Google Groups no longer supports new Usenet posts or subscriptions. Historical content remains viewable.
Dismiss

Pretty cool eh?

15 views
Skip to first unread message

(M)-adman

unread,
Oct 16, 2008, 5:10:54 PM10/16/08
to
Do a test.

1) Take a 400 letter gene.

2) Find a monkey of your choice. (please give it a bath first)

3) Put the monkey in front of a keyboard (upright, on a chair, no cigars, no
pizza, no beer)

4) Allow the monkey to bang the keys (using a simple four letter genetic
alphabet)

The odds against the monkey getting the correct order for the first
sequence? four to one.

The odds against getting the second sequence correct? sixteen to one.

The odds against getting the first three sequences correct? sixty-four to
one.

The chance the monkey can get the rest of the 397 sequences correct? 1
followed by 130 zeros

(ask spintronic for a mathematical formula if you doubt the calculation.)

Are we getting the picture yet?

I'll simplify:

Sequenced DNA and proteins cannot be attributed to blind chance.(sorry) The
odds are beyond astronomical.

Which equals an Author. A Creator. I like to call him/her God. You can use
whatever name you wish.

DNA (found by brilliant scientists, btw) is God's handwriting. Kinda like a
computer program.

Pretty cool eh?

hth
--
A cup of coffee and some truth with:

·.¸Adman¸.·
^^^^^^^^^^^

Seanpit

unread,
Oct 16, 2008, 5:32:12 PM10/16/08
to

You forget about the concept of natural selection as a guiding force
to producing specific sequences. What is your arguing for countering
the likes of Richard Dawkins when the explanation of "Climbing Mt.
Improbable" one tiny step at a time is given? There is an answer.
It's just that you haven't presented it here. You need to do a bit
better than this - - even from a creationist perspective.

See the following link for a more detailed argument for the "Methinks
it is Like a Weasel" evolution algorithm:

http://www.detectingdesign.com/methinksitislikeaweasel.html

Sean Pitman
www.DetectingDesign.com

Augray

unread,
Oct 16, 2008, 5:35:00 PM10/16/08
to
On Thu, 16 Oct 2008 16:10:54 -0500, "\(M\)-adman" <gr...@hotmail.ed>
wrote in <c3OJk.42775$IB6....@bignews8.bellsouth.net> :

>Do a test.
>
>1) Take a 400 letter gene.
>
>2) Find a monkey of your choice. (please give it a bath first)
>
>3) Put the monkey in front of a keyboard (upright, on a chair, no cigars, no
>pizza, no beer)
>
>4) Allow the monkey to bang the keys (using a simple four letter genetic
>alphabet)
>
>The odds against the monkey getting the correct order for the first
>sequence? four to one.
>
>The odds against getting the second sequence correct? sixteen to one.
>
>The odds against getting the first three sequences correct? sixty-four to
>one.
>
>The chance the monkey can get the rest of the 397 sequences correct? 1
>followed by 130 zeros
>
>(ask spintronic for a mathematical formula if you doubt the calculation.)
>
>Are we getting the picture yet?
>
>I'll simplify:
>
>Sequenced DNA and proteins cannot be attributed to blind chance.(sorry) The
>odds are beyond astronomical.

But no one attributes them to blind chance.


>Which equals an Author. A Creator. I like to call him/her God. You can use
>whatever name you wish.

Unfortunately, your premise is wrong, therefore your conclusion has no
basis.


>DNA (found by brilliant scientists, btw) is God's handwriting. Kinda like a
>computer program.
>
>Pretty cool eh?
>
>hth

What amazes me is that you seem to think that you're the first person
to come up with this.

Lee Jay

unread,
Oct 16, 2008, 5:40:31 PM10/16/08
to
On Oct 16, 3:10 pm, "\(M\)-adman" <g...@hotmail.ed> wrote:
> Sequenced DNA and proteins cannot be attributed to blind chance.

Fortunately they aren't, except in creationist straw-man arguments.

Lee Jay

Grandbank

unread,
Oct 16, 2008, 5:40:05 PM10/16/08
to


Zzzzzzzzzzzzzzzz.

You're getting lazy again. If you're just going to read through the
chapter headings of every creationist tract in the dustbin, could you
at least go to the effort of mixing up the order or something?

At this point you're kind of like Suzanne without the passive
aggression: booooring.


KP

John Harshman

unread,
Oct 16, 2008, 5:59:14 PM10/16/08
to
(M)-adman wrote:
> Do a test.
>
> 1) Take a 400 letter gene.
>
> 2) Find a monkey of your choice. (please give it a bath first)
>
> 3) Put the monkey in front of a keyboard (upright, on a chair, no cigars, no
> pizza, no beer)
>
> 4) Allow the monkey to bang the keys (using a simple four letter genetic
> alphabet)
>
> The odds against the monkey getting the correct order for the first
> sequence? four to one.
>
> The odds against getting the second sequence correct? sixteen to one.
>
> The odds against getting the first three sequences correct? sixty-four to
> one.
>
> The chance the monkey can get the rest of the 397 sequences correct? 1
> followed by 130 zeros
>
> (ask spintronic for a mathematical formula if you doubt the calculation.)

Spintronic? He's supposed to be a math expert now? And who needs an
expert? It's just 4^n to one. You are impressing nobody with your
brilliance here.

> Are we getting the picture yet?
>
> I'll simplify:
>
> Sequenced DNA and proteins cannot be attributed to blind chance.(sorry) The
> odds are beyond astronomical.

Agreed. Of course nobody claims that DNA and proteins can be attributed
to blind chance, but that particular strawman is about your speed.

> Which equals an Author. A Creator. I like to call him/her God. You can use
> whatever name you wish.

Not so fast. There are a few other things that produce non-random
results. Have you heard of natural selection, for example?

> DNA (found by brilliant scientists, btw) is God's handwriting. Kinda like a
> computer program.
>
> Pretty cool eh?

Sure, if you've been smoking pot with your frat buddies. If you think
that's cool, have you ever looked at wallpaper? I mean *really* looked?

Kleuskes & Moos

unread,
Oct 16, 2008, 5:56:10 PM10/16/08
to
On 16 okt, 23:10, "\(M\)-adman" <g...@hotmail.ed> wrote:

<snip monkey business>
> Pretty cool eh?

In the time i've been reading this newsgroup, that kind of reasoning
was brought up and debunked at least 100 times in one form or another.

Nah.. Not so cool.

r norman

unread,
Oct 16, 2008, 6:01:28 PM10/16/08
to
On Thu, 16 Oct 2008 16:10:54 -0500, "\(M\)-adman" <gr...@hotmail.ed>
wrote:

So I see you have abandoned all those other threads you started with
substantive questions still unanswered. Do you plan to do the same
with this crazy idea?

First, a relatively short sequence is easy to generate completely
randomly given a long time and an enormous number of parallel
attempts. Most stories about the chimps typing Shakespeare involve a
rather large roomful of them and infinite time.

Far more important, DNA does not arise by random typing but by
replication with modification of pre-existing pieces of DNA. These go
by various names; 'motif' is a good one to choose and there are indeed
many motifs known that are shared by many proteins. 'Cut and paste
sequences and subsequences of already established utility and then
diddle with them' is a far better metaphor for evolution than your
monkey typing out DNA sequences.

So how did it start? Go back to 'First' above and note the relative
certainly of producing in a reasonable time a large number of
different short functional sequences given an enormous number of
simultaneous trials and then allowing selection to pick the small
percentage that work.

So here is a substantive critique of your completely unreasonable
scenario. Use logic and reason, combined with known fact, to assail
it if you wish. Or cut and run as is your custom.

r norman

unread,
Oct 16, 2008, 6:05:24 PM10/16/08
to
On Thu, 16 Oct 2008 14:59:14 -0700, John Harshman
<jharshman....@pacbell.net> wrote:

>(M)-adman wrote:
<snip silliness that (M)-adman wrote>

>> Pretty cool eh?
>
>Sure, if you've been smoking pot with your frat buddies. If you think
>that's cool, have you ever looked at wallpaper? I mean *really* looked?

Yes I have. Like Wow man! That is SO neat!

J.J. O'Shea

unread,
Oct 16, 2008, 6:28:22 PM10/16/08
to
On Thu, 16 Oct 2008 18:01:28 -0400, r norman wrote
(in article <pldff4tk8stllun28...@4ax.com>):

> So I see you have abandoned all those other threads you started with
> substantive questions still unanswered. Do you plan to do the same
> with this crazy idea?

He always does.

--
email to oshea dot j dot j at gmail dot com.

rossum

unread,
Oct 16, 2008, 6:23:53 PM10/16/08
to
On Thu, 16 Oct 2008 16:10:54 -0500, "\(M\)-adman" <gr...@hotmail.ed>
wrote:

>Do a test.

Take the Bible. What are the chances of all the letters of the Bible
appearing in that order by chance? Looking at one of my Bibles, I
find that it has about 30 characters per line, 56 lines in a column
and two columns per page. The Old Testament contains 840 pages and the
New Testament 240 pages. A total of 1080 pages. This is 30 x 56 x 2 x
1080 = 3628800 characters. For simplicity let us take the number of
possible characters as 30, 26 letters plus space and some punctuation.
Therefore by the standard probability argument the likelihood of the
Bible having arisen by chance is 1 in 30 ^ 3628800.

Working out the numbers, 1 in 30 ^ 3628800 is a probability of 1.8 x
10 ^ -3628942.

Since God wrote the Bible therefore there must have been a meta-God to
create God. QED.

rossum

snex

unread,
Oct 16, 2008, 6:29:20 PM10/16/08
to

whatever sequence the monkey DOES type out, it will have the exact
same odds of being typed as the one you had in mind. and yet the
monkey still managed to type it. how could this be? the odds were
astronomical!

David Hare-Scott

unread,
Oct 16, 2008, 6:26:13 PM10/16/08
to

"(M)-adman" <gr...@hotmail.ed> wrote in message
news:c3OJk.42775$IB6....@bignews8.bellsouth.net...

>
> Sequenced DNA and proteins cannot be attributed to blind chance.(sorry)
> The odds are beyond astronomical.
>

Roll up, roll up, roll up! See Mighty Madman knock down a huge straw man
with the power of ten billion butterfly sneezes! Blasting, billowing forth
he destroys enemies of Truth, Justice and The American Way with each
astounding blast of flatus.

What? You want to see him knock down something real? Sorry the Master
Illusionist doesn't do that, try the next tent.

David

Prof Weird

unread,
Oct 16, 2008, 6:30:02 PM10/16/08
to
On Oct 16, 5:10 pm, "\(M\)-adman" <g...@hotmail.ed> wrote:
> Do a test.
>
> 1) Take a 400 letter gene.
>
> 2) Find a monkey of your choice. (please give it a bath first)
>
> 3) Put the monkey in front of a keyboard (upright, on a chair, no cigars, no
> pizza, no beer)
>
> 4) Allow the monkey to bang the keys (using a simple four letter genetic
> alphabet)
>
> The odds against the monkey getting the correct order for the first
> sequence? four to one.
>
> The odds against getting the second sequence correct?  sixteen to one.
>
> The odds against getting the first three sequences correct? sixty-four to
> one.
>
> The chance the monkey can get the rest of the 397 sequences correct?  1
> followed by 130 zeros
>
> (ask spintronic for a mathematical formula if you doubt the calculation.)
>
> Are we getting the picture yet?

Yes - you are a blithering idiot who seems to have fallen for the
Argument from Heep Big Numbers/Improbability.

