*First of all, Rudolph's birth scene was unnecessarily graphic: the beads of
claymation sweat on his mother's face, her cries of pain as she enters the final
stages of labor, the Burl Ives-voiced snowman yelling "Push!"...all very
off-putting, frankly.
*I must, say, however, that the montage of shots depicting Rudolph's humiliation
by his fellow reindeer was very effective. This showed that, rather than simply
ostracizing Rudolph, the reindeer community sought to debase him and thoroughly
break his spirit. The end of the montage with Fireball playing the
burning-paperbag-of-poop trick on Rudolph, therefore, better helps us understand
the severe distrust and antisocial tendencies Rudolph combats through much of
his adolescence and early adulthood.
*The additional Island of Misfit Toys sequence, with the Barbara Bain doll
constantly falling over and crushing the smaller toys, could have gone smoother.
*The additional scene showing the complete transformation of "Bumble" the Snow
Monster was a joy to behold. The part where he tries to put on a pair of pants,
and when he speaks his first words -- "I-am-not-dumb-now!" -- well, there
probably wasn't a dry eye in America's living rooms; proof positive that Roger
C. Carmel really knew how to lend his voice to animated characters.
*The digital remastering of "Rudolph" also helped clear up a longstanding rumor:
If you look carefully at the end of the "Fame and Fortune" sequence, you can
indeed see a Santa's elf committing suicide by impaling himself on one of the
stationary reindeers.
All in all, a very positive experience.
Sean ("Is it true that Clarice later became a reindeer porn film star?") Smith
smt...@bcvms.bc.edu
Because some things
can't be helped--http://www.geocities.com/Heartland/6504;
Featuring "Daze and Quirks"
and
The Dumb, Stupid Baseball Hat Page
[][][][][][][][][]{}{}{}{}{}{}{}{}{}{}{}
Best Out-of-Context Quote, 1998, Political Division:
"...lawn mowing is not a sex act."
Newport, Me. town manager (Associated Press)
> Has anyone noticed that the Claudia
> Christian "Babylon 5" action figure
> looks REALLY creepy? And what kid
> would need the Flounder doll?
I kind of thought the whole series of _Animal House_ action figures
was kind of unnecessary.
--
Joseph Bay Program in Cancer Biology -- Auctus Auctus Gratia
Leland Stanford Junior University Stanford, California
What Would Andre The Giant Do? Private Idaho
5'CCGATTATGCCTGGCGCTAACGGCAGTTATGCT3' http://www.stanford.edu/~jmbay
THAT... WAS... NO... DOLL! THAT... WAS... MY... WIFE!
Also, when the North Pole blew up at the end, it looked nothing like
when Santa saw the vision of the North Pole blowing up in that first-
season episode where Majel Barrett went bald.
-- K.
"Barbara
Parted from me
Yet never parted
Martin Landau's feet really stink"
>Also, when the North Pole blew up at the end, it looked nothing like
>when Santa saw the vision of the North Pole blowing up in that first-
>season episode where Majel Barrett went bald.
>
Well, remember that ol' Santa's vision isn't what it used to be. That's because
he won't listen to Mrs. Claus and EAT so he can be a FAT, JOLLY SANTA!!!1!!
Or it could be that Santa's developed a severe, slowly gestating heart infection
from prolonged exposure to flying reindeer poop. Then he'll die and Ricky
Schroeder will have to take his place!!11!!1!
>
> Has anyone noticed that the Claudia
> Christian "Babylon 5" action figure
> looks REALLY creepy? And what kid
> would need the Flounder doll?
Squeeze him there, and he'll drop and give you 20.
Sean ("But don't take off his pledge pin") Smith