1+&start=0&hl=en&

from you to me or me to you with love and 3 years AGO:

Tues, Apr 13 2010 9:04 am
Subject: Re: Skin as an endocrine organ/ Being ZEN with KEN & SKIN?
http://groups.google.com/group/alt.support.skin-diseases.psoriasis/msg/1bee2441bc416115
or with highlights: <why bother see [...]>
https://groups.google.com/group/alt.support.skin-diseases.psoriasis/browse_thread/thread/2e18358805cd9422/1bee2441bc416115?hl=en&lnk=gst&q=CYP11A1+#1bee2441bc416115


[...] ReferencesCutaneous steroidogenesis
Mammalian skin expresses steroidogenically functional CYP11A1 system
[48,49]. Skin cells also express alternatively spliced isoforms of
CYP11A1 and cholesterol transport protein MLN64 [48]. Moreover,
isolated mitochondria from skin cells can transform cholesterol to
pregnenolone and progesterone, though with low efficiency,
<snip>


and not like i've not BEEN Nuts for mitochondria
http://en.wikipedia.org/wiki/Pregnenolone#Biosynthesis
Pregnenolone is synthesized from cholesterol. This conversion involves
hydroxylation at the side-chain at C20 and C22 positions, with
cleavage of the side-chain. The enzyme performing this task is
cytochrome P450scc, located in the mitochondria, and controlled by
anterior pituitary tropic hormones, such as ACTH, FSH, LH.
<snip>

Cell growth that is:
http://en.wikipedia.org/wiki/Mitochondrion
[...] Mitochondria are sometimes described as "cellular power plants"
because they generate most of the cell's supply of adenosine
triphosphate (ATP), used as a source of chemical energy.[2] In
addition to supplying cellular energy, mitochondria are involved in
other tasks such as signaling, cellular differentiation, cell death,
as well as the control of the cell cycle and cell growth.[3]
Mitochondria have been implicated in several human diseases, including
mitochondrial disorders[4] and cardiac dysfunction,[5] and may play a
role in the aging process.
<snip>

So what if John24 got his mito's fired uP and his skin cleared?
Yikes.

No T helper cells but a HPA deal to CLEAR us?

Like Christ on eASTER?

...?

Doth the pituitary protest to much and the cortisol takes a back seat
to testy? <G>

Certainly OUR Lord had his test and/or those hpa... cortisol included
under control?

cyP doth not protest or protect that mush IMO?


http://en.wikipedia.org/wiki/CYP11A1#Regulation

[...] The production of this enzyme is inhibited notably by the
nuclear receptor DAX-1.[17]
P450scc is always active, however its activity is limited by the
supply of cholesterol in the inner membrane. The supplying of
cholesterol to this membrane (from the outer mitochondrial membrane)
is thus considered the true rate-limiting step in steroid production.
This step is primarily mediated by the steroidogenic acute regulatory
protein (StAR or STARD1). Upon stimulation of a cell to make steroid,
the amount of StAR available to transfer cholesterol to the inner
membrane limits how fast the reaction can go (the acute phase). With
prolonged (chronic) stimulation, it is thought that cholesterol supply
becomes no longer an issue and that the capacity of the system to make
steroid (i.e., level of P450scc in the mitochondria) is now more
important.
<snip>


Will have fun.. thinking it ALL over!

Or giving it the OLD college try during March madness via spring
break, aka EASTER, in UVB inductable Miami?


Past the EASTER hyperimmune eGGs and i choose Palm Springs LOL:?

Clearly cheaPer er er then the DEAD SEA...

<note: Easter being a time to listen with your heart and LOVE for all
mankind the way OUR LORD loves us? YOU? etc>


and YOU posted a few minutes LATER on Palm Sunday:

http://www.ncbi.nlm.nih.gov/pubmed/21673307

Cutaneous hypothalamic-pituitary-adrenal axis homolog: regulation by

ultraviolet radiation.
Skobowiat C, Dowdy JC, Sayre RM, Tuckey RC, Slominski A.
Am J Physiol Endocrinol Metab. 2011 Sep;301(3):E484-93. doi: 10.1152/
ajpendo.00217.2011.. Epub 2011 Jun 14.

[...] Thus, the capacity to activate or change the spatial
distribution of the cutaneous HPA axis elements is dependent on highly
energetic wavelengths (UVC and UVB), implying a dependence of a local
stress response on their noxious activity with overlapping or
alternative mechanisms activated by UVA.
PMID: 21673307
Free PMC Article
http://www.ncbi.nlm.nih.gov/pmc/articles/pmid/21673307/

EnerJETic being 308-312-nm uvb's?

33 hits: 308 uvb psoria*
http://www.ncbi.nlm.nih.gov/pubmed/?term=308+uvb+psoria*

Praise the almighty uvb and get plenty of vitamin K2 besides free
sunny D3 or pass the retinoidaLL puva?

huh?

http://en.wikipedia.org/wiki/PUVA_therapy
http://en.wikipedia.org/wiki/Psoralen#Uses

http://en.wikipedia.org/wiki/Retinoic_acid#Biosynthesis

[...] Enzymes that metabolize excess retinol to prevent toxicity
include alcohol dehydrogenase and cytochrome P450(cyp26)

and the morning before pill for male rats:
[...] The retinoic acid synthesis in testes is catalyzed primarily by
the RALDH2 (ALDH1A2) aldehyde dehydrogenase. Suppressing this enzyme
has been proposed as a possible way to make a male contraceptive pill,
because retionic acid is necessary for spermatogenesis in humans much
like in rats.[9]
<snip>

402 hits : retinoid + puva
http://www.ncbi.nlm.nih.gov/pubmed/?term=retinoid+puva

Pass the laser BEANs... LoL

I like Pinto...

shut up id squid... you make me feel like i'm chatting with a ... ykw.

no who?

An id?

With ER?

But won't that stuff make me hyper GONDANADAL?
http://en.wikipedia.org/wiki/Retinoic_acid#Retinoic_acid_function_in_the_absence_of_precursors_retinol_or_retinaldehyde

[...] vitamin A-deprived but retinoic acid-supplemented male rats
exhibit hypogonadism and infertility due to lack of local retinoic
acid synthesis in the testis
<snip>

Imagine telling your kids or GRAND kids...i've got

http://en.wikipedia.org/wiki/Hypogonadism


er er er ... exicmer light gizmo is LOOKING better by the second!

How Homologous is it? Following suit or in spades?

Does that yak butter rule or what?

What do they graze on? Super GRASS @ 15,000 plus feet altitudes!


http://thegreenbayyakkers.com/page4.html

[...] One of the few vocalizations is a loud grunt, made during the
breeding season by wild yaks. Domestic yaks, however, "grunt"
throughout the year - hence the specific name grunniens.


Just like drunk kids on spring BREAK... smoking or eating GRASS being
the difference.

But part of mating behavior for either one may be high D3 levels and
enough fermentation to hook up.

In the ruminant that would be quite less a mind trip... i'm guessing.


OK>.. it is EASTER and i've got bigger FISH to FRY... and or eat HAM?

Yikes.. ham was always a downFALL food for me... LOL

Why?