Even the simple Weasel Programs shows just what a little selection can
do - it cuts through 'improbability' the way a lightsaber cuts through
Sith agents.

> I'll simplify:
>
> Sequenced DNA and proteins cannot be attributed to blind chance.(sorry) The
> odds are beyond astronomical.

Only if one were under the sway of two major delusions :

1. That sequences arose PURELY by chance - shown to be FALSE by the
fact that selection is non-random.
2. That there is one - and ONLY ONE - sequence to do anything. Shown
to be FALSE by the fact that there is much variation in the same
protein from many different critters.

The odds that a random 70 amino acid protein (210 nucleotides) will
have a selectable function is 1 in 10^9 to 1 in 10^15 from ACTUAL
EXPERIMENTAL RESULTS; this is about 60+ orders of magnitude more
likely than your simple-minded 'all at once PURELY BY CHANCE'
scenario.

This makes the score :

Reality : 149,874,568,829,950,121,899,267,565,328,672,457,536,864
(M)adman : - 5

> Which equals an Author. A Creator. I like to call him/her God. You can use
> whatever name you wish.

Only if one were deluded enough to 'think' that sequences had to poof
into existence all at once purely by chance exactly the way we see
them today.

If the 'odds' of DNA sequences arising by chance is small, the odds of
a Magical Sky Pixie/Creator/'Intelligent Designer' existing are far,
far less.

And since we 'must' reject the least likely scenario ...

> DNA (found by brilliant scientists, btw) is God's handwriting. Kinda like a
> computer program.

Not really. DNA was found by brilliant scientists. Then parasitic
creotards, IDiots and theoloons lied about it, under the presumption
that their ignorance is evidence of anything except the fact that they
are ignorant.

> Pretty cool eh?

REAL biology is extremely cool; simple-minded creotardic mathematical
masturbation is not.

(M)-adman

unread,
Oct 16, 2008, 6:39:59 PM10/16/08
to
John Harshman wrote:
> (M)-adman wrote:
>> Do a test.
>>
>> 1) Take a 400 letter gene.
>>
>> 2) Find a monkey of your choice. (please give it a bath first)
>>
>> 3) Put the monkey in front of a keyboard (upright, on a chair, no
>> cigars, no pizza, no beer)
>>
>> 4) Allow the monkey to bang the keys (using a simple four letter
>> genetic alphabet)
>>
>> The odds against the monkey getting the correct order for the first
>> sequence? four to one.
>>
>> The odds against getting the second sequence correct? sixteen to
>> one. The odds against getting the first three sequences correct?
>> sixty-four to one.
>>
>> The chance the monkey can get the rest of the 397 sequences correct?
>> 1 followed by 130 zeros
>>
>> (ask spintronic for a mathematical formula if you doubt the
>> calculation.)
>
> Spintronic? He's supposed to be a math expert now? And who needs an
> expert? It's just 4^n to one. You are impressing nobody with your
> brilliance here.

Actually. yes. Spintronic is quite good at math.

>> Are we getting the picture yet?
>>
>> I'll simplify:
>>
>> Sequenced DNA and proteins cannot be attributed to blind
>> chance.(sorry) The odds are beyond astronomical.
>
> Agreed. Of course nobody claims that DNA and proteins can be
> attributed to blind chance, but that particular strawman is about
> your speed.

Well, there is how the DNA is read.(I did a thread on this)

Besides, natural selection is chaotic, random. Code sequences and randomness
do not mix well. Randomness destroys the code.Take a computer program that
runs smooth and add some random characters. What will you get? A broken
code. Therefore randomness and code sequences are mutually destructive to
each other. The code will not read randomness, and the randomness will stop
the code. How can we come to the conclusion that randomness gives rise to
spontaneous birth of an accurate code sequence? IOW, randomness in any code
sequence progressively destroys the code. Eventually you would destroy what
natural selection was trying to preserve in the first place by the very
nature of changing the code.

>> Which equals an Author. A Creator. I like to call him/her God. You
>> can use whatever name you wish.
>
> Not so fast. There are a few other things that produce non-random
> results. Have you heard of natural selection, for example?

Natural selection is random and works only within the species and does not
harm the code The selective process rearranges the existing code to give the
desired results. Have you observed otherwise?

>
>> DNA (found by brilliant scientists, btw) is God's handwriting. Kinda
>> like a computer program.
>>
>> Pretty cool eh?
>
> Sure, if you've been smoking pot with your frat buddies. If you think
> that's cool, have you ever looked at wallpaper? I mean *really*
> looked?

ha! your humor shines through again.

yes, i have *really* looked at wallpaper. I perfer paint. Paint is easier to
change when you are tired of it.

I have Not noticed DNA sequences in wallpaper though. But i have noticed
randomness.

If you have noticed DNA sequences in wallpaper, then please, pass over what
ever it is you have been smokiN.

--
A cup of coffee and some truth with:

·.¸Adman¸.·
^^^^^^^^^^^


My List of confirmed liars
1) J.J. O'Shea

Don't fret!! YOU can be added to the list too!

geo...@hotmail.com

unread,
Oct 16, 2008, 6:42:50 PM10/16/08
to
[snip troll's lame attempt to be inflamatory]

1/10 - see me

John Harshman

unread,
Oct 16, 2008, 7:34:15 PM10/16/08
to
(M)-adman wrote:
> John Harshman wrote:
>> (M)-adman wrote:
>>> Do a test.
>>>
>>> 1) Take a 400 letter gene.
>>>
>>> 2) Find a monkey of your choice. (please give it a bath first)
>>>
>>> 3) Put the monkey in front of a keyboard (upright, on a chair, no
>>> cigars, no pizza, no beer)
>>>
>>> 4) Allow the monkey to bang the keys (using a simple four letter
>>> genetic alphabet)
>>>
>>> The odds against the monkey getting the correct order for the first
>>> sequence? four to one.
>>>
>>> The odds against getting the second sequence correct? sixteen to
>>> one. The odds against getting the first three sequences correct?
>>> sixty-four to one.
>>>
>>> The chance the monkey can get the rest of the 397 sequences correct?
>>> 1 followed by 130 zeros
>>>
>>> (ask spintronic for a mathematical formula if you doubt the
>>> calculation.)
>> Spintronic? He's supposed to be a math expert now? And who needs an
>> expert? It's just 4^n to one. You are impressing nobody with your
>> brilliance here.
>
> Actually. yes. Spintronic is quite good at math.

Not that anyone on TO has seen. He tends to make elementary errors, some
of which can be attributed to carelessness. Others...not so sure.

>>> Are we getting the picture yet?
>>>
>>> I'll simplify:
>>>
>>> Sequenced DNA and proteins cannot be attributed to blind
>>> chance.(sorry) The odds are beyond astronomical.
>> Agreed. Of course nobody claims that DNA and proteins can be
>> attributed to blind chance, but that particular strawman is about
>> your speed.
>
> Well, there is how the DNA is read.(I did a thread on this)

I have no idea what that was supposed to mean. Are you talking about
replication? That's not blind chance either.

> Besides, natural selection is chaotic, random.

No it isn't. That's your big mistake.

> Code sequences and randomness
> do not mix well. Randomness destroys the code.Take a computer program that
> runs smooth and add some random characters. What will you get? A broken
> code. Therefore randomness and code sequences are mutually destructive to
> each other. The code will not read randomness, and the randomness will stop
> the code. How can we come to the conclusion that randomness gives rise to
> spontaneous birth of an accurate code sequence? IOW, randomness in any code
> sequence progressively destroys the code. Eventually you would destroy what
> natural selection was trying to preserve in the first place by the very
> nature of changing the code.

Ah, you have confused natural selection with mutation. Mutation is
random. Natural selection is not. You know you're out to lunch when even
other creationists (e.g. Sean Pitman) tell you so.

>>> Which equals an Author. A Creator. I like to call him/her God. You
>>> can use whatever name you wish.
>> Not so fast. There are a few other things that produce non-random
>> results. Have you heard of natural selection, for example?
>
> Natural selection is random and works only within the species and does not
> harm the code The selective process rearranges the existing code to give the
> desired results. Have you observed otherwise?

Yes. You understand nothing of evolution, selection, or genetics. That
makes most of what you write into word salad, as above. Some of your
nonsense can be reinterpreted to make true statements. Natural selection
is indeed a process that works within species (or, we more often say,
populations). Natural selection does indeed work on existing variation.
"Code" has a particular meaning in genetics, which you are not
approaching. The code is very, very seldom altered in any way. Coding
sequences (very different from the code itself) are altered fairly
frequently, by mutation. Some of these mutations are neutral, and
selection ignores them. Some are deleterious, and selection eliminated
them. Some are advantageous, and selection spreads them. Mutation is
random; selection is not.

>>> DNA (found by brilliant scientists, btw) is God's handwriting. Kinda
>>> like a computer program.
>>>
>>> Pretty cool eh?
>> Sure, if you've been smoking pot with your frat buddies. If you think
>> that's cool, have you ever looked at wallpaper? I mean *really*
>> looked?
>
> ha! your humor shines through again.
>
> yes, i have *really* looked at wallpaper. I perfer paint. Paint is easier to
> change when you are tired of it.
>
> I have Not noticed DNA sequences in wallpaper though. But i have noticed
> randomness.
>
> If you have noticed DNA sequences in wallpaper, then please, pass over what
> ever it is you have been smokiN.

I think you've been smoking too much already. Time to come down.

heekster

unread,
Oct 16, 2008, 8:14:41 PM10/16/08
to
On Thu, 16 Oct 2008 17:39:59 -0500, "\(M\)-adman" <gr...@hotmail.ed>
wrote:

>John Harshman wrote:

How does one perfer paint?

>I have Not noticed DNA sequences in wallpaper though. But i have noticed
>randomness.
>
>If you have noticed DNA sequences in wallpaper, then please, pass over what
>ever it is you have been smokiN.

http://tinyurl.com/4td69o

(M)-adman

unread,
Oct 16, 2008, 8:39:11 PM10/16/08
to

thanks, i'll take a look.


Natural selection is random, unpredictable, depends on too many other
circumstances.

Randomness and code sequences do not mix. One will break the other.


--
A cup of coffee and some truth with:

·.¸Adman¸.·
^^^^^^^^^^^


DJT

unread,
Oct 16, 2008, 8:35:21 PM10/16/08
to
On Oct 16, 6:14 pm, heekster <heeks...@iwxt.net> wrote:
snip


>
> >yes, i have *really* looked at wallpaper. I perfer paint. Paint is easier to
> >change when you are tired of it.
>
> How does one perfer paint?

I think he meant "prefer", but in this case, it's likely he sprays
gold paint into a bag, and breathes the fumes....


DJT

Anlatt the Builder

unread,
Oct 16, 2008, 10:02:39 PM10/16/08
to

Natural selection is not random at all. You have no idea what you are
talking about.

Anlatt the Builder

unread,
Oct 16, 2008, 10:01:39 PM10/16/08
to
On Oct 16, 2:10 pm, "\(M\)-adman" <g...@hotmail.ed> wrote:

You have left out anything in your analogy that corresponds to natural
selection, and therefore you are missing the whole point of the theory
of evolution.

hth

Anlatt the Builder

unread,
Oct 16, 2008, 10:05:58 PM10/16/08
to
On Oct 16, 3:39 pm, "\(M\)-adman" <g...@hotmail.ed> wrote:
>
> Besides, natural selection is chaotic, random.

Natural selection is not random.