Quality versus quantity id squid...

or


randall... won't clear his skin for EASTER!


you said:

>
> J Steroid Biochem Mol Biol. 2013 Feb 19. pii: S0960-0760(13)00027-7.
> doi: 10.1016/j.jsbmb.2013.02.006. [Epub ahead of print]
>
> Steroidogenesis in the skin: Implications for local immune functions.
> Slominski A, Zbytek B, Nikolakis G, Manna PR, Skobowiat C, Zmijewski M,
> Li W, Janjetovic Z, Postlethwaite A, Zouboulis CC, Tuckey RC.
>
> Source
> Department of Pathology and Laboratory Medicine, University of Tennessee
> Health Science Center, Memphis, TN 38163, USA; Center for Cancer
> Research, University of Tennessee Health Science Center, Memphis, TN
> 38163, USA; Department of Medicine, University of Tennessee Health
> Science Center, Memphis, TN 38163, USA. Electronic address:
> aslomin...@uthsc.edu.
>
> Abstract
> The skin has developed a hierarchy of systems that encompasses the skin
> immune and local steroidogenic activities in order to protect the body
> against the external environment and biological factors and to maintain
> local homeostasis. Most recently it has been established that skin cells
> contain the entire biochemical apparatus necessary for production of
> glucocorticoids, androgens and estrogens either from precursors of
> systemic origin or, alternatively, through the conversion of cholesterol
> to pregnenolone and its subsequent transformation to biologically active
> steroids. Examples of these products are corticosterone, cortisol,
> testosterone, dihydrotesterone and estradiol.
>
> Their local production can be regulated by locally produced
> corticotropin releasing hormone (CRH), adrenocorticotropic hormone
> (ACTH) or cytokines. Furthermore the production of glucocorticoids is
> affected by ultraviolet B radiation. The level of production and nature
> of the final steroid products are dependent on the cell type or
> cutaneous compartment, e.g., epidermis, dermis, adnexal structures or
> adipose tissue. Locally produced glucocorticoids, androgens and
> estrogens affect functions of the epidermis and adnexal structures as
> well as local immune activity.
> ************************************************************************
> Malfunction of these steroidogenic activities can lead to inflammatory
> disorders or autoimmune diseases.
> ************************************************************************
>
> The cutaneous steroidogenic system can also have systemic effects, which
> are emphasized by significant skin contribution to circulating androgens
> and/or estrogens. Furthermore, local activity of CYP11A1 can produce

> novel 7Δ-steroids and secosteroids that are biologically active.

> Therefore, modulation of local steroidogenic activity may serve as a new
> therapeutic approach for treatment of inflammatory disorders, autoimmune
> processes or other skin disorders. In conclusion, the skin can be
> defined as an independent steroidogenic organ, whose activity can affect
> its functions and the development of local or systemic inflammatory or
> autoimmune diseases. This article is part of a Special Issue entitled
> 'CSR 2013'.
> Copyright © 2013 Elsevier Ltd. All rights reserved.
> PMID: 23435015 [PubMed - as supplied by publisher]

[randall]

On Mar 24, 2:30 pm, Susan <su...@nothanks.org> wrote:
> x-no-archive: yes

i think i'll save this.. maybe susan will comment further?

And i've not come to enough conclusions even though my last post
has a few:

Sun, Mar 31 2013 11:44 am
Subject: Re: Steroids produced in/by the skin as a cause of
inflammatory and autoimmune diseases
http://groups.google.com/group/alt.support.skin-diseases.psoriasis/msg/eea82dcbd8abccd6

>
> Another interesting one:
>
> Am J Physiol Endocrinol Metab. 2011 September; 301(3): E484–E493.
> Published online 2011 June 14. doi:  10.1152/ajpendo.00217.2011
> PMCID: PMC3174533

> Cutaneous hypothalamic-pituitary-adrenal axis homolog: regulation by

> ultraviolet radiation
> Cezary Skobowiat,1,5 John C. Dowdy,2 Robert M. Sayre,3 Robert C.
> Tuckey,4 and Andrzej Slominski1
> Departments of 1Pathology and Laboratory Medicine and
> 2Dermatology, University of Tennessee, Health Science Center, Memphis;
> 3Rapid Precision Testing Laboratories, Cordova, Tennessee;
> 4School of Biomedical, Biomolecular and Chemical Sciences, University of
> Western Australia, Crawley, Australia; and
> 5Department of Clinical Physiology, University of Warmia and Mazury,
> Olsztyn, Poland
> Corresponding author.
> Address for reprint requests and other correspondence: A. Slominski,
> Dept. of Pathology and Laboratory Medicine, Univ. of Tennessee Health
> Science Center, 930 Madison Ave. Rm. 525, Memphis, TN 38163 (e-mail:

> aslom...@uthsc.edu).

> Received May 4, 2011; Accepted June 7, 2011.
> Copyright © 2011 the American Physiological Society

> Abstract
> The hypothalamic-pituitary-adrenal (HPA) axis maintains basal and
> stress-related homeostasis in vertebrates. Skin expresses all elements
> of the HPA axis including corticotropin-releasing hormone (CRH),
> proopiomelanocortin (POMC), ACTH, β-endorphin (β-END) with corresponding
> receptors, the glucocorticoidogenic pathway, and the glucocorticoid
> receptor (GR). To test the hypothesis that cutaneous responses to
> environmental stressors follow the organizational structure of the
> central response to stress, the activity of the “cutaneous HPA” axis
> homolog was investigated after exposure to ultraviolet radiation (UVR)
> wavelengths of UVA (320–400 nm), UVB (280–320 nm), and UVC (100–280 nm)
> in human skin organ culture and in co-cultured
> keratinocytes/melanocytes. The level of stimulation of CRH, POMC, MC1R,
> MC2R, CYP11A1, and CYP11B1 genes was dependent on UV wavelengths and
> doses, with the highest effects observed for highly energetic UVC and
> UVB. ELISA and Western assays showed significant production of CRH,
> POMC, ACTH, and CYP11A1 proteins and of cortisol, with a decrease in GR
> expression only after UVB and UVC. However, β-END expression was also
> stimulated by UVA. Immunocytochemistry localized the deposition of the
> aforesaid antigens predominantly to the epidermis with additional
> accumulation of CRH, β-END, and ACTH in the dermis. UVR-stimulated
> CYP11A1 expression was seen in the basal layer of the epidermis and
> cells of adjacent dermis. Thus, the capacity to activate or change the

> spatial distribution of the cutaneous HPA axis elements is dependent on
> highly energetic wavelengths (UVC and UVB), implying a dependence of a
> local stress response on their noxious activity with overlapping or
> alternative mechanisms activated by UVA.
>

> Keywords: corticotropin-releasing hormone, proopiomelanocortin, stress,
> cortisol, glucocorticoid receptor
> the hypothalamic-pituitary-adrenal (HPA) axis represents one of the main
> limbs of an adaptive system, which maintains the basal and
> stress-related homeostasis in vertebrates (6, 25, 28, 55). Thus, stress
> (psychological, physical, or biological) stimulates hypothalamic
> corticotropin-releasing hormone (CRH) production and release, which,
> after activation of CRH receptor type 1 (CRH-R1) in the anterior
> pituitary, stimulates production and release of proopiomelanocortin
> (POMC)-derived adrenocorticotropin ACTH (6, 25, 55). ACTH in the adrenal
> cortex activates MC2 receptors (MC2R, receptor for ACTH), stimulating
> secretion and production of glucorticoids (GC), mainly cortisol [COR,
> (6)]. COR counteracts the effects of stressors and exerts powerful
> immunosuppressive effects.
>
> The skin, the largest organ of the body, is continuously exposed to
> environmental factors, of which ultraviolet (UV) wavelengths of solar
> radiation represent the most prevalent stressor to humans and diurnal
> animals (17, 39, 53). Therefore, it has been proposed that the homolog
> of the HPA axis has developed in the integument (skin) as an efficient
> way to deal with environmental stressors (30, 41, 43). This concept is
> strengthened by the evidence that vertebrate skin expresses CRH and
> related peptides, POMC, which its further processed to β-endorphin
> (β-END), ACTH, and melanocyte-stimulating hormone (MSH) (reviewed in
> Refs. 40, 42). In addition, skin cells express the corresponding
> functional CRH-R1 (reviewed in Ref. 48), melanocortin (MC), and opiate
> receptors (reviewed in Refs. 2, 53). Furthermore, CRH, POMC, and their
> corresponding receptors are coexpressed in cultured skin cells, with
> this coexpression also being demonstrated in skin biopsies by in situ
> hybridization or immunocytochemistry (18, 20, 22, 36, 42, 58). Finally,
> production of corticosterone (CORT) and COR has been clearly
> demonstrated in cultured normal human melanocytes and fibroblasts
> (45–47) and in human hair follicles (18, 29). In fact, skin expresses
> cytochrome P-450scc (P450scc or CYP11A1) and is capable of initiating
> steroidogenesis from cholesterol with pregnenolone as an intermediate
> product (49), which undergoes further sequential transformation to
> progesterone, deoxycorticosterone (DOC), 18(OH)-DOC, CORT, and COR (18,
> 33, 34, 45–47). The expression of these elements appears to be
> nonrandom, with organization into functional, cell type-specific
> regulatory loops with a structural hierarchy similar to that found at
> the central level (18, 43, 45, 46).
>
> Ultraviolet radiation (UVR) represents the electromagnetic energy
> covering wavelengths between 100 and 400 nm. It includes UVC (100–280
> nm), which is absorbed by the atmosphere but when generated by
> artificial light sources has profound mutagenic and lethal effects (1).
> UVB (280–320 nm), although representing only ∼5% of the UV spectrum of
> the solar radiation reaching the surface of the earth, is very efficient
> at stimulating cutaneous biological effects, including mutagenic and
> carcinogenic effects, induction of sunburns, stimulation of melanin
> pigmentation, and inducing transformation of 7-dehydrocholesterol to
> vitamin D3 (1, 10, 15, 17, 24, 38). It can penetrate to the level of the
> papillary dermis. UVA (320–400 nm), which has good cutaneous
> penetration, has lower ability to induce erythema and melanogenesis and
> is also less carcinogenic but having a profound effect on photoaging (1,
> 21). UV exerts many different biological actions on human and animal
> organisms utilizing different mechanisms of action including direct and
> indirect DNA damage, free radical production, and/or interaction with
> specific chromophores (1, 7, 10, 13, 35).
>
> Studies on cultured isolated skin cells have demonstrated that UVB can
> stimulate the expression of CRH, POMC, and POMC-peptides (4, 23, 27, 32,
> 57), implying its involvement in the regulation of local neuroendocrine
> activities (41). Since UVR is a prevalent environmental stressor, we
> decided to clarify the nature of cutaneous neuroendocrine responses to
> UVR by testing wavelength-dependent changes in the expression pattern of
> crucial elements of the HPA axis. We used co-cultured human
> keratinocytes and melanocytes, because of the bidirectional
> communication between these cells, and full-thickness histo-cultured
> skin biopsies as the reliable ex vivo models of human skin.
>
> MATERIALS AND METHODS
> Approval of human protocols.
> All procedures adhered to the principles of the Declaration of Helsinki
> and were approved by the local Institutional Review Board with Exempt
> Protocol no. 4.
>
> Co-cultures.
> Second passage of human neonatal epidermal keratinocytes (HEKn) and
> human neonatal epidermal melanocytes (HEMn) was used for co-cultures.
> Cells were seeded in a ratio 5:1; e.g., 5 × 105 HEKn and 1 × 105 HEMn
> per Petri dish (100 mm in diameter) in triplicate and maintained in 2 ml
> of serum-free medium (to remove all exogenous sources of POMC-derived
> peptides) composed of mixed KBM-2-MBM-4 (1:1) supplemented with insulin
> (5 μg/ml), human epidermal growth factor (2 μg/ml), human fibroblast
> growth factor (5 μg/ml), and 1% antibiotic antimycotic solution (AAS)
> (all from Lonza, Walkersville, MD). After 2 days of incubation time
> (37°C, 5% CO2), when the cells achieved 90% confluence, the media were
> discarded and cells washed 2× with PBS, and 3 ml of PBS was added to
> each flask. The cells were irradiated with the appropriate doses of UVA,
> UVB, or UVC (see Irradiation protocols below). The control cells were
> treated the same way, except that they were not exposed to UVR
> (sham-treated groups). During irradiation with UVA, both experimental
> and control (covered by aluminum foil) groups were placed on a cold
> (4°C) blanket to prevent UVA-induced temperature increases. After
> treatment, PBS was replaced with 2 ml of the same serum-free medium, and
> after 6, 12, 24, and 48 h, media from each conditions were collected and
> frozen (−80°C). The cells were rinsed with PBS and harvested by
> trypsinization, centrifuged into pellets as described previously (32,
> 37), and frozen separately at −80°C for RNA, Western blot (WB), and
> ELISA assays.
>
> Organ cultures.
> Skin samples were obtained from adult African American donors after
> breast reduction (The Med Hospital, Memphis, TN). The subcutaneous fat
> was removed, and skin was cut into 0.5 × 0.5-cm pieces. Skin fragments
> were placed dermis down onto humid (PBS) Waltham paper in a 60-mm Petri
> dish and irradiated with UVA, UVB, or UVC bulbs (see below). The UVB and
> UVC irradiation was performed at room temperature, while UVA and
> UVA-sham treated (as a control for UVA) were placed onto a cold (4°C)
> blanket to avoid heating. Eight skin fragments per dish (in duplicate
> cultures) were used for each condition. Next, the skin fragments were
> placed into six-well plates, eight per well, containing 1.5 ml of
> WILLIAM'S Medium E with l-glutamine and without phenol red (Sigma, St.
> Louis, MO) and supplemented with insulin (5 μg/ml) and AAS (1%) for 6,
> 12, 24, and 48 h of incubation at 37°C, 5% CO2. The fragments were used
> separately for RNA, WB, ELISA, and immunohistochemical (IHC) studies.
>
> Irradiation protocols.
> Doses of irradiations were as follows: UVA, sham control (C) = 0, 10,
> 20, 50 J/cm2; UVB, C 0, 50, 100, 200 mJ/cm2; and UVC, C = 0, 1, 5, 10
> mJ/cm2 (Table 1).
>
> Real-time RT-PCR (RT-PCR) assay.
> RNA from cell pellets was extracted using the Absolutely RNA Miniprep
> kit (Stratagene La Jolla, CA), and TRIzol reagents (Invitrogen,
> Carlsbad, CA) were used to isolate RNA from skin. The RNA concentration
> was quantified, and 3 μg of total RNA (either from cells or from the
> skin) was reverse-transcribed with SuperScript First-Strand Synthesis
> System (Applied Biosystems, Foster City, CA). Primers used for PCR
> amplification are listed in Table 2 and were designed with the Universal
> Probe Library (Roche,https://www.roche-applied-science.com) and
> synthesized by Integrated DNA Technologies (Coralville, IA). The
> reaction was performed in triplicate with SYBR Green I Master Mix
> (Roche, Manheim, Germany). The data were collected on a Light Cycler 480
> (Roche). The amount of amplified product for each gene was compared with
> that for β-actin by using a comparative ΔΔCT method.
>
> ELISA assays.
> Cell pellets were lysed by vortexing while the skin fragments were
> homogenized with Brinkkmann homogenizer (Brinkkmann, Dallas, TX) with 2
> ml of ice-cold RIPA buffer [PBS containing 1% Nonidet P-40, 0.1% SDS
> supplemented with 1% proteinase inhibitor cocktail (PIC; 10 μl/1 ml,
> Sigma; St. Louis, MO)]. The homogenates were kept on ice for 20 min and
> then centrifuged for 25 min (13,000 g, 4°C). Supernatants were collected
> into fresh tubes and pellets discarded. Peptides and cortisol
> concentrations were measured with ELISA kits (Table 3) and normalized
> for total protein content in cell lysates (2.5 μg/μl, Bradford assay).
> The amount of peptides and cortisol was calculated from the standard
> curve (according to the manufacturer's instructions) and presented as
> nanograms or picograms per milliliter of cell/tissue extract from organ
> culture.
>
> Western blot analyses.
> Cell pellet was lysed in 100 μl of ice-cold RIPA buffer, while the skin
> scraps (2 per condition) were homogenized with 1 ml of the same lysis
> solution a using homogenizer. Next, homogenates were kept on ice for 20
> min and centrifuged for 20 min. Supernatants were collected into fresh
> tubes, and pellet or tissue was discarded; 2.5 μl of each sample was
> used for Bradford protein assay. Extracts (30 μg of protein per line)
> were suspended in the loading Laemmli buffer (4× concentrated),
> denatured, and separated by SDS-15% PAGE. Next, separated proteins were
> transferred to a 0.2-μm PVDF membrane (Millipore, Bedford, MA).
> Membranes were blocked for 2 h at room temperature in skim milk (5%
> wt/vol) and Tris-buffered saline with Tween 20 (TBS-T). Membranes were
> then washed and incubated with primary antibody (Table 4) in 5% skim
> milk diluted (TBS-T) or nonimmune rabbit serum overnight (4°C).
> Membranes were then washed (TBS-T) and incubated with goat anti-rabbit
> IgG-conjugated HRP (0.1 μl/ml; Santa Cruz Biotechnology, Santa Cruz, CA)
> for 1 at room temperature. Blots were rinsed with TBS-T/TBS and exposed
> to the chemiluminescent substrate (SuperSignal West Pico, Thermo Sci,
> Rockford, PA). Bands were visualized by exposure to a classic blue
> autoradiography film BX (MidSci, St. Louis, MO) for 1–10 min. Membranes
> were stripped in Restore Plus Western Blot Stripping Buffer (Thermo
> Sci). The positive signals were standardized to the β-actin antibody
> (1:10,000, Sigma). Expression levels of proteins are the ratio of
> primary antibody to β-actin signal, respectively.
>
> Immunofluorescent staining of co-cultures in chambers.
> HEKn/HEMn were maintained and treated similarly as described earlier,
> except they were seeded at chamber slides (Thermo Sci). Following a 24-h
> incubation, cells were washed in PBS and fixed with 4% buffered PFA for
> 30 min. Afterward, cells were permeabilized and blocked in a solution
> comprising 0.2% Triton-X 100, 0.1% BSA, and 5% donkey serum for 30 min.
> Primary rabbit antibody directed against CRH, PC1, ACTH, β-END, and
> P450scc (details in Table 4) were mixed separately with mouse monoclonal
> MEL-5 antibody diluted in the same blocking solution and incubated for 3
> at room temperature. After an extensive washing in PBS, cells were
> incubated for 1 h in a mixture of species-specific secondary antibody
> conjugated with appropriate fluorophore, e.g., donkey anti-rabbit IgG
> conjugated-CY3 (red) and donkey anti-mouse IgG conjugated-FITC (green)
> (both from Jackson ImmunoResearch West Grove, PA). Cells were further
> washed, dried out, and mounted with mounting medium (Sigma). Negative
> controls were performed including omission of primary antibody,
> replacement with nonimmune rabbit serum, and exclusion of secondary
> antibodies. The positive control was performed on AtT-20 cell lines
> treated similarly. Stained cells were viewed with a fluorescent
> microscope equipped with a digital camera (Leica Digital DM4000B,
> Bannockburn, IL) and photographed under ×200 or ×400 magnifications. At
> least three chambers from each specimen were stained in each condition.
>
> Immunohistochemistry.
> Following a 24-h incubation with UV irradiation, the skin was fixed in
> 4% PFA (12 h, 4°C), rinsed several times in PBS, cryoprotected with 18%
> sucrose in PBS for 10 days (4°C), and cryosectioned (Leica, Bannockburn,
> IL). Ten-micrometer sections were mounted onto silanized slides (Dako,
> Carpinteria, CA), rinsed several times in PBS, and maintained for 1 h at
> room temperature in a blocking solution (5% donkey serum, 0.1% BSA, 0.2%
> Triton X-100 in PBS), rinsed in PBS and incubated for 16 h at room
> temperature with some rabbit polyclonals listed in Table 4. To visualize
> the immunocomplexes, the secondary donkey anti-rabbit biotinylated IgG
> (1:1,000) and then with CY3-conjugated streptavidin (0.2 μg/ml) as a
> fluorophore (both from Jackson ImmunoResearch, West Grove, PA) were
> applied. All slides were finally counterstained with DAPI. At least six
> slides from each specimen were stained and assessed. The immunoreactive
> (IR) signals were examined under fluorescent microscope (Leica Digital
> DM4000B) equipped with a digital camera. In addition, the intensity of
> fluorescent signals inside the epidermis layer was evaluated using
> ImageJ software (National Institutes of Health) and statistically
> compared between conditions with the controls. Positive-control staining
> was performed on human pituitary gland and uterus tissues, which were
> treated similarly to the skin. The negative controls consisted of
> tissues incubated without primary antibody or with nonimmune rabbit
> serum or with antibodies preabsorbed with 0.1 mmol/l concentrations of
> CRH (Sigma, St. Louis, MO), β-END, and ACTH (Peninsula Laboratory,
> Torrance, CA).
>
> Statistical evaluation.
> Data are presented as means ± SD and were analyzed with Student's t-test
> (for 2 groups) or (for more than 2 groups) with one-way ANOVA Dunnett's
> multiple comparison post hoc test using Prism 4.00 (GraphPad Software,
> San Diego, CA). Statistically significant differences are denoted by
> black (t-test) and white or gray (ANOVA) asterisks, where ***P ≤ 0.001,
> **P ≤ 0.005, and *P ≤ 0.05.
>
> RESULTS
> Changes in the expressions of CRH, POMC, MC1R, MC2R, CYP11A1 and CYP11B1
> genes.
> UVR significantly changed the expression of the HPA-related genes in
> both co-cultured human keratinocytes and melanocytes (the two main cell
> populations of the epidermis) and in full-thickness skin biopsies
> incubated ex vivo, in time-, dose-, and wavelength-dependent manners
> (Fig. 1). The most pronounced induction of the expression was observed
> at 12 and 24 h after irradiation. Of the doses tested, the one causing
> the highest stimulation was variable, particularly for UVA. For UVB the
> highest stimulation was at a dose of either 100 or 200 mJ/cm2 and for
> UVC was either 1 or 5 mJ/cm2. The highest increase of CRH mRNA
> expression was observed after 1 mJ/cm2 UVC [507 ± 2.15-fold change (fc)]
> and was also enhanced after UVA (10 J/cm2, 5.6 ± 0.19 fc) and UVB (100
> mJ/cm2, 3.5 ± 0.6 fc) for skin biopsies and 200 mJ/cm2, 8 ± 0.6 fc for
> co-cultures (Fig. 1). Stimulation of POMC followed the same trend, with
> the highest effect seen after UVC and UVB with the highest stimulation
> at 5 and 100 mJ/cm2, respectively. There was also a moderate effect
> after UVA, seen only at 10 J/cm2. The stimulation of MC1R expression was
> the greatest after UVC (all doses) and was nearly 100× higher than with
> the UVB (highest at 100 mJ/cm2), whereas UVA had no effect. Although
> MC2R expression was very low in untreated samples, its mRNA expression
> was induced by UVR, with the highest stimulation after UVB (200 mJ/cm2;
> 820 ± 0.24 fc) and a moderate stimulation after UVA (at 50 J/cm2), but
> only a minimal effect was seen after UVC (at 5 mJ/cm2). Expressions of
> the CYP11A1 and CYP11B1 genes encoding the GC synthesis pathway enzymes
> were noticeably increased after UVC exposure, especially with 1 mJ/cm2
> as well as after UVB. UVA stimulated the expression of CYP11A1 at 10 and
> 50 J/cm2, but it inhibited CYP11B1 gene expression (Fig. 1A). In
> co-cultured melanocytes and keratinocytes, the UVB-induced expression of
> HPA related genes expression consistently showed a dose-dependent
> stimulation, with the highest increases observed for either 100 or 200
> mJ/cm2 after 12 h of irradiation (Fig. 1B).
>
> Effect of UVR on CRH, ACTH, β-END, and COR production.
> The most remarkable effects were obtained after 24 h of irradiation. CRH
> production from the skin and co-cultures was stimulated in a
> dose-dependent manner by UVB and UVC (highest stimulation at 100 and 5
> mJ/cm2, respectively) but not by UVA (Fig. 2). Interestingly, the
> highest doses of UVC slightly but significantly decreased the CRH
> levels. The basal levels of ACTH were very low (below or at the border
> of detection). However, the ACTH concentration was significantly
> increased in a dose-dependent manner by UVB and UVC irradiation, which
> was highest at 100 and 5 mJ/cm2, respectively. Again, UVA had no effect
> on ACTH concentration (undetectable). β-END was endogenously produced
> both in skin and co-culture and its levels significantly increased after
> exposure to UVA, UVB and UVC in a dose-dependent manner with maximum
> stimulation at 20 J/cm2, 100 mJ/cm2 and 5 mJ/cm2, respectively. COR was
> also produced endogenously, and its levels increased after UVB and UVC
> irradiation in a dose-dependent manner, with UVA being without any effect.