You say:

> Randomness destroys the code.

and then:

>
> Natural selection is random and works only within the species and does not
> harm the code

which contradicts what you just said. (The "only within species" is a
change of subject and a red herring.)

Prof Weird

unread,
Oct 16, 2008, 10:40:23 PM10/16/08
to

Read ? When DNA is replicated, G matches with C and T matches with
A. If you know the sequence of one strand, you automatically know the
sequence of the other strand.

If you meant 'transcription' - mRNA is 'read' from the DNA, but it is
not random either (G pairs against C, and U pairs against A. Thus, if
you know the DNA sequence, you can figure out the RNA sequence that
would be transcribed from it).

If you meant 'translation' (production of protein from mRNA
'instructions') - have a reading frame for the triplets, but not
random if know where to start.

> Besides, natural selection is chaotic, random.

Not in this reality (unless you've confused mutation with natural
selection). Sequences that 'code' for something that improves the
odds the critter it resides in will live long enough to reproduce tend
to become more common in the population.

If THAT concept is beyond you, you truly have no place criticizing
evolution.

> Code sequences and randomness
> do not mix well. Randomness destroys the code.Take a computer program that
> runs smooth and add some random characters. What will you get? A broken
> code. Therefore randomness and code sequences are mutually destructive to
> each other.

Too bad that, IN REALITY, there is more than one organism in a
population (evolution happens to POPULATIONS, not individuals).

Too bad that some alterations to the 'code' will be deleterious;
others will be useful (in biology, most changes are neutral; of the
few with noticeable affect, the majority are deleterious, and a
minority are beneficial). Living things are more robust than computer
code.

Too bad that, IN REALITY, researchers have indeed used random
alterations of code to generate complex programs - Ofria, Pennock,
etc. The POPULATIONS of programs went from merely replicating
themselves and performing no logical operations, to replicating
themselves AND performing complex logical operations. Thus reality
delivers a knee to your groin once again.

Too bad that, IN REALITY, your simpering 'example' relies on their
being a 'perfect' code and predetermined functions - biology is a bit
messier and far more robust to changes.

> The code will not read randomness, and the randomness will stop
> the code.

Good thing that, IN REALITY, DNA is not that sort of code - ANY DNA
sequence with the appropriate promoters can be transcribed into mRNA
and translated into protein. Transcription complexes and ribosomes
DON'T CARE, they just catalyze chemical reactions.

You still seem stuck on the odd idea that DNA is directly comparable
to a computer program, and is capable of a 'Blue Screen of Death'
effects.

> How can we come to the conclusion that randomness gives rise to
> spontaneous birth of an accurate code sequence?

Functional selection FILTERS OUT SEQUENCES that are deleterious faster
than anything else.

Only things left after enough generations is 'useful'
'information' (hence, no need for 'spontaneous' birth of any
sequence).

> IOW, randomness in any code
> sequence progressively destroys the code.

IF there were nothing filtering out the effects, it would.

Good thing that, IN REALITY, selection filters out deleterious changes
rather efficiently.

> Eventually you would destroy what
> natural selection was trying to preserve in the first place by the very
> nature of changing the code.

That's assuming mutation rate far outstrips selective forces - rarely
seen because its lethal.

Good thing that, IN REALITY, such situations rarely come up. Most
mutation rates are low, and most mutations are neutral or mildly
deleterious (can be compensated for), or context dependent (a change
may be neutral in one environ, deleterious in another).

Viruses mutate very fast, but do quite well (some of the mutations
allow them to better evade host defenses; this is BENEFICIAL for the
virus, not so much for the host.)

> >> Which equals an Author. A Creator. I like to call him/her God. You
> >> can use whatever name you wish.
>
> > Not so fast. There are a few other things that produce non-random
> > results. Have you heard of natural selection, for example?
>
> Natural selection is random and works only within the species and does not
> harm the code

SELECTION is the OPPOSITE of random - you'd have to be even more slack-
witted than spintwitty to 'think' that natural selection is random.

How, EXACTLY, did you 'determine' that natural selection only works
within a species ? Fiat ?

Mutations alter the 'code' - whether any given change is good, bad, or
neutral depends on many factors.

> The selective process rearranges the existing code to give the
> desired results. Have you observed otherwise?

Where did you get the silly idea that natural selection does ANYTHING
to any code ?

All natural selection does is FILTER randomness - some changes are
good, some are bad, and some are neutral. The neutral and good
changes accumulate while the bad changes eventually get lost from the
gene pool.

Selective processes (like selective breeding) do much the same thing -
humans decide what VARIATIONS breed and which do not. No rearranging
of any code.

(M)-adman

unread,
Oct 16, 2008, 11:04:12 PM10/16/08
to
> So I see you have abandoned all those other threads you starter

I am not answering trolls

(M)-adman

unread,
Oct 16, 2008, 11:10:04 PM10/16/08
to

no

>
>> Besides, natural selection is chaotic, random.
>
> No it isn't. That's your big mistake.

outside forces can be quite random, unless you can predict a way to forecast
an ice age, or a sustained drought.

>
>> Code sequences and randomness
>> do not mix well. Randomness destroys the code.Take a computer
>> program that runs smooth and add some random characters. What will
>> you get? A broken code. Therefore randomness and code sequences are
>> mutually destructive to each other. The code will not read
>> randomness, and the randomness will stop the code. How can we come
>> to the conclusion that randomness gives rise to spontaneous birth of
>> an accurate code sequence? IOW, randomness in any code sequence
>> progressively destroys the code. Eventually you would destroy what
>> natural selection was trying to preserve in the first place by the
>> very nature of changing the code.
>
> Ah, you have confused natural selection with mutation. Mutation is
> random. Natural selection is not. You know you're out to lunch when
> even other creationists (e.g. Sean Pitman) tell you so.

Sean was correct on the grand canyon. That is all i saw correct.

>
>>>> Which equals an Author. A Creator. I like to call him/her God. You
>>>> can use whatever name you wish.
>>> Not so fast. There are a few other things that produce non-random
>>> results. Have you heard of natural selection, for example?
>>
>> Natural selection is random and works only within the species and
>> does not harm the code The selective process rearranges the existing
>> code to give the desired results. Have you observed otherwise?
>
> Yes. You understand nothing of evolution, selection, or genetics. That
> makes most of what you write into word salad, as above. Some of your
> nonsense can be reinterpreted to make true statements. Natural
> selection is indeed a process that works within species (or, we more
> often say, populations). Natural selection does indeed work on
> existing variation. "Code" has a particular meaning in genetics,
> which you are not approaching. The code is very, very seldom altered
> in any way. Coding sequences (very different from the code itself)
> are altered fairly frequently, by mutation. Some of these mutations
> are neutral, and selection ignores them. Some are deleterious, and
> selection eliminated them. Some are advantageous, and selection
> spreads them. Mutation is random; selection is not.

I was correct. Evolution is a crack pot idea.


>
>>>> DNA (found by brilliant scientists, btw) is God's handwriting.
>>>> Kinda like a computer program.
>>>>
>>>> Pretty cool eh?
>>> Sure, if you've been smoking pot with your frat buddies. If you
>>> think that's cool, have you ever looked at wallpaper? I mean
>>> *really* looked?
>>
>> ha! your humor shines through again.
>>
>> yes, i have *really* looked at wallpaper. I perfer paint. Paint is
>> easier to change when you are tired of it.
>>
>> I have Not noticed DNA sequences in wallpaper though. But i have
>> noticed randomness.
>>
>> If you have noticed DNA sequences in wallpaper, then please, pass
>> over what ever it is you have been smokiN.
>
> I think you've been smoking too much already. Time to come down.

no

'Rev Dr' Lenny Flank

unread,
Oct 16, 2008, 11:10:42 PM10/16/08
to


Sean, you can go ahead and tell Adman that he's an ignorant retard who
doesn't have a clue what he's yammering about. It's OK. God won't
strike you down for telling that to another creationist. (Although
ADMAN might threaten to Smite you or something -- snicker, giggle)


================================================
Lenny Flank
"There are no loose threads in the web of life"

Editor, Red and Black Publishers
http://www.RedandBlackPublishers.com

(M)-adman

unread,
Oct 17, 2008, 12:14:14 AM10/17/08
to

Only one of you eviloutionist caught this. And i intentionally left this
part in to see all the babble i would get.

Actually, it is not a red herring. When natural selection takes place within
the species, the DNA's natural filter restores the code. Tes, DNA can repair
itself to a point. The only changes made are within the existing code. There
is no introduction of coruption from outside the species when the species
evolves within the same species..

A Wolf and a Lion cannot mate and produce another species. But with enough
selection, natural or man manipulated, a wolf can evolve into a dog. Dogs
are within the species of wolfs. As the bible says: "each after their own
kind"

(M)-adman

unread,
Oct 17, 2008, 12:18:17 AM10/17/08
to
Prof Weird wrote:

> On Oct 16, 6:39?pm, "\(M\)-adman" <g...@hotmail.ed> wrote:
>> John Harshman wrote:
>>> (M)-adman wrote:
>>>> Do a test.
>>
>>>> 1) Take a 400 letter gene.
>>
>>>> 2) Find a monkey of your choice. (please give it a bath first)
>>
>>>> 3) Put the monkey in front of a keyboard (upright, on a chair, no
>>>> cigars, no pizza, no beer)
>>
>>>> 4) Allow the monkey to bang the keys (using a simple four letter
>>>> genetic alphabet)
>>
>>>> The odds against the monkey getting the correct order for the first
>>>> sequence? four to one.
>>
>>>> The odds against getting the second sequence correct? ?sixteen to

I do not think you have a firm GRIP ON REALITY.

You should READ THE BIBLE.

Lee Jay

unread,
Oct 17, 2008, 12:50:19 AM10/17/08
to
On Oct 16, 9:10 pm, "\(M\)-adman" <g...@hotmail.ed> wrote:
> outside forces can be quite random, unless you can predict a way to forecast
> an ice age, or a sustained drought.

Your original claim was:

> Sequenced DNA and proteins cannot be attributed to blind chance.(sorry)

That's called "moving the goal posts".

Now that it's been explained to you that selection (and chemistry)
causes DNA sequences to be non-random, you "move the goal posts" to
now claim that the environment is what is random, which has nothing to
do with your original (wrong) claim.

Any biology student that would make the claim you did in your original
post would be called a "liberal arts" major, possibly even a drop-out,
the next semester.

> I was correct. Evolution is a crack pot idea.

An assertion without support. Remember, evolution works, and many
successful industries base their products and services on it.

Lee Jay

Ken Shackleton

unread,
Oct 17, 2008, 12:59:13 AM10/17/08
to

What does that have to do with reality?

Vend

unread,
Oct 17, 2008, 2:58:53 AM10/17/08
to
On Oct 16, 11:32 pm, Seanpit <sean...@gmail.com> wrote:

> On Oct 16, 2:10 pm, "\(M\)-adman" <g...@hotmail.ed> wrote:
>
>
>
> > Do a test.
>
> > 1) Take a 400 letter gene.
>
> > 2) Find a monkey of your choice. (please give it a bath first)
>
> > 3) Put the monkey in front of a keyboard (upright, on a chair, no cigars, no
> > pizza, no beer)
>
> > 4) Allow the monkey to bang the keys (using a simple four letter genetic
> > alphabet)
>
> > The odds against the monkey getting the correct order for the first
> > sequence? four to one.
>
> > The odds against getting the second sequence correct?  sixteen to one.

>
> > The odds against getting the first three sequences correct? sixty-four to
> > one.
>
> > The chance the monkey can get the rest of the 397 sequences correct?  1
> > followed by 130 zeros
>
> > (ask spintronic for a mathematical formula if you doubt the calculation.)
>
> > Are we getting the picture yet?
>
> > I'll simplify:
>
> > Sequenced DNA and proteins cannot be attributed to blind chance.(sorry) The
> > odds are beyond astronomical.
>
> > Which equals an Author. A Creator. I like to call him/her God. You can use
> > whatever name you wish.
>
> > DNA (found by brilliant scientists, btw) is God's handwriting. Kinda like a
> > computer program.
>
> > Pretty cool eh?
>
> > hth
> > --
> > A cup of coffee and some truth with:
>
> > ·.¸Adman¸.·
> > ^^^^^^^^^^^
>
> You forget about the concept of natural selection as a guiding force
> to producing specific sequences.  What is your arguing for countering
> the likes of Richard Dawkins when the explanation of "Climbing Mt.
> Improbable" one tiny step at a time is given?  There is an answer.
> It's just that you haven't presented it here.  You need to do a bit
> better than this - - even from a creationist perspective.

Madman is a troll, perhaps not he is not even a creationist.

<snip>

richardal...@googlemail.com

unread,
Oct 17, 2008, 3:16:04 AM10/17/08
to
On Oct 17, 4:04 am, "\(M\)-adman" <g...@hotmail.ed> wrote:
> r norman wrote:
> > On Thu, 16 Oct 2008 16:10:54 -0500, "\(M\)-adman" <g...@hotmail.ed>


rnorman a troll?
There's a novel idea!
Bearing in mind that you snipped without marking a substative post (as
most of his posts are), how do you think that this example of utter
hypocrisy makes you look?

RF

J.J. O'Shea

unread,
Oct 17, 2008, 5:19:35 AM10/17/08
to
On Fri, 17 Oct 2008 03:16:04 -0400, richardal...@googlemail.com wrote
(in article
<fc8234c3-47eb-471c...@f63g2000hsf.googlegroups.com>):

He doesn't care.

spintronic

unread,
Oct 17, 2008, 5:40:02 AM10/17/08
to
On Oct 16, 10:59 pm, John Harshman <jharshman.diespam...@pacbell.net>
wrote:
> (M)-adman wrote:

> > Sequenced DNA and proteins cannot be attributed to blind chance.(sorry) The
> > odds are beyond astronomical.
>

> Agreed. Of course nobody claims that DNA and proteins can be attributed
> to blind chance, but that particular strawman is about your speed.


But you do attribute that to RNA world.

The first self replicating ribozyme was suppose to be about 50-80nt

It catalised the replication of two exact sequences 2*~30^4 = 1.6m

Both fragments cleave-fold and are now useless. Congrats.

The first ever self replicating ribozyme that replicates once, and
destroys
both copies. Kool.

Not to mention the fact that R.N.A degredation rates occur much faster
than
polymerization, so getting 50-80nt in the first place is rather rather
slim.

Now you can explain how R.N.A forms naturally.

Ilas

unread,
Oct 17, 2008, 6:32:20 AM10/17/08
to
"\(M\)-adman" <gr...@hotmail.ed> wrote in
news:ugUJk.50984$vX2....@bignews6.bellsouth.net:

> Only one of you eviloutionist caught this.

"Eviloutionist"? Oh, come on. People still don't think he's a troll?

wf3h

unread,
Oct 17, 2008, 6:38:49 AM10/17/08
to

unless, of course, random code sequences are functional and confer a
selective advantage

oh. adman didn't realize this could work.

J.J. O'Shea

unread,
Oct 17, 2008, 6:41:13 AM10/17/08
to
On Fri, 17 Oct 2008 06:32:20 -0400, Ilas wrote
(in article <Xns9B3A755E...@195.188.240.200>):

He _is_ overegging the pudding, isn't he?

r norman

unread,
Oct 17, 2008, 7:59:43 AM10/17/08
to

Just because I am not that tall, some people think I look grotesque,
and I live under a bridge?

Augray

unread,
Oct 17, 2008, 8:29:22 AM10/17/08
to
On Thu, 16 Oct 2008 22:10:04 -0500, "\(M\)-adman" <gr...@hotmail.ed>
wrote in <lkTJk.50949$vX2....@bignews6.bellsouth.net> :

>John Harshman wrote:

[snip]

>> Ah, you have confused natural selection with mutation. Mutation is
>> random. Natural selection is not. You know you're out to lunch when
>> even other creationists (e.g. Sean Pitman) tell you so.
>
>Sean was correct on the grand canyon. That is all i saw correct.

So everything else you saw there was incorrect?

[snip]

>>>>> Pretty cool eh?
>>>> Sure, if you've been smoking pot with your frat buddies. If you
>>>> think that's cool, have you ever looked at wallpaper? I mean
>>>> *really* looked?
>>>
>>> ha! your humor shines through again.
>>>
>>> yes, i have *really* looked at wallpaper. I perfer paint. Paint is
>>> easier to change when you are tired of it.
>>>
>>> I have Not noticed DNA sequences in wallpaper though. But i have
>>> noticed randomness.
>>>
>>> If you have noticed DNA sequences in wallpaper, then please, pass
>>> over what ever it is you have been smokiN.
>>
>> I think you've been smoking too much already. Time to come down.
>
>no

Apparently, the smoking will continue.

(M)-adman

unread,
Oct 17, 2008, 9:12:46 AM10/17/08
to

It is your best shot at finding truth.

(M)-adman

unread,
Oct 17, 2008, 9:10:34 AM10/17/08
to
Lee Jay wrote:
> On Oct 16, 9:10 pm, "\(M\)-adman" <g...@hotmail.ed> wrote:
>> outside forces can be quite random, unless you can predict a way to
>> forecast an ice age, or a sustained drought.
>
> Your original claim was:
>
>> Sequenced DNA and proteins cannot be attributed to blind
>> chance.(sorry)
>
> That's called "moving the goal posts".

Blind chance IS outside forces and they are random.

>
> Now that it's been explained to you that selection (and chemistry)
> causes DNA sequences to be non-random, you "move the goal posts" to
> now claim that the environment is what is random, which has nothing to
> do with your original (wrong) claim.

Excuse me, Natural means natural. As in (root word) nature. Nature is
unpredictable, even random. If natural selection is natural then it has to
conform to the definition of natural forces in nature. If not, then the term
"natural selection" is mis-defined. As I have said before, the theory of
evolution is not correct under it's current definition. This is just one
example.

>
> Any biology student that would make the claim you did in your original
> post would be called a "liberal arts" major, possibly even a drop-out,
> the next semester.
>

uh huh.

>> I was correct. Evolution is a crack pot idea.
>
> An assertion without support. Remember, evolution works, and many
> successful industries base their products and services on it.

got some examples?


>
> Lee Jay

(M)-adman

unread,
Oct 17, 2008, 9:11:40 AM10/17/08
to

You are the troll.

(M)-adman

unread,
Oct 17, 2008, 9:19:11 AM10/17/08
to

I have my reasons

> Bearing in mind that you snipped

garbage

John Harshman

unread,
Oct 17, 2008, 9:20:49 AM10/17/08
to

No, you can explain what that has to do with DNA sequences and proteins
being attributed to blind chance, or natural selection being random.

Kleuskes & Moos

unread,
Oct 17, 2008, 10:18:44 AM10/17/08
to
On 17 okt, 15:19, "\(M\)-adman" <g...@hotmail.ed> wrote:
<snip>

> >>> So I see you have abandoned all those other threads you starter
>
> >> I am not answering trolls
>
> > rnorman a troll?
> > There's a novel idea!

<unmarked snippage>
>
> I have my reasons
>

Main one being you don't know how to answer all those tricky
questions? How to take a point someone else makes? Because you don't
want to admit you've been told off by people who actually *know* what
they're talking about?

James Beck

unread,
Oct 17, 2008, 10:15:04 AM10/17/08
to
In article <c3OJk.42775$IB6....@bignews8.bellsouth.net>,
gr...@hotmail.ed says...
>
> Do a test.

You fail.
Why don't you take this shit somewhere else?

Prof Weird

unread,
Oct 17, 2008, 11:20:26 AM10/17/08
to

Stated (M)adman to the face in the mirror as he EVADES with a
simpering one-line dismissal. As usual.
(At least the first four words of your 'response' are correct ...)

> You should READ THE BIBLE.

RiiIIiiIIiiIIiiIGHT ! Ludicrous 'interpretations' of an ancient
collection of morality tales is more useful to biology and
understanding the REAL world than actually examining THE REAL WORLD.
(that's sarcasm BTW)

And just HOW, exactly, does whining 'GODDIDIT !!!1!1!!!!' qualify as a
useful or productive answer ?

It is a dead end. A complete STOP to investigation and learning.

It is the epitome of arrogance to assume that if YOU can't figure
something out, the ONLY possible explanation is 'GAWDDIDIT !!1!!!!
1!!!!'

>
> --
> A cup of dung and some delusions from :
>
> ·.¸Adman¸.·
> ^^^^^^^^^^^
>
> My List of confirmed liars (anyone I disagree with that has defeated me)
> 1) J.J. O'Shea

Now your sig line is closer to being correct

Grandbank

unread,
Oct 17, 2008, 11:31:55 AM10/17/08
to
On Oct 17, 7:15 am, James Beck <j...@reallykillersystems.com> wrote:
> In article <c3OJk.42775$IB6.14...@bignews8.bellsouth.net>,
> g...@hotmail.ed says...

>
>
>
> > Do a test.
>
> You fail.
> Why don't you take this shit somewhere else?

Sadly, this *is* somewhere else.


KP

spintronic

unread,
Oct 17, 2008, 12:30:44 PM10/17/08
to
On Oct 17, 2:20 pm, John Harshman <jharshman.diespam...@pacbell.net>


Sure. I'll do one better.

2 words.

Okazaki fragment.

Lets ignore all of the many proteins involved in replication.


helicase

binding proteins

topoisomerase

etc etc.


And just concentrate on a few of the proteins that write the DNA
backwards, on the Okazaki fragment..

-----------------

RNA primase

DNA PolymeraseIII
DNA Polymerase I
DNA Ligase

-----------------

Now I haven't looked at how long theses sequences are yet.

But the "Okazaki fragment" cannot be written correctly without any
one of them.

So in essence we require a "specific" % of some sequence to have a
working model.

Now, say we pick "DNA Polymerase I" as a test case.


Because this is a *required* essential protein. And tehre is no way
the
Okazaki fragment can be completed without it.

You have 4^(whatever that sequence length is).

Which, I am guessing is a very very very very large number.

And selection doesn't cut it, because the "Okazaki fragment" is
either
written or it isn't.


Your turn.

spintronic

unread,
Oct 17, 2008, 12:40:41 PM10/17/08
to
On Oct 17, 4:20 pm, Prof Weird <pol...@msx.dept-med.pitt.edu> wrote:
> On Oct 17, 12:18 am, "\(M\)-adman" <g...@hotmail.ed> wrote:

> Stated (M)adman to the face in the mirror


Lol. This guy says that to everyone.

My best guess is that it is a daily ritual of his, and he assumes
others
do the same.

Best leave the skitzos to their projections.

spintronic

unread,
Oct 17, 2008, 12:47:49 PM10/17/08
to

Here is a nice video for evo-sticks and creative people alike.

http://uk.youtube.com/watch?v=4jtmOZaIvS0&feature=related

Lee Jay

unread,
Oct 17, 2008, 12:44:39 PM10/17/08
to
On Oct 17, 7:10 am, "\(M\)-adman" <g...@hotmail.ed> wrote:
> Lee Jay wrote:
> > On Oct 16, 9:10 pm, "\(M\)-adman" <g...@hotmail.ed> wrote:
> >> outside forces can be quite random, unless you can predict a way to
> >> forecast an ice age, or a sustained drought.
>
> > Your original claim was:
>
> >> Sequenced DNA and proteins cannot be attributed to blind
> >> chance.(sorry)
>
> > That's called "moving the goal posts".
>
> Blind chance IS outside forces and they are random.

Random changes to the environment do not necessarily result in random
DNA sequences. Your original claim was that the sequences themselves
were totally randomly generated by evolution - evolution makes no such
claim, and in fact claims the opposite, that certain sequences are
selected by survival to procreation and the heritability of those
sequences. 4^n does not apply.

> > Now that it's been explained to you that selection (and chemistry)
> > causes DNA sequences to be non-random, you "move the goal posts" to
> > now claim that the environment is what is random, which has nothing to
> > do with your original (wrong) claim.
>
> Excuse me, Natural means natural. As in (root word) nature. Nature is
> unpredictable, even random.

You seem extremely confused about nature. The uncertainty principle
does say that there is some inherent uncertainty in nature in certain
ways, but the laws of physics create a great deal of predictability
and non-randomness in nature. Crystals, from salt to snow flakes are
examples of the laws of physics creating order from randomness without
the intervention of an intelligent agent. DNA, like everything else,
is subject to the laws of physics, and therefore chemistry as well.

> If natural selection is natural then it has to
> conform to the definition of natural forces in nature. If not, then the term
> "natural selection" is mis-defined.

No it's not, you just don't understand it. Throwing dirt through a
sieve is a natural process, yet the result is specific. That's a form
of selection, in this case, selection by size.

> >> I was correct. Evolution is a crack pot idea.
>
> > An assertion without support.  Remember, evolution works, and many
> > successful industries base their products and services on it.
>
> got some examples?

Actually, I can't say it any better than this, which was a direct
response to one of your questions:

http://groups.google.com/group/talk.origins/msg/058320f6d6d17c09

Lee Jay

Ye Old One

unread,
Oct 17, 2008, 1:34:16 PM10/17/08
to
On Fri, 17 Oct 2008 08:12:46 -0500, "\(M\)-adman" <gr...@hotmail.ed>
enriched this group when s/he wrote:

>Ken Shackleton wrote:
>> On Oct 16, 10:18 pm, "\(M\)-adman" <g...@hotmail.ed> wrote:
>>> Prof Weird wrote:
>>>> On Oct 16, 6:39?pm, "\(M\)-adman" <g...@hotmail.ed> wrote:
>>>>> John Harshman wrote:
>>>>>> (M)-adman wrote:
>>>>>>> Do a test.
>>>

[snip]


>>>> Selective processes (like selective breeding) do much the same
>>>> thing - humans decide what VARIATIONS breed and which do not. No
>>>> rearranging of any code.
>>>
>>> I do not think you have a firm GRIP ON REALITY.
>>>
>>> You should READ THE BIBLE.
>>
>> What does that have to do with reality?
>
>It is your best shot at finding truth.

Well he wouldn't find much truth in the bible.

--
Bob.

Prof Weird

unread,
Oct 17, 2008, 1:38:54 PM10/17/08
to

But the DNA is NOT written backwards, twit ! Okazaki fragments are
generated BECAUSE DNA can only be synthesized in the 5' to 3'
direction. One strand of DNA has continuous synthesis, while the
other anti-parallel strand can't - it would have to be synthesized
backwards (3' to 5') to be continuous. Since no polymerase works in
that direction, synthesis must be discontinous; thus, you get Okazaki
fragments.

You seem to have this pathological need to demonstrate your limited
and naive understanding of biology, and the silly notion that your
ignorant opinions are of any relevance.


>
> -----------------
>
> RNA primase
>
> DNA PolymeraseIII
> DNA Polymerase I
> DNA Ligase
>
> -----------------
>
> Now I haven't looked at how long theses sequences are yet.

RNA primase, DNA polymerase III, DNA polymerase I, and DNA ligase ARE
ENZYMES, BUFFOON !

They are not nucleotide sequences.

Oh, THAT'S RIGHT ! You're an idiot ! You actually 'think' the whole
system had to fall together all at once purely by chance, just so your
mathematical masturbations can come close to even LOOKING relevant !

> But the "Okazaki fragment" cannot be written correctly without any
> one of them.

Okazaki fragments are DNA, twit. TEMPLATED from one strand of DNA,
buffoon; thus they can indeed be written correctly, since THAT IS HOW
NORMAL DOUBLE STRANDED DNA IS REPLICATED.

> So in essence we require a "specific" % of some sequence to have a
> working model.
>
> Now, say we pick "DNA Polymerase I" as a test case.
>
> Because this is a *required* essential protein. And tehre is no way
> the
> Okazaki fragment can be completed without it.
>
> You have 4^(whatever that sequence length is).

Okazaki fragments are DNA TEMPLATED from one strand of genomic DNA,
twit. DNA polymerase I catalyzes reactions dATP pairs against T, and
dCTP pairs against G. So AT NO FRECKING POINT IS DNA BEING ASSEMBLED
RANDOMLY; thus, your blithering ignorance is displayed once again.

Or are you actually STUPID enough to imply that DNA poly I had to form
all at once PURELY by chance ?

> Which, I am guessing is a very very very very large number.

And utterly meaningless, since OKAZAKI FRAGMENTS ARE TEMPLATED, NOT
RANDOMLY ASSEMBLED !

Nor does any sane or rational person believe any enzyme fell together
all at once purely by chance - that is the domain of creotards,
IDiots, and theoloons.

> And selection doesn't cut it, because the "Okazaki fragment" is
> either written or it isn't.

Once again, simpleton : Okazaki fragments are TEMPLATED from DNA; they
are NOT random sequences.

They are a side effect of discontinous synthesis. In fact, DNA
polymerase I has PROOF-READING ABILITY - if the base it adds to the 3'
end of the chain doesn't match the TEMPLATE, it removes it and tries
again.

So you have failed to explain 'what any of this has to do with DNA


sequences and proteins being attributed to blind chance, or natural

selection being random.'

Dwib

unread,
Oct 17, 2008, 1:41:11 PM10/17/08
to
On Oct 16, 7:39 pm, "\(M\)-adman" <g...@hotmail.ed> wrote:
> Natural selection is random, unpredictable, depends on too many other
> circumstances.

For individuals of a species, Natural Selection may seem random but
pretty darned unfair. Who wants to get eaten by a lion or starve when
the climate turns dry!

Dwib

spintronic

unread,
Oct 17, 2008, 1:46:41 PM10/17/08
to
Here we go. The mirror guy.


On Oct 17, 6:38 pm, Prof Weird <pol...@msx.dept-med.pitt.edu> wrote:
> On Oct 17, 12:30 pm, spintronic <spintro...@hotmail.com> wrote:


> But the DNA is NOT written backwards, twit !  

Oh dear.


In fact. Oh fucking Oh dear.


Could someone (who understands) tell this moron what a tit he is?

<snip>

I await your responses.

Prof Weird

unread,
Oct 17, 2008, 1:45:57 PM10/17/08
to
On Oct 17, 12:40 pm, spintronic <spintro...@hotmail.com> wrote:
> On Oct 17, 4:20 pm, Prof Weird <pol...@msx.dept-med.pitt.edu> wrote:
>
> > On Oct 17, 12:18 am, "\(M\)-adman" <g...@hotmail.ed> wrote:
> > Stated (M)adman to the face in the mirror
>
> Lol. This guy says that to everyone.

No - just to blithering idiots that 'think' their uninformed opinions
are more relevant than actual knowledge and understanding. And
arrogant posturing buffoons that 'think' their posturing is of any
relevance, or that their ignorance is evidence of anything except
their own ignorance. Fortunately, no one is limited to your absymal
understanding of anything - if they were, we'd still be living in
caves and poking things with sticks, living in terror of Storm Gods
and other nonesuch.

> My best guess is that it is a daily ritual of his, and he assumes
> others do the same.

Armchair psychology from a oaf that thinks chromosomes leap about the
animal kingdom willy-nilly, confounding any and all phylogenies. That
thinks his posturing and bellicose assertions are convincing to anyone
but himself and those even more slack-witted than him.

> Best leave the skitzos to their projections.

If you projected any more, you could rent yourself out at drive-in
movies.

spintronic

unread,
Oct 17, 2008, 1:50:59 PM10/17/08
to
On Oct 17, 6:38 pm, Prof Weird <pol...@msx.dept-med.pitt.edu> wrote:
> On Oct 17, 12:30 pm, spintronic <spintro...@hotmail.com> wrote:


> > -----------------
>
> > RNA primase
>
> > DNA PolymeraseIII
> > DNA Polymerase I
> > DNA Ligase
>
> > -----------------
>
> > Now I haven't looked at how long theses sequences are yet.
>
> RNA primase, DNA polymerase III, DNA polymerase I, and DNA ligase ARE
> ENZYMES, BUFFOON !
>


Watch this guys. ITS FUCKING FUNNY AS HELL.

********************************************

> They are not nucleotide sequences. <prof weird wrote this!


***********************************************


Yes he did say that, and yes he does scream at mirrors.


LMFAO.


Should I find you their sequences for you?


spintronic

unread,
Oct 17, 2008, 2:01:10 PM10/17/08
to
Hang on, this is the best. Or its in my top 3.


On Oct 17, 6:38 pm, Prof Weird <pol...@msx.dept-med.pitt.edu> wrote:

> On Oct 17, 12:30 pm, spintronic <spintro...@hotmail.com> wrote:


> But the DNA is NOT written backwards, twit !  Okazaki fragments are
> generated BECAUSE DNA can only be synthesized in the 5' to 3'


Lets say this direction

1)---2)-----3)-----4)-------5)------------------>

> One strand of DNA has continuous synthesis, while the
> other anti-parallel strand can't

Hmm.

> it would have to be synthesized backwards (3' to 5') to be continuous.
> Since no polymerase works in that direction, synthesis must be discontinous;
> thus, you get Okazaki fragments.


You mean like this

5)----> 4)---> 3)---> 2)----> 1)--->


I have 0 doubt in my mind that you are not a professor.


I think your a binman or serve some other function.

Perhaps you shine shoes for a living.


But if *people* do call you "prof".

More fool them!

> > But the "Okazaki fragment" cannot be written correctly without any
> > one of them.
>
> Okazaki fragments are DNA, twit.


And?

>  TEMPLATED from one strand of DNA,
> buffoon; thus they can indeed be written correctly, since THAT IS HOW
> NORMAL DOUBLE STRANDED DNA IS REPLICATED.


You are such a bafoon. I will ask you one very simple question and
then
leave you to scream at your mirrors.

**************************************************************


How were they written correctly before all the parts came together as
a whole?


****************************************************************


Kleuskes & Moos

unread,
Oct 17, 2008, 2:11:31 PM10/17/08
to

Even with my very limited knowledge of biology (about college-level) i
know that names ending in -ase denote enzymes. So yes please...

Show us the sequence.

(M)-adman

unread,
Oct 17, 2008, 2:18:52 PM10/17/08
to
Vend wrote:
> On Oct 16, 11:32 pm, Seanpit <sean...@gmail.com> wrote:

>> On Oct 16, 2:10 pm, "\(M\)-adman" <g...@hotmail.ed> wrote:
>>
>>
>>
>>> Do a test.
>>
>>> 1) Take a 400 letter gene.
>>
>>> 2) Find a monkey of your choice. (please give it a bath first)
>>
>>> 3) Put the monkey in front of a keyboard (upright, on a chair, no
>>> cigars, no pizza, no beer)
>>
>>> 4) Allow the monkey to bang the keys (using a simple four letter
>>> genetic alphabet)
>>
>>> The odds against the monkey getting the correct order for the first
>>> sequence? four to one.
>>
>>> The odds against getting the second sequence correct? sixteen to

>>> one.
>>
>>> The odds against getting the first three sequences correct?
>>> sixty-four to one.
>>
>>> The chance the monkey can get the rest of the 397 sequences
>>> correct? 1 followed by 130 zeros
>>
>>> (ask spintronic for a mathematical formula if you doubt the
>>> calculation.)
>>
>>> Are we getting the picture yet?
>>
>>> I'll simplify:
>>
>>> Sequenced DNA and proteins cannot be attributed to blind
>>> chance.(sorry) The odds are beyond astronomical.
>>
>>> Which equals an Author. A Creator. I like to call him/her God. You
>>> can use whatever name you wish.
>>
>>> DNA (found by brilliant scientists, btw) is God's handwriting.
>>> Kinda like a computer program.
>>
>>> Pretty cool eh?
>>
>>> hth
>>> --
>>> A cup of coffee and some truth with:
>>
>>> ·.¸Adman¸.·
>>> ^^^^^^^^^^^
>>
>> You forget about the concept of natural selection as a guiding force
>> to producing specific sequences. What is your arguing for countering
>> the likes of Richard Dawkins when the explanation of "Climbing Mt.
>> Improbable" one tiny step at a time is given? There is an answer.
>> It's just that you haven't presented it here. You need to do a bit
>> better than this - - even from a creationist perspective.
>
> Madman is a troll, perhaps not he is not even a creationist.
>
> <snip>

With all the real trolls around here, you call me a troll?

umm..no.

you got poor judgement


--
A cup of coffee and some truth with:

·.¸Adman¸.·
^^^^^^^^^^^


My List of confirmed liars

spintronic

unread,
Oct 17, 2008, 2:23:38 PM10/17/08
to
> Show us the sequence.- Hide quoted text -
>
> - Show quoted text -

Down shep.


It's a readily available sequence. (you can find yourself)

Im sure John or mirror guy may post it soon.

If they don't. I will.

The sequence is irrelivent. It's the length that s important.

John, adman, mirror guy and myself know this basic fact.

But only 2 of us know it blows evolution out of the water.

(M)-adman

unread,
Oct 17, 2008, 2:24:17 PM10/17/08
to
Lee Jay wrote:
> On Oct 17, 7:10 am, "\(M\)-adman" <g...@hotmail.ed> wrote:
>> Lee Jay wrote:
>>> On Oct 16, 9:10 pm, "\(M\)-adman" <g...@hotmail.ed> wrote:
>>>> outside forces can be quite random, unless you can predict a way to
>>>> forecast an ice age, or a sustained drought.
>>
>>> Your original claim was:
>>
>>>> Sequenced DNA and proteins cannot be attributed to blind
>>>> chance.(sorry)
>>
>>> That's called "moving the goal posts".
>>
>> Blind chance IS outside forces and they are random.
>
> Random changes to the environment do not necessarily result in random
> DNA sequences. Your original claim was that the sequences themselves
> were totally randomly generated by evolution - evolution makes no such
> claim, and in fact claims the opposite, that certain sequences are
> selected by survival to procreation and the heritability of those
> sequences. 4^n does not apply.

Good, cause i did not make such a claim either. What i did say was natural
selection is random. Nature proves that


>
>>> Now that it's been explained to you that selection (and chemistry)
>>> causes DNA sequences to be non-random, you "move the goal posts" to
>>> now claim that the environment is what is random, which has nothing
>>> to do with your original (wrong) claim.
>>
>> Excuse me, Natural means natural. As in (root word) nature. Nature is
>> unpredictable, even random.
>
> You seem extremely confused about nature. The uncertainty principle
> does say that there is some inherent uncertainty in nature in certain
> ways, but the laws of physics create a great deal of predictability
> and non-randomness in nature. Crystals, from salt to snow flakes are
> examples of the laws of physics creating order from randomness without
> the intervention of an intelligent agent. DNA, like everything else,
> is subject to the laws of physics, and therefore chemistry as well.

If nature is as ordered as you say, then you proved evolution is wrong.
Evolution is based not on order but changes.


>
>> If natural selection is natural then it has to
>> conform to the definition of natural forces in nature. If not, then
>> the term "natural selection" is mis-defined.
>
> No it's not, you just don't understand it. Throwing dirt through a
> sieve is a natural process, yet the result is specific. That's a form
> of selection, in this case, selection by size.

oh, so evolution gets to pick and choose the selection.
riiiiiiight!

(M)-adman

unread,
Oct 17, 2008, 2:30:12 PM10/17/08
to
Kleuskes & Moos wrote:
> On 17 okt, 15:19, "\(M\)-adman" <g...@hotmail.ed> wrote:
> <snip>
>
>>>>> So I see you have abandoned all those other threads you starter
>>
>>>> I am not answering trolls
>>
>>> rnorman a troll?
>>> There's a novel idea!
>
> <unmarked snippage>
>>
>> I have my reasons
>>
>
> Main one being you don't know how to answer all those tricky
> questions?

nope

>How to take a point someone else makes?

\
nope. that is not correct either

>Because you don't
> want to admit you've been told off by people who actually *know* what
> they're talking about?

You are not a programer.

it is THAT simple.

Prof Weird

unread,
Oct 17, 2008, 2:38:53 PM10/17/08
to

Projecting again, eh spintwitty ?

I suppose you have to, given you have more than enough mental defects
to go 'round. Saves the trouble of actually UNDERSTANDING or
COMPREHENDING anything.

In the CONTEXT of what you were blithering about, they are indeed
enzymes, not nucleotides sequences.

But, then again, since you don't know what the freck you are talking
about, how could you know you're an idiot incapable of stating
anything clearly enough to be understood ? After all, Okazaki
fragments are NOT 'read backwards' as you stated.

RNA primase, DNA poly I, DNA poly III etc are enzymes whose amino acid
sequence is 'encoded' by DNA.

As all living critters are the end result of 3.5+ billion years of
evolution, what sane or rational person would think the original forms
would be as complex or accurate ?

What kind of simpering twit would 'calculate' the odds of a RANDOMLY
ASSEMBLED sequence matching up to a predetermined sequence, given the
FACT that that is NOTHING like how actual evolution works ? All that
does is generate a huge but MEANINGLESS number.

But, then again, you have exhibited a pathological attraction to
meaningless data and a psychotic need to parade it about as if it
meant anything at all.

spintronic

unread,
Oct 17, 2008, 2:59:58 PM10/17/08
to
On Oct 17, 7:38 pm, Prof Weird <pol...@msx.dept-med.pitt.edu> wrote:
> On Oct 17, 1:50 pm, spintronic <spintro...@hotmail.com> wrote:
>
>
>
> > On Oct 17, 6:38 pm, Prof Weird <pol...@msx.dept-med.pitt.edu> wrote:
>
> > > On Oct 17, 12:30 pm, spintronic <spintro...@hotmail.com> wrote:
> > > > -----------------
>
> > > > RNA primase
>
> > > > DNA PolymeraseIII
> > > > DNA Polymerase I
> > > > DNA Ligase
>
> > > > -----------------
>
> > > > Now I haven't looked at how long theses sequences are yet.
>
> > > RNA primase, DNA polymerase III, DNA polymerase I, and DNA ligase ARE
> > > ENZYMES, BUFFOON !
>
> > Watch this guys. ITS FUCKING FUNNY AS HELL.
>
> > ********************************************
>
> > > They are not nucleotide sequences. <prof weird wrote this!
>
> > ***********************************************
>
> > Yes he did say that, and yes he does scream at mirrors.
>
> > LMFAO.
>
> Projecting again, eh spintwitty ?


You are a boon, so I will ask very simple questions.

"Can DNA, Okazaki fragment's, be duplicated without DNA
"Polymerase I" in modern cells"?

Prof Weird

unread,
Oct 17, 2008, 3:09:47 PM10/17/08
to
On Oct 17, 2:01 pm, spintronic <spintro...@hotmail.com> wrote:
> Hang on, this is the best. Or its in my top 3.
>
> On Oct 17, 6:38 pm, Prof Weird <pol...@msx.dept-med.pitt.edu> wrote:
>
> > On Oct 17, 12:30 pm, spintronic <spintro...@hotmail.com> wrote:
> > But the DNA is NOT written backwards, twit !  Okazaki fragments are
> > generated BECAUSE DNA can only be synthesized in the 5' to 3'
>
> Lets say this direction
>
> 1)---2)-----3)-----4)-------5)------------------>
>
> > One strand of DNA has continuous synthesis, while the
> > other anti-parallel strand can't
>
> Hmm.

Do you always say 'Hmm' to accurate data you can't/won't understand ?

> >  it would have to be synthesized backwards (3' to 5') to be continuous.
> > Since no polymerase works in that direction, synthesis must be discontinous;
> > thus, you get Okazaki fragments.
>
> You mean like this
>
> 5)----> 4)---> 3)---> 2)----> 1)--->

Not even close, twit. Look up 'Okazaki fragments' on google to see
just how frecking stupid you're being.

DNA is double stranded, antiparallel. DNA sequence is read in the
5' (phosphate) to 3' (hydroxyl) end.

As in 5' AGGATATATTTTACACACATTATATTA 3'
--------3' TCCTATATAAAATGTGTGTAATATAAT 5'

As DNA synthesis can only go in one direction (5' to 3'), when dealing
with a replication fork have :

3'-------------------------------------------------------------------------
RF
5' primer --bases added continously on this end-->3' (synthesis goes
continuously towards fork)


and the other strand is :
5'-------------------------------------------------------------------
RF

Note that it is NOT possible to synthesize continuously towards the
fork. Which is WHY Okazaki fragments show up :

5'
----------------------------------------------------------------------
RF
3'<-----------------**5'..3'<-----------------------------**5' (where
** represent RNA primers)

Thus, twit, Okazaki fragments are NOT 'read backwards' as you so
simple-mindedly assert; synthesis is ALWAYS 5' to 3'.

Spintwitty attempts standard hollow and delusional posturing :

> I have 0 doubt in my mind that you are not a professor.
>
> I think your a binman or serve some other function.
>
> Perhaps you shine shoes for a living.
>
> But if *people* do call you "prof".
>
> More fool them!

I have a Master's degree in biology with 15 years experience in
recombinant DNA tech. Thus you are wrong about my qualifications (not
like I was actually EXPECTING you to be right about anything; you seem
congenitally incapable of it).

I use the name 'Prof Weird' as a nod to Doctor Strange and Doctor
Who. It also makes a nice target when fools need to escape (they can
go after the username AS IF IT MEANT SOMETHING).

If I used the title 'God, Thine Lord and Master' would you presume
that I was the ruler of the universe ?

> You are such a bafoon. I will ask you one very simple question and
> then leave you to scream at your mirrors.

I'm not the one screaming at mirrors, twit - you and (m)adman are
every time you claim authority in things you obviously do not
understand.

> **************************************************************
>
> How were they written correctly before all the parts came together as
> a whole ?
>
> ****************************************************************

They are 'written correctly' because DNA synthesis is a templated
reaction. For BOTH strands, twit. The same kind of polymerases work
for making Okazaki fragments and the other DNA strand; they are NOT a
special case.

How, EXACTLY, did you 'determine' that the way the system is now is
the way it always was ? That your numerology is of any actual
relevance ?

Oh, right - spintwittian arrogance. If'n spintwitty SAYS 'X be true!
11!1!!!!', then X be true without any further thought or questioning
permitted.

How, EXACTLY, does invoking the unknowable whim of an unknowable being
qualify as an explanation ? It doesn't further understanding of
anything one bit.

In words simple enough for you to understand : "GAWDDIDIT !!11!!!!!"
is not a useful explanation. It is an intellectual dead end.

r norman

unread,
Oct 17, 2008, 4:14:33 PM10/17/08
to

I can't follow all the silliness in these posts so could you please
tend me which of us is "mirror guy"?

r norman

unread,
Oct 17, 2008, 4:21:33 PM10/17/08
to

Sequences are readily available. For protein, go to "NCBI Protein" at
http://www.ncbi.nlm.nih.gov/sites/entrez?db=Protein&itool=toolbar
and enter the protein name. Select one of the entries to see the
sequence. For example, "DNA polymerase III" produces 29000 hits .

Interpreting what it all means is quite another story. As you might
imagine, an awful lot of nonsense is generated by people who naively
take whatever sequence they find at face value.


johnetho...@yahoo.com

unread,
Oct 17, 2008, 4:23:07 PM10/17/08
to
On Oct 16, 8:04 pm, "\(M\)-adman" <g...@hotmail.ed> wrote:
> r norman wrote:
> > On Thu, 16 Oct 2008 16:10:54 -0500, "\(M\)-adman" <g...@hotmail.ed>

> > wrote:
>
> >> Do a test.
>
> >> 1) Take a 400 letter gene.
>
> >> 2) Find a monkey of your choice. (please give it a bath first)
>
> >> 3) Put the monkey in front of a keyboard (upright, on a chair, no
> >> cigars, no pizza, no beer)
>
> >> 4) Allow the monkey to bang the keys (using a simple four letter
> >> genetic alphabet)
>
> >> The odds against the monkey getting the correct order for the first
> >> sequence? four to one.
>
> >> The odds against getting the second sequence correct? sixteen to
> >> one.
>
> >> The odds against getting the first three sequences correct?
> >> sixty-four to one.
>
> >> The chance the monkey can get the rest of the 397 sequences correct?
> >> 1 followed by 130 zeros
>
> >> (ask spintronic for a mathematical formula if you doubt the
> >> calculation.)
>
> >> Are we getting the picture yet?
>
> >> I'll simplify:
>
> >> Sequenced DNA and proteins cannot be attributed to blind
> >> chance.(sorry) The odds are beyond astronomical.
>
> >> Which equals an Author. A Creator. I like to call him/her God. You
> >> can use whatever name you wish.
>
> >> DNA (found by brilliant scientists, btw) is God's handwriting. Kinda
> >> like a computer program.
>
> >> Pretty cool eh?
>
> >> hth
>
> > So I see you have abandoned all those other threads you starter
>
> I am not answering trolls

Note: When adman uses the word "troll" he means someone who actually
knows something about a subject.. He usually uses it when he has made
various false statements about a subject he knows nothing about, and
the person in question replies in a way that makes adman's ignorance
obvious.

John Harshman

unread,
Oct 17, 2008, 4:22:07 PM10/17/08
to
Sure. I'll ask again what this has to do with DNA sequences and proteins
being attributed to blind chance, or natural selection being random.

John Harshman

unread,
Oct 17, 2008, 4:27:28 PM10/17/08
to

Only in eukaryotes, that is, and they're needed because eukaryotes have
long, linear chromosomes in which only a small portion of the chromosome
is uncoiled at any time. Prokaryotes have much simpler replication of
smaller, circular chromosomes, without Okazaki fragments, replication
being similar for both strands. Hey, I wonder if one sort of replication
could evolve gradually into the other.

[snip]

> So you have failed to explain 'what any of this has to do with DNA
> sequences and proteins being attributed to blind chance, or natural
> selection being random.'

That would be the important point. Don't hold your breath.

Lee Jay

unread,
Oct 17, 2008, 4:26:21 PM10/17/08
to
On Oct 17, 12:24 pm, "\(M\)-adman" <g...@hotmail.ed> wrote:
> Lee Jay wrote:
> > On Oct 17, 7:10 am, "\(M\)-adman" <g...@hotmail.ed> wrote:
> >> Lee Jay wrote:
> >>> On Oct 16, 9:10 pm, "\(M\)-adman" <g...@hotmail.ed> wrote:
> >>>> outside forces can be quite random, unless you can predict a way to
> >>>> forecast an ice age, or a sustained drought.
>
> >>> Your original claim was:
>
> >>>> Sequenced DNA and proteins cannot be attributed to blind
> >>>> chance.(sorry)
>
> >>> That's called "moving the goal posts".
>
> >> Blind chance IS outside forces and they are random.
>
> > Random changes to the environment do not necessarily result in random
> > DNA sequences.  Your original claim was that the sequences themselves
> > were totally randomly generated by evolution - evolution makes no such
> > claim, and in fact claims the opposite, that certain sequences are
> > selected by survival to procreation and the heritability of those
> > sequences.  4^n does not apply.
>
> Good, cause i did not make such a claim either. What i did say was natural
> selection is random. Nature proves that

You implied it, and you just did again.

> >>> Now that it's been explained to you that selection (and chemistry)
> >>> causes DNA sequences to be non-random, you "move the goal posts" to
> >>> now claim that the environment is what is random, which has nothing
> >>> to do with your original (wrong) claim.
>
> >> Excuse me, Natural means natural. As in (root word) nature. Nature is
> >> unpredictable, even random.
>
> > You seem extremely confused about nature.  The uncertainty principle
> > does say that there is some inherent uncertainty in nature in certain
> > ways, but the laws of physics create a great deal of predictability
> > and non-randomness in nature.  Crystals, from salt to snow flakes are
> > examples of the laws of physics creating order from randomness without
> > the intervention of an intelligent agent.  DNA, like everything else,
> > is subject to the laws of physics, and therefore chemistry as well.
>
> If nature is as ordered as you say, then you proved evolution is wrong.
> Evolution is based not on order but changes.

Changes can be ordered.

> >> If natural selection is natural then it has to
> >> conform to the definition of natural forces in nature. If not, then
> >> the term "natural selection" is mis-defined.
>
> > No it's not, you just don't understand it.  Throwing dirt through a
> > sieve is a natural process, yet the result is specific.  That's a form
> > of selection, in this case, selection by size.
>
> oh, so evolution gets to pick and choose the selection.
> riiiiiiight!

"Pick and choose" is another way to say "selection".

Now that you're cornered, you're resorting to moving the goal posts,
word salad, lying about what you are claiming, and redefining common
terms. Admitting you were wrong (or are a Loki) would be less
painful.

Lee Jay

John Harshman

unread,
Oct 17, 2008, 4:29:12 PM10/17/08
to
He's right. DNA is "written" in one direction only, 5' to 3'. Now since
the two strands are antiparallel, 5' to 3' on one strand is opposite to
5' to 3' on the other strand. But it's all the same direction from the
DNA's point of view.

spintronic

unread,
Oct 17, 2008, 4:37:23 PM10/17/08
to
On Oct 17, 9:29 pm, John Harshman <jharshman.diespam...@pacbell.net>
wrote:
> DNA's point of view.- Hide quoted text -

>
> - Show quoted text -

Yes but its a matter of Semantics.

Of course DNA is written from 5' to 3' on both strands.

But if they were written in the same direction, you would not require
the extra proteins to write the Okazaki fragment's.

John Harshman

unread,
Oct 17, 2008, 4:52:57 PM10/17/08
to
spintronic wrote:
> On Oct 17, 9:29 pm, John Harshman <jharshman.diespam...@pacbell.net>
> wrote:
>> spintronic wrote:
>>> Here we go. The mirror guy.
>>> On Oct 17, 6:38 pm, Prof Weird <pol...@msx.dept-med.pitt.edu> wrote:
>>>> On Oct 17, 12:30 pm, spintronic <spintro...@hotmail.com> wrote:
>>>> But the DNA is NOT written backwards, twit !
>>> Oh dear.
>>> In fact. Oh fucking Oh dear.
>>> Could someone (who understands) tell this moron what a tit he is?
>>> <snip>
>>> I await your responses.
>> He's right. DNA is "written" in one direction only, 5' to 3'. Now since
>> the two strands are antiparallel, 5' to 3' on one strand is opposite to
>> 5' to 3' on the other strand. But it's all the same direction from the
>> DNA's point of view.

>

> Yes but its a matter of Semantics.
>
> Of course DNA is written from 5' to 3' on both strands.
>
> But if they were written in the same direction, you would not require
> the extra proteins to write the Okazaki fragment's.

All depends on what "direction" means. I would never have said that any
DNA is written backwards. It's just bad writing to make that claim. And
have you figured out yet that not all life has Okazaki fragments?

Prof Weird

unread,
Oct 17, 2008, 7:23:26 PM10/17/08
to
> "Polymerase I" in modern cells"?- Hide quoted text -

>
> - Show quoted text -

No. Your point being what ? The gibbering invocation of the (yawn)
Argument from Personal Incredulity - "if me not figure it out, ONLY
explanation be GAWDDIDIT !!!1!!11!1" ?

Templated replication has been the norm for about 3.5+ billion years
or so, AFAACT.

Your numerology (ie, calculating the 'odds' that modern DNA polymerase
I would arise all at once purely by chance billions of years ago) is
the Texas Marksman error - shoot a few bullets randomly, THEN circle
each bullet hole, THEN calculate the odds that you would hit those
exact spots, THEN proclaim that "Me be excellent shooter !!"

Evolution isn't AIMING at any given target - it is demographics. If
the product of one sequence grants an advantage over the others in the
gene pool, that one will most likely become more common. Once you
realize that, you'll realize why your statistical sleight-of-hand is
naught but numerical numbskullery (your 'calculations' PRESUME a
target when there really isn't one).

DNA sequence can vary by up to about 30% and STILL 'code' for the same
protein - the code is degenerate (one amino acid can be 'coded' for by
more than one DNA sequence : GTA, GTC, GTG and GTT all stand in for
Valine). Strike one for spintwittian math (which relies on PERFECT
match at the DNA level).

Not all amino acids in a sequence are critical - some can be replaced
by just about any other, some are more limited (like one hydrophobic
residue can be replaced by any other hydrophobic residue). Strike two
for spintwittian math (which presumes there is One True Sequence).

Protein STRUCTURE is more conserved than amino acid sequence; as it is
difficult to determine what activity a given string of amino acids
does from just looking at it, this puts a major crimp in your math.
Strike 3 for spintwittian math.

There are a very limited number of stable protein shapes - on the
order of a few THOUSAND. Increases the odds of finding something
useful quite well. Strike 4 for spintwittian math.

Actually doing research to SEE what the odds are of finding a sequence
with a selectable function shows the odds are 1 in 10^9 to 1 in
10^15. Strike 5 for spintwittian math.

This means that the naive 'calculations' you were blithering about are
off by 50 - 70+ orders of magnitude. The actual odds that a random
sequence of 70 amino acids would have a selectable function is 1 in
10^9 to 1 in 10^15 (and NOT 1 in 20^70 (or 1 in 1.18 x 10^91) as naive
droolers desperately need to believe)

RNA ribozymes also arise at similar odds - so far, they've found a
ligase and a polymerase from a RANDOM sequence library; were your
gibberings valid, such feats should've been impossible.

Prof Weird

unread,
Oct 17, 2008, 7:29:17 PM10/17/08
to
On Oct 17, 1:46 pm, spintronic <spintro...@hotmail.com> wrote:
> Here we go. The mirror guy.
>
> On Oct 17, 6:38 pm, Prof Weird <pol...@msx.dept-med.pitt.edu> wrote:
>
> > On Oct 17, 12:30 pm, spintronic <spintro...@hotmail.com> wrote:
> > But the DNA is NOT written backwards, twit !  
>
> Oh dear.
>
>  In fact. Oh fucking Oh dear.

Translation : "sh*t !! spintwitty get caught making another simple
error !! Must bluff and posture !!!"

>
> Could someone (who understands) tell this moron what a tit he is?

Okay : Spincronic you moron, you are being a great and tremendous tit.

(M)-adman

unread,
Oct 17, 2008, 9:34:27 PM10/17/08
to

Pissed that condition leaves you out?

sounds like it

(M)-adman

unread,
Oct 17, 2008, 9:47:54 PM10/17/08
to

Bromelain is an enzyme. It does not end in -ase Kleuskes & Moos is wrong
Papaya is an enzyme. It does not end in -ase Kleuskes & Moos is wrong

You would know who the "mirror guy" is if you were keeping up

HTH

~adman

(M)-adman

unread,
Oct 17, 2008, 10:22:14 PM10/17/08
to
Prof Weird wrote:
> On Oct 17, 2:01 pm, spintronic <spintro...@hotmail.com> wrote:
>> Hang on, this is the best. Or its in my top 3.
[\snip]
>
> Thus, twit, Okazaki fragments are NOT 'read backwards' [CUT]

Not read backwards? That does not sound right. Let me go see.[jeopardy theme
song playing]

Ah, i was right. You are Incorrect. (twit)

Okazaki fragment - Small pieces of DNA which form during DNA replication
since DNA polymerase must work *backwards* on some strands. The Okazaki
fragments are joined together by the enzyme DNA ligase.


DNA replication
In constructing a new strand of DNA, DNA polymerase can only work from the
new strand's 5' end to its 3' end. On one side of the replication origin,
the DNA polymerase follows the DNA helicase, *but* on the other side, it
must move *backwards* for short intervals, creating small pieces of DNA
called *Okazaki* *fragments*.
The Okazaki fragments are linked together by the enzyme DNA ligase.

http://library.thinkquest.org/27819/ch6_rvw.html


Each Okazaki fragment is made in the 5' to 3' direction, by a DNA polymerase
whose direction of synthesis is *backwards* compared to the overall
direction of fork movement.

http://www.answers.com/topic/replication


[cut]

> I'm not the one screaming at mirrors, twit - you and (m)adman are
> every time you claim authority in things you obviously do not
> understand.

THAT would be you. (twit). It Seems Spinster is correct. And i am never
wrong.

See Spinny for details on your stupidity and edcuation levels. His math
skills are even more superior then his DNA knowledge, so he can give you a
formula on just how dumb you are.

HTH

~~~~~~~~~~~~~~~~~~~~

(M)-adman

unread,
Oct 17, 2008, 10:24:24 PM10/17/08
to

It shows Sequenced DNA and proteins cannot be attributed to blind chance.


--

(M)-adman

unread,
Oct 17, 2008, 10:25:23 PM10/17/08
to


ROLL ON THE FLOOR LAUGHING!!!!!!!!!!!!!!!!!!!!!!

r norman

unread,
Oct 17, 2008, 10:25:41 PM10/17/08
to
On Fri, 17 Oct 2008 20:47:54 -0500, "\(M\)-adman" <gr...@hotmail.ed>
wrote:

Kleuskes/Moos did not claim that all enzyme names end in -ase. She
did write that "names ending in -ase denote enzymes" which is
generally true. If you understood logic you would understand the
distinction between "all -ase names are enzymes" and "all enzymes have
-ase names".

Papaya is a fruit, papain is an enzyme. You are wrong.

I admitted to not keeping up. It is craziness to read all this
stupidity so I just browse here and there.

John Harshman

unread,
Oct 18, 2008, 1:21:28 AM10/18/08
to
I'll type slow: Nobody says that DNA or proteins can be attributed to
blind chance. Also, "sequenced DNA" doesn't mean what you think it does.

Ye Old One

unread,
Oct 18, 2008, 3:50:52 AM10/18/08
to
On Fri, 17 Oct 2008 11:23:38 -0700 (PDT), spintronic

You have proven, time after time, that you know nothing.

--
Bob.

Ye Old One

unread,
Oct 18, 2008, 3:52:03 AM10/18/08
to
On Fri, 17 Oct 2008 13:30:12 -0500, "\(M\)-adman" <gr...@hotmail.ed>

enriched this group when s/he wrote:

I know you are a very forgetful person, or at least you like to run
away and try to forget things. However, on the 29th September 2008 you
failed to deal with a number of items that were first listed by
Boikat.

So, to help you, here (again) are the mistakes Boikat (and now myself)
think you need to address:-

Claiming the actor Paul Newman was a creationist....

Claiming that "Dr." Kent Hovind has made lots of *scientific*
discoveries...

Claiming wars have been fought because some scientific finding
discredited some facet of some religion...

Claiming to have a "higher education" than most posters to this news
group....

Claiming to understand how geologists determine the age of any given
sample of rock...

Now, will you deal with them? Or do I need to keep reminding you?

--
Bob.

Tony Raymonds

unread,
Oct 18, 2008, 4:11:41 AM10/18/08
to
In article
<0c771b07-db06-4992...@g17g2000prg.googlegroups.com>,
Seanpit <sea...@gmail.com> writes

>On Oct 16, 2:10 pm, "\(M\)-adman" <g...@hotmail.ed> wrote:
>> Do a test.
>>
>> 1) Take a 400 letter gene.
>>
>> 2) Find a monkey of your choice. (please give it a bath first)
>>
>> 3) Put the monkey in front of a keyboard (upright, on a chair, no cigars, no
>> pizza, no beer)
>>
>> 4) Allow the monkey to bang the keys (using a simple four letter genetic
>> alphabet)
>>
>> The odds against the monkey getting the correct order for the first
>> sequence? four to one.
>>
>> The odds against getting the second sequence correct? sixteen to one.
>>
>> The odds against getting the first three sequences correct? sixty-four to
>> one.
>>
>> The chance the monkey can get the rest of the 397 sequences correct? 1
>> followed by 130 zeros
>>
>> (ask spintronic for a mathematical formula if you doubt the calculation.)
>>
>> Are we getting the picture yet?
>>
>> I'll simplify:
>>
>> Sequenced DNA and proteins cannot be attributed to blind chance.(sorry) The
>> odds are beyond astronomical.
>>
>> Which equals an Author. A Creator. I like to call him/her God. You can use
>> whatever name you wish.
>>
>> DNA (found by brilliant scientists, btw) is God's handwriting. Kinda like a
>> computer program.
>>
>> Pretty cool eh?
>>
>> hth
>> --
>> A cup of coffee and some truth with:
>>
>> ·.¸Adman¸.·
>> ^^^^^^^^^^^
>
>You forget about the concept of natural selection as a guiding force
>to producing specific sequences. What is your arguing for countering
>the likes of Richard Dawkins when the explanation of "Climbing Mt.
>Improbable" one tiny step at a time is given? There is an answer.
>It's just that you haven't presented it here. You need to do a bit
>better than this - - even from a creationist perspective.
>
>See the following link for a more detailed argument for the "Methinks
>it is Like a Weasel" evolution algorithm:
>
>http://www.detectingdesign.com/methinksitislikeaweasel.html
>
>Sean Pitman
>www.DetectingDesign.com
>

Sean Pitman: I can prove that the theory of evolution is wrong.

Scientist: Very interesting! Show me your evidence.

Sean Pitman: I can prove that there is no way that a 1000aa protein can
evolve. We know they exist, so life must be designed.

Scientist: Go on...

Sean Pitman: What? You want more, can't I just assert it?

Scientist: No, that's not how science works.

Sean Pitman: I can show you many examples of functional gaps between
1000aa proteins and can show that evolution cannot cross those gaps.

Scientist: Very interesting. I have some free time and I would love to
see these examples.

Sean Pitman: Well, I don't actually have any examples.

Scientist: But you just said...

Sean Pitman: No, I meant that I can show statistically that there must
be examples of large gaps which cannot be crossed. That's the same
thing.

Scientist: So your statistics show that large neutral gaps completely
surround 1000aa proteins and there is no way to reach them from simpler
proteins?

Sean Pitman: No, that's too hard to prove. How very unscientific of you
to ask me for something like that!

Scientist: Err, so what can you show me then?

Sean Pitman: I can prove that the odds of crossing a gap of 100 neutral
mutations is 1 in 20^100, which is impossible.

Scientist: Can you demonstrate that gaps of 100 neutral mutations exist?

Sean Pitman: No, but if they did then the theory of evolution would be
proven wrong by my calculations. Therefore life is designed, not
evolved.

Scientist: Sigh. Don't let the door hit you on the way out. Next...

<slam>

Sean Pitman: Ouch
--
to...@wacky.zzn.com

(M)-adman

unread,
Oct 18, 2008, 6:46:47 AM10/18/08
to

That is pretty unconditional

>If you understood logic you would understand the
> distinction between "all -ase names are enzymes" and "all enzymes have
> -ase names".
>
> Papaya is a fruit, papain is an enzyme. You are wrong.

Does Papin end in -ase? No.

>
> I admitted to not keeping up. It is craziness to read all this
> stupidity so I just browse here and there.

--

A cup of coffee and some truth with:

·.¸Adman¸.·
^^^^^^^^^^^


Kleuskes & Moos

unread,
Oct 18, 2008, 7:10:03 AM10/18/08
to
On 17 okt, 20:30, "\(M\)-adman" <g...@hotmail.ed> wrote:
> Kleuskes & Moos wrote:
> > On 17 okt, 15:19, "\(M\)-adman" <g...@hotmail.ed> wrote:
> > <snip>
>
> >>>>> So I see you have abandoned all those other threads you starter
>
> >>>> I am not answering trolls
>
> >>> rnorman a troll?
> >>> There's a novel idea!
>
> > <unmarked snippage>
>
> >> I have my reasons
>
> > Main one being you don't know how to answer all those tricky
> > questions?
>
> nope
>
> >How to take a point someone else makes?
>
> \
> nope. that is not correct either
>
> >Because you don't
> > want to admit you've been told off by people who actually *know* what
> > they're talking about?
>
> You are not a programer.

You REALLY seem to be stuck on that one, no?

> it is THAT simple.

Fortunately, the people who pay me think otherwise. So your opinion is
of very little value to me.

Sapient Fridge

unread,
Oct 18, 2008, 7:08:26 AM10/18/08
to
In message
<b76eb566-5d56-4d92...@e17g2000hsg.googlegroups.com>,
spintronic <spint...@hotmail.com> writes

>On Oct 17, 2:20 pm, John Harshman <jharshman.diespam...@pacbell.net>
>wrote:
>> spintronic wrote:
>> > On Oct 16, 10:59 pm, John Harshman <jharshman.diespam...@pacbell.net>
>> > wrote:
>> >> (M)-adman wrote:
>>
>> >>> Sequenced