>
> Changes in protein levels for CRH, POMC, P450scc (CYP11A1), and GR
> measured by western blotting.
> To complement gene expression and ELISA assays, we performed WB analyses
> on extracts from skin and co-cultures after UVB followed by 24 h of
> incubation (Fig. 3). The antibody against CRH recognized the 23-kDA
> pro-CRH protein, whose concentration was enhanced in a dose-dependent
> manner after UVB (Fig. 3A). Increased levels of POMC-derived 33-kDa
> protein were also seen after UVB by using an antibody directed against
> ACTH (Fig. 3B). In addition, a dose-dependent increase in the
> concentration of P450scc was evident after UVB irradiation (Fig. 3C).
> Remarkably, the same doses of UVB downregulated the levels of GR (Fig. 3D).
>
> Immunofluorescent in situ detection of CRH, proconvertase-1, ACTH,
> β-END, P450scc, and GR expressions followed by UVR.
> The basal expressions of CRH, proconvertase-1 (PC1), β-END, and P450scc
> antigens in control samples were low and limited mainly to basal or
> suprabasal epidermal layers, while only single ACTH-immunoreactive (IR)
> cells were seen (Fig. 4). However, there were significant and
> dose-dependent increases in CRH-, ACTH-, and β-END-IR signals after UVB,
> which were located in the cytoplasm of keratinocytes distributed through
> all layers of the epidermis (Fig. 4A). UVC also remarkably stimulated
> expression of all above with UVA having stimulatory effect mainly on
> CRH-IR and β-END-IR (Fig. 4B). The spatial distribution of these
> neuropeptides was similar to the that of the samples treated with UVB.
> The expression of GR-IR was high in nuclei of control epidermal
> keratinocytes, being seen in all layers of the epidermis. Exposure to a
> high dose of UVB (100 mJ/cm2) or UVC (5 mJ/cm2), but not to UVA,
> significantly decreased the immunopositive signal. The calculated values
> of immunopositive signal intensity for appropriate antigens expression
> are shown on inset graphs to Fig. 4, A and B. In contrast, P450scc-IR,
> while being low in control samples, significantly increased after UVB
> and UVC but only slightly after UVA. The antigen was localized in
> cytoplasm of basal keratinocytes, dermal fibroblasts, and other
> nonepithelial cells of the dermis (after UVC) (Fig. 4B).
>
> The chamber double staining of co-cultured melanocytes and keratinocytes
> showed that there were increases in immunofluorescence intensities for
> CRH, PC1, ACTH, β-END, and P450scc (localized to the cytoplasm),
> especially after UVB and UVC irradiation, with UVA lacking a visible
> effect on ACTH-IR (Fig. 4B). Double staining with melanocyte-specific
> MEL-5 antibody (FITC-green) demonstrated that not only keratinocytes but
> also melanocytes (yellow, as a result of digital overlapping of green
> and red fluorophors) expressed CRH, PC1, ACTH, β-END-IR, and P450scc
> after UVR (Fig. 4B).
>
> DISCUSSION
> This is the most comprehensive study yet on the effects of UVR on the
> cutaneous HPA axis. It shows wavelength-dependent changes in cutaneous
> expression of almost all of the main regulatory elements of the HPA axis
> at the levels of gene expression, protein, and final hormone (CRH, ACTH,
> β-END, and COR) concentrations. This indicates that UVR, a prevalent
> environmental stressor, can trigger local neuroendocrine stress
> responses, with CRH, POMC, and GC acting as coordinators of phenotypic
> responses aimed at stabilization or preservation of local homeostasis.
>
> These studies are in agreement with previous reports on UVB induction of
> CRH (32, 57), POMC, and MC1R (4, 5, 23, 27) expressions in cultured in
> vitro normal and malignant melanocytes and keratinocytes. There is also
> a striking resemblance between the range of biologically active UVB
> doses seen in this study with those demonstrated by Pawelek's group as
> the most effective for induction of melanin pigmentation (5, 24). The
> significance of our study is the demonstration of the
> wavelength-dependent capability of UVR to stimulate the expression of
> the crucial regulatory genes of the HPA axis. In general, the more
> energetic and shorter the wavelength, the stronger the effect, with UVC
> ≥ UVB > UVA. Nevertheless, there are some exceptions; for example, UVB
> was the most efficient in induction of the MC2R gene, whereas UVC had
> only a minor effect, and UVA inhibited CYP11B1 expression. Since UVC and
> UVB, but not UVA, show direct and prominent effects on DNA, which serves
> as a chromophore for both wavelengths (1), it is likely that the
> observed gene responses could occur via an SOS-like mechanism following
> DNA damage, similar to that which induces melanin pigmentation (13, 14).
> This conclusion is further substantiated by the protective role of the
> products of genes tested as in the following cases. First, CRH in
> addition to triggering the HPA axis, also has protective properties at
> tissue levels (16, 48). Second, POMC is processed to β-END, ACTH, and
> MSH peptides, which have respective, antinociceptive, anti-inflammatory,
> melanogenic, and protective activities in the skin (38, 40, 53). Third,
> the increased expression of steroidogenic genes leading to enhanced
> production of COR amplifies the above-mentioned protective properties to
> maintain the homeostasis in the skin. The above UV-induced,
> keratinocyte-derived growth factors can also regulate the activity of
> epidermal melanocytes in a context-dependent fashion as described above
> (38, 41). Finally, MC2R is crucial for ACTH-induced steroidogeneic
> activity (2, 6), while MC1R has antimutagenic and antiapoptotic
> activities, which are separate from melanin pigmentation (2, 19).
>
> The striking UVB- and UVC-restricted effects are best illustrated when
> one analyzes the levels of the final products. For both wavelengths, but
> not UVA, the boosted production of CRH, ACTH, and COR, with UVA being
> able to increase only β-END, was shown in whole skin extracts and in
> situ in the epidermis by IHC. The spatial pattern of UV-induced CRH,
> ACTH, and β-END expression in epidermis is consistent with previous
> studies on increased expression of POMC in the upper layers of the
> epidermis (3) and prodifferentiation effects of CRH (44, 48, 56). This
> could contribute to building the biological barrier in the outermost
> layer of skin to protect against environmental or biological insults (9,
> 31, 36, 41, 52). Increased expression of CYP11A1 in basal layers of the
> epidermis suggests strategic production of pregnenolone that could be
> used for steroid synthesis in either epidermal or superficial dermal
> compartments with multiple biological implications (49–51).
> Colocalization of those antigens in co-cultured melanocytes and
> keratinocytes indicates that both cell types play a role in building
> this barrier. In contrast, expression of GR was inhibited by UVB and
> UVC, which may indicate an epidermal mechanism designed to attenuate the
> long-term immunosuppression caused by cortisol throughout the
> downregulation of its receptor. At the present stage of our knowledge, a
> possible molecular mechanism regulating this process is speculative;
> however, it indicates a linkage to pathways activated by UVB and UVC but
> not UVA. Also, in many autoimmune skin disorders, the glucocorticoid
> resistance appears to be associated with a qualitative or quantitative
> deficiency in GR activity (11, 26). Thus, further careful studies
> including defining a role for GRα and GRβ isoforms and a mechanism
> regulating their expression and activity are required to uncover a
> biological and clinical significance of the above findings.
>
> POMC-derived peptides will also generate an immunosuppressive
> environment (2, 23) weakening the epidermal barrier, which however is
> compensated for by their induction of melanin (a factor protecting skin
> from environmental stress) production (38). The UV-induced stimulation
> of the expression of P450scc (CYP11A1), which is localized predominantly
> in the basal layer of epidermis and dermal fibroblasts, is consistent
> with the skin cell expression of this enzyme previously described by us
> (49). Furthermore, increased cleavage of cholesterol or its precursor by
> this enzyme in the upper layer of the epidermis would disrupt proper
> barrier formation, which requires cholesterol and its derivatives (8).
> The noticeable stimulation of β-END by all wavelengths of UV tested is
> consistent with the nociceptive action of this peptide and perhaps may
> explain the phenomenon of UV-induced “opioid-like” effects described in
> the literature (12, 54). Thus, the described differential expression of
> HPA axis elements induced by diverse UV wavelengths offers distinct but
> overlapping mechanisms by which local neuroendocrine pathways maintain
> the protection of cutaneous homeostasis. This extends far beyond the
> visionary concept that proposed a critical role of MSH receptor activity
> for UV-induced melanin pigmentation (24), a recognized protector against
> environmental stress. These mechanisms include different layers of local
> HPA axis activities, which could have developed in the integument (30)
> and which are independent of regulation of melanin pigmentation or
> represent reaction to sub- or lethal insults, for which the testing
> model has been UVC.
>
> Conclusion
>
> In summary, we have shown differential susceptibility of the cutaneous
> HPA axis following UV irradiation at diverse wavelengths. The most
> remarkable effects were mediated by highly energetic UVC and UVB,
> implying a dependence on a local stress response for their noxious
> activity. Stimulation of CRH and β-END within the epidermis by UVA
> indicates an overlapping (with the equivalent hypothalamic-pituitary
> axis) or alternative mechanisms induced by this wavelength. These
> differential responses of “cutaneous HPA” axis elements are consistent
> with differences in the mechanism of action of different UV wavelengths
> and their pathological consequences.
>
> GRANTS
> This study was supported by grants from National Science Foundation
> (IOS-0918934) and National Institutes of Health (AR-052190) to A. Slominski.
>
> DISCLOSURES
> No conflicts of interest, financial or otherwise, are declared by the
> author(s).
>
> ACKNOWLEDGMENTS
> We thank Dr. Zorica Janjetovic and Tae-Kang Kim for technical assistance.
>
> REFERENCES
> 1. Bjorn LM. Photobiology: The Science of Life and Light. New York:
> Springer, 2008.
> 2. Bohm M, Luger TA, Tobin DJ, Garcia-Borron JC. Melanocortin receptor
> ligands: new horizons for skin biology and clinical dermatology. J
> Invest Dermatol 126: 1966–1975, 2006. [PubMed: 16912693]
> 3. Chakraborty AK, Funasaka Y, Pawelek JM, Nagahama M, Ito A, Ichihashi
> M. Enhanced expression of melanocortin-1 receptor (MC1-R) in normal
> human keratinocytes during differentiation: evidence for increased
> expression of POMC peptides near suprabasal layer of epidermis. J Invest
> Dermatol 112: 853–860, 1999. [PubMed: 10383729]
> 4. Chakraborty AK, Funasaka Y, Slominski A, Bolognia J, Sodi S,
> Ichihashi M, Pawelek JM. UV light and MSH receptors. Ann NY Acad Sci
> 885: 100–116, 1999. [PubMed: 10816644]
> 5. Chakraborty AK, Funasaka Y, Slominski A, Ermak G, Hwang J, Pawelek
> JM, Ichihashi M. Production and release of proopiomelanocortin (POMC)
> derived peptides by human melanocytes and keratinocytes in culture:
> regulation by ultraviolet B. Biochim Biophys Acta 1313: 130–138, 1996.
> [PubMed: 8781560]
> 6. Chrousos GP. The hypothalamic-pituitary-adrenal axis and
> immune-mediated inflammation. N Engl J Med 332: 1351–1362, 1995.
> [PubMed: 7715646]
> 7. de Gruijl FR, Sterenborg HJ, Forbes PD, Davies RE, Cole C, Kelfkens
> G, van Weelden H, Slaper H, van der Leun JC. Wavelength dependence of
> skin cancer induction by ultraviolet irradiation of albino hairless
> mice. Cancer Res 53: 53–60, 1993. [PubMed: 8416751]
> 8. Elias PM, Feingold KR. Lipids and the epidermal water barrier:
> metabolism, regulation, and pathophysiology. Semin Dermatol 11: 176–182,
> 1992. [PubMed: 1498022]
> 9. Elias PM, Menon G, Wetzel BK, Williams JJ. Barrier requirements as
> the evolutionary “driver” of epidermal pigmentation in humans. Am J Hum
> Biol 22: 526–537, 2010. [PMCID: PMC3071612] [PubMed: 20209486]
> 10. Freeman SE, Hacham H, Gange RW, Maytum DJ, Sutherland JC, Sutherland
> BM. Wavelength dependence of pyrimidine dimer formation in DNA of human
> skin irradiated in situ with ultraviolet light. Proc Natl Acad Sci USA
> 86: 5605–5609, 1989. [PMCID: PMC297671] [PubMed: 2748607]
> 11. Gagliardo R, Chanez P, Vignola AM, Bousquet J, Vachier I, Godard P,
> Bonsignore G, Demoly P, Mathieu M. Glucocorticoid receptor alpha and
> beta in glucocorticoid dependent asthma. Am J Respir Crit Care Med 162:
> 7–13, 2000. [PubMed: 10903212]
> 12. Gambichler T, Bader A, Vojvodic M, Avermaete A, Schenk M, Altmeyer
> P, Hoffmann K. Plasma levels of opioid peptides after sunbed exposures.
> Br J Dermatol 147: 1207–1211, 2002. [PubMed: 12452872]
> 13. Gilchrest BA, Eller MS. DNA photodamage stimulates melanogenesis and
> other photoprotective responses. J Investig Dermatol Symp Proc 4: 35–40,
> 1999.
> 14. Goukassian DA, Helms E, van Steeg H, van Oostrom C, Bhawan J,
> Gilchrest BA. Topical DNA oligonucleotide therapy reduces UV-induced
> mutations and photocarcinogenesis in hairless mice. Proc Natl Acad Sci
> USA 101: 3933–3938, 2004. [PMCID: PMC374347] [PubMed: 14999099]
> 15. Hearing VJ. Biochemical control of melanogenesis and melanosomal
> organization. J Investig Dermatol Symp Proc 4: 24–28, 1999.
> 16. Hillhouse EW, Grammatopoulos DK. The molecular mechanisms underlying
> the regulation of the biological activity of corticotropin releasing
> hormone receptors: implications for physiology and pathophysiology.
> Endocr Rev 2006.
> 17. Holick MF. Vitamin D deficiency. N Engl J Med 357: 266–281, 2007.
> [PubMed: 17634462]
> 18. Ito N, Ito T, Kromminga A, Bettermann A, Takigawa M, Kees F, Straub
> RH, Paus R. Human hair follicles display a functional equivalent of the
> hypothalamic-pituitary-adrenal axis and synthesize cortisol. FASEB J 19:
> 1332–1334, 2005. [PubMed: 15946990]
> 19. Kadekaro AL, Wakamatsu K, Ito S, Abdel-Malek ZA. Cutaneous
> photoprotection and melanoma susceptibility: reaching beyond melanin
> content to the frontiers of DNA repair. Front Biosci 11: 2157–2173,
> 2006. [PubMed: 16720302]
> 20. Kauser S, Slominski A, Wei ET, Tobin DJ. Modulation of the human
> hair follicle pigmentary unit by corticotropin-releasing hormone and
> urocortin peptides. FASEB J 20: 882–895, 2006. [PMCID: PMC1472637]
> [PubMed: 16675846]
> 21. Kligman LH, Sayre RM. An action spectrum for ultraviolet induced
> elastosis in hairless mice: quantification of elastosis by image
> analysis. Photochem Photobiol 53: 237–242, 1991. [PubMed: 2011628]
> 22. Kono M, Nagata H, Umemura S, Kawana S, Osamura RY. In situ
> expression of corticotropin-releasing hormone (CRH) and
> proopiomelanocortin (POMC) genes in human skin. FASEB J 15: 2297–2299,
> 2001. [PubMed: 11511529]
> 23. Luger T, Paus R, Lipton J, Slominski A. Cutaneous Neuromodulation:
> the Proopiomelanocortin System. Ann NY Acad Sci 885: 1–479, 1999.
> [PubMed: 10816638]
> 24. Pawelek JM, Chakraborty AK, Osber MP, Orlow SJ, Min KK, Rosenzweig
> KE, Bolognia JL. Molecular cascades in UV-induced melanogenesis: a
> central role for melanotropins? Pigment Cell Res 5: 348–356, 1992.
> [PubMed: 1292019]
> 25. Rivier C, Vale W. Modulation of stress-induced ACTH release by
> corticotropin-releasing factor, catecholamines and vasopressin. Nature
> 305: 325–327, 1983. [PubMed: 6312319]
> 26. Roohk DJ, Varady KA, Turner SM, Emson CL, Gelling RW, Shankaran M,
> Lindwall G, Shipp LE, Scanlan TS, Wang JC, Hellerstein MK. Differential
> in vivo effects on target pathways of a novel arylpyrazole
> glucocorticoid receptor modulator compared with prednisolone. J
> Pharmacol Exp Ther 333: 281–289, 2010. [PubMed: 20065017]
> 27. Schiller M, Brzoska T, Bohm M, Metze D, Scholzen TE, Rougier A,
> Luger TA. Solar-simulated ultraviolet radiation-induced upregulation of
> the melanocortin-1 receptor, proopiomelanocortin, and
> alpha-melanocyte-stimulating hormone in human epidermis in vivo. J
> Investig Dermatol 122: 468–476, 2004. [PubMed: 15009732]
> 28. Seyle H. The Stress of Life. New York: McGraw-Hill, 1976, p.515.
> 29. Sharpley CF, Kauter KG, McFarlane JR. An initial exploration of in
> vivo hair cortisol responses to a brief pain stressor: latency,
> localization and independence effects. Physiol Res 58: 757–761, 2009.
> [PubMed: 19093721]
> 30. Slominski A. A nervous breakdown in the skin: stress and the
> epidermal barrier. J Clin Invest 117: 3166–3169, 2007. [PMCID:
> PMC2045620] [PubMed: 17975659]
> 31. Slominski A. On the role of the corticotropin-releasing hormone
> signalling system in the aetiology of inflammatory skin disorders. Br J
> Dermatol 160: 229–232, 2009. [PMCID: PMC2649670] [PubMed: 19187344]
> 32. Slominski A, Baker J, Ermak G, Chakraborty A, Pawelek J. Ultraviolet
> B stimulates production of corticotropin releasing factor (CRF) by human
> melanocytes. FEBS Lett 399: 175–176, 1996. [PubMed: 8980146]
> 33. Slominski A, Gomez-Sanchez C, Foecking MF, Wortsman J. Active
> steroidogenesis in the normal rat skin. Biochim Biophys Acta 1474: 1–4,
> 2000. [PubMed: 10699483]
> 34. Slominski A, Gomez-Sanchez CE, Foecking MF, Wortsman J. Metabolism
> of progesterone to DOC, corticosterone and 18OHDOC in cultured human
> melanoma cells. FEBS Lett 455: 364–366, 1999. [PubMed: 10437805]
> 35. Slominski A, Pawelek J. Animals under the sun: effects of
> ultraviolet radiation on mammalian skin. Clin Dermatol 16: 503–515,
> 1998. [PubMed: 9699062]
> 36. Slominski A, Pisarchik A, Tobin DJ, Mazurkiewicz JE, Wortsman J.
> Differential expression of a cutaneous corticotropin-releasing hormone
> system. Endocrinology 145: 941–950, 2004. [PMCID: PMC1201495] [PubMed:
> 14605004]
> 37. Slominski A, Roloff B, Zbytek B, Wei ET, Fechner K, Curry J,
> Wortsman J. Corticotropin releasing hormone (CRH) and related peptides
> can act as bioregulatory factors in human keratinocytes. In Vitro Cell
> Develop Biol 36: 211–216, 2000.
> 38. Slominski A, Tobin DJ, Shibahara S, Wortsman J. Melanin pigmentation
> in mammalian skin and its hormonal regulation. Physiol Rev 84:
> 1155–1228, 2004. [PubMed: 15383650]
> 39. Slominski A, Wortsman J. Neuroendocrinology of the skin. Endocr Rev
> 21: 457–487, 2000. [PubMed: 11041445]
> 40. Slominski A, Wortsman J, Luger T, Paus R, Solomon S. Corticotropin
> releasing hormone and proopiomelanocortin involvement in the cutaneous
> response to stress. Physiol Rev 80: 979–1020, 2000. [PubMed: 10893429]
> 41. Slominski A, Wortsman J, Paus R, Elias PM, Tobin DJ, Feingold KR.
> Skin as an endocrine organ: implications for its function. Drug Discov
> Today Dis Mech 5: 137–144, 2008. [PMCID: PMC2658605] [PubMed: 19492070]
> 42. Slominski A, Wortsman J, Pisarchik A, Zbytek B, Linton EA,
> Mazurkiewicz JE, Wei ET. Cutaneous expression of corticotropin releasing
> hormone (CRH), urocortin, and CRH receptors. FASEB J 15: 1678–1693,
> 2001. [PubMed: 11481215]
> 43. Slominski A, Wortsman J, Tuckey RC, Paus R. Differential expression
> of HPA axis homolog in the skin. Mol Cell Endocrinol 265–266: 143–149, 2007.
> 44. Slominski A, Zbytek B, Pisarchik A, Slominski RM, Zmijewski MA,
> Wortsman J. CRH functions as a growth factor/cytokine in the skin. J
> Cell Physiol 206: 780–791, 2006. [PMCID: PMC1351367] [PubMed: 16245303]
> 45. Slominski A, Zbytek B, Semak I, Sweatman T, Wortsman J. CRH
> stimulates POMC activity and corticosterone production in dermal
> fibroblasts. J Neuroimmunol 162: 97–102, 2005. [PubMed: 15833364]
> 46. Slominski A, Zbytek B, Szczesniewski A, Semak I, Kaminski J,
> Sweatman T, Wortsman J. CRH stimulation of corticosteroids production in
> melanocytes is mediated by ACTH. Am J Physiol Endocrinol Metab 288:
> E701–E706, 2005. [PubMed: 15572653]
> 47. Slominski A, Zbytek B, Szczesniewski A, Wortsman J. Cultured human
> dermal fibroblasts do produce cortisol. The J Investig Dermatol 126:
> 1177–1178, 2006.
> 48. Slominski A, Zbytek B, Zmijewski M, Slominski RM, Kauser S, Wortsman
> J, Tobin DJ. Corticotropin releasing hormone and the skin. Front Biosci
> 11: 2230–2248, 2006. [PMCID: PMC1847336] [PubMed: 16720310]
> 49. Slominski A, Zjawiony J, Wortsman J, Semak I, Stewart J, Pisarchik
> A, Sweatman T, Marcos J, Dunbar C, Tuckey RC. A novel pathway for
> sequential transformation of 7-dehydrocholesterol and expression of the
> P450scc system in mammalian skin. Eur J Biochem 271: 4178–4188, 2004.
> [PMCID: PMC1201497] [PubMed: 15511223]
> 50. Slominski AT, Janjetovic Z, Fuller BE, Zmijewski MA, Tuckey RC,
> Nguyen MN, Sweatman T, Li W, Zjawiony J, Miller D, Chen TC, Lozanski G,
> Holick MF. Products of vitamin D3 or 7-dehydrocholesterol metabolism by
> cytochrome P450scc show anti-leukemia effects, having low or absent
> calcemic activity. PLoS One 5: e9907, 2010. [PMCID: PMC2845617] [PubMed:
> 20360850]
> 51. Slominski AT, Zmijewski MA, Semak I, Sweatman T, Janjetovic Z, Li W,
> Zjawiony JK, Tuckey RC. Sequential metabolism of 7-dehydrocholesterol to
> steroidal 5,7-dienes in adrenal glands and its biological implication in
> the skin. PLoS One 4: e4309, 2009. [PMCID: PMC2629546] [PubMed: 19190754]
> 52. Slominski AT, Zmijewski MA, Zbytek B, Brozyna AA, Granese J,
> Pisarchik A, Szczesniewski A, Tobin DJ. Regulated proenkephalin
> expression in human skin and cultured skin cells. J Investig Dermatol
> 131: 613–622, 2011. [PMCID: PMC3074970] [PubMed: 21191404]
> 53. Tobin DJ. Biochemistry of human skin—our brain on the outside. Chem
> Soc Rev 35: 52–67, 2006. [PubMed: 16365642]
> 54. Tominaga M, Ogawa H, Takamori K. Possible roles of epidermal opioid
> systems in pruritus of atopic dermatitis. The J Investig Dermatol 127:
> 2228–2235, 2007.
> 55. Vale W, Spiess J, Rivier C, Rivier J. Characterization of a
> 41-residue ovine hypothalamic peptide that stimulates secretion of
> corticotropin and beta-endorphin. Science 213: 1394–1397, 1981. [PubMed:
> 6267699]
> 56. Zbytek B, Slominski AT. Corticotropin-releasing hormone induces
> keratinocyte differentiation in the adult human epidermis. J Cell
> Physiol 203: 118–126, 2005. [PubMed: 15468147]
> 57. Zbytek B, Wortsman J, Slominski A. Characterization of a ultraviolet
> B-induced corticotropin-releasing hormone-proopiomelanocortin system in
> human melanocytes. Mol Endocrinol (Baltimore, Md) 20: 2539–2547, 2006.
> 58. Zouboulis CC, Seltmann H, Hiroi N, Chen W, Young M, Oeff M,
> Scherbaum WA, Orfanos CE, McCann SM, Bornstein SR.
> Corticotropin-releasing hormone: an autocrine hormone that promotes
> lipogenesis in human sebocytes. Proc Natl Acad Sci USA 99: 7148–7153,
> 2002. [PMCID: PMC124543] [PubMed: 12011471]
> Figures and Tables
> Table 1.
>
> Specification of UV lamps used in this study
>
> Bulb Name       Destination     Total Energy 100% (W/cm2)       UVA, %  UVB, %  UVC, %
> Spectroline BLE-1500B   UVA     6.26 × 10−3  98.8    0.016   0.0002
> USHIO G15T8E    UVB     7.71 × 10−3  37.8    55      1.1
> Plusrite G15T8 Germ     UVC     1.78 × 10−2  1.59    1.82    88.7
> Table 2.
>
> List of primers used for real-time RT-PCR
>
> Gene Name       Primer Location Accession no.   Forward Sequence, 5′-3′     Reverse
> Sequence, 5′-3′
> CRH     Exon 2  NM_000756       ACTCAGAGACCAAGTCCA      CTTCCCAGGCGCTTCGCAGGT
> POMC    Exon 3  NM_000939       CTACGGCGGTTTCATGACCT    CCCTCACTCGCCCTTCTTG
> MC1R    Exon 1  NM_002386.3     ACTCCGTCTGCTCCAATGAC    AGAGCTGGCAGCAAAGATG
> MC2R    Exon 2  NM_000529       TCTTCAGCCTGTCTGTGATTG   GGCACAGGATGAAGACCAG
> CYP11A1 Exon 4  NM_001099773    CCAGACCTGTTCCGTCTGTT    AAAATCACGTCCCATGCAG
> CYP11B1 Exons 2/3       NM_000497.3     AGGTGGACAGCCTGCATC      CCATTCAGGCCCATTCAG
> β-Actin                NM_001101.3     CCAACCGCGAGAAGATGA      CCAGAGGCGTACAGGGATAG
> Table 3.
>
> List of ELISA kits used
>
> Name    Cat. No.        Vendor
> CRH     EK-019-06       Phoenix Pharmac., USA
> ACTH    21-ACTH-E01     Alpco Immuno., USA
> β-END  S-1170  Peninsula Lab., USA
> CORTISOL        KGE008  R&D Systems, UK
> Table 4.
>
> List of primary antibody used for Western blotting or immunohistochemistry
>
> Antigen Host    Titer   Source
> Corticotropin-releasing hormone, CRH* (PBL rC70)        Rabbit  1:2,000 Prof.
> Wylie Vale, Salk Inst., USA
> Proconvertase-1, PC1    Rabbit  1:1,000 Dr. Iris Lindberg, USA
> Adrenocorticotropic hormone, ACTH*,#    Rabbit  1:500   Dr. Allen, USA
> Adrenocorticotropic hormone, ACTH (AFP-6328031) Rabbit  1:1,000 Dr.
> Parlow, NIDDKD, USA
> β-Endorphins, β-END*  Rabbit  1:2,000 Dr. Allen, USA
> Cytochrome P-450 side-chain-cleavage, P450scc   Rabbit  1:1,000 Prof.
> Robert Tuckey, Univ. of Western Australia
> Glucocorticoid receptor, GR (sc-8992)   Rabbit  1:500   Santa Cruz Biotech., USA
> MEL-5 (MA02026) Mouse   1:300   Signet, USA
> β-Actin-HRP, β-actin# (A3854) Mouse   1:10,000        Sigma, USA
> *In general, cross-reactivity of antibodies against β-END and ACTH with
> noncorresponding POMC peptides has been reported to be <1% (1, 33, 40).
> Anti CRH antibody had very low cross-reactivity to other hypothalamic
> peptides (25).
> #Antibody used exclusively for Western blot.
> Fig. 1.
>
> Comparison of the expression level of selected HPA axis genes (CRH,
> POMC, MC1R, MC2R, CYP11A1, CYP11B1) after UVA, UVB, or UVC irradiation
> followed by 12 h of cultured human skin (A), and co-cultured HEKn/HEMn
> after UVB (B). See text for definitions. Values on the x-axis are doses
> of irradiation: mJ/cm2 for UVB and UVC and J/cm2 for UVA. On the y-axis
> are provided the mRNA expression levels as a fold change using a
> comparative ΔΔCT method with β-actin. Real-time RT-PCR presented as
> means ± SD.
>
> Fig. 2.
>
> UVB irradiation enhances CRH, ACTH, β-END, and cortisol (COR) production
> in the skin (A) and in HEKn/HEMn co-culture (B) followed by 24 h of
> culture. ELISA study presented as means ± SD.
>
> Fig. 3.
>
> Quantitative comparison of selected HPA axis protein concentrations,
> measured by Western blotting, relative to β-actin. Primary antibodies,
> listed in Table 4, were directed against CRH (A), ACTH (B), P450scc (C),
> GR (D).
>
> Fig. 4.
>
> Immunofluorescent examples of in situ localization of CRH-, PC1-, ACTH-,
> β-END-, P450scc-, and GR-immunoreactive (IR) signals (CY3-red) in human
> skin. A: dose-dependent increase in CRH-, ACTH-, and β-END-IR signals
> after UVB irradiation. B: wavelength-dependent changes in selected
> antigen expression shown as single (skin) and double (co-culture)
> staining with the use of melanocyte-specific markers [mouse MEL-5
> antibody (FITC-green)]. Graphs show quantitative (means ± SD) comparison
> of immunoreactive signal intensity for appropriate antigens as a
> function of dose and/or wavelength. All viable nuclei were
> counterstained with DAPI (blue). Magnification ×200 (skin) and ×400
> (co-culture).
>
> Articles from American Journal of Physiology - Endocrinology and
> Metabolism are provided here courtesy of American Physiological Society

[randall]

On Mar 24, 5:30 pm, JRStern <JRSt...@foobar.invalid> wrote:
> On Sun, 24 Mar 2013 17:30:58 -0400, Susan <su...@nothanks.org> wrote:
> >x-no-archive: yes
>
> >Another interesting one:
>
> >Am J Physiol Endocrinol Metab. 2011 September; 301(3): E484 E493.
> >Published online 2011 June 14. doi:  10.1152/ajpendo.00217.2011
> >PMCID: PMC3174533
> >Cutaneous hypothalamic-pituitary-adrenal axis homolog: regulation by
> >ultraviolet radiation
> >Cezary Skobowiat,1,5 John C. Dowdy,2 Robert M. Sayre,3 Robert C.
> >Tuckey,4 and Andrzej Slominski1
> >Departments of 1Pathology and Laboratory Medicine and
> >2Dermatology, University of Tennessee, Health Science Center, Memphis;
> >3Rapid Precision Testing Laboratories, Cordova, Tennessee;
> >4School of Biomedical, Biomolecular and Chemical Sciences, University of
> >Western Australia, Crawley, Australia; and
> >5Department of Clinical Physiology, University of Warmia and Mazury,
> >Olsztyn, Poland
> >Corresponding author.
> >Address for reprint requests and other correspondence: A. Slominski,
> >Dept. of Pathology and Laboratory Medicine, Univ. of Tennessee Health
> >Science Center, 930 Madison Ave. Rm. 525, Memphis, TN 38163 (e-mail:

> >aslom...@uthsc.edu).

> >Received May 4, 2011; Accepted June 7, 2011.
> >Copyright 2011 the American Physiological Society
>
> ...
>
> OMG, American Idol must be *seriously* boring this year!
>
>  :)
>
> Kind of a long-winded article, if it's going to apply to psoriasis
> you'd think they could just take a few skin samples and test for the
> presence of suspected steroids.
>
> J.

J and Susan


If you are both SINGLE.. i advocate you hook up.

Maybe your hpa-axis will lower cortisol and.. you move to
Hawaii and eat poi and lower salt

poi
http://en.wikipedia.org/wiki/Poi_(food)

Looks like a bowl of chocolate syrup.

But... if would be ok to get to-gether if
you are both in close proximity.

I met a Lady once who flew half way around the world to
go to work.

Tahiti to New York.

So family is more important then work..

Why not fly across town?

OK>.. it's easter and i'm not a very good easter CUPID bunny.

Hope my Egg HEADED idea is taken with a GRAIN of SALT. <w>


thank you both for your diligence over the years.


randall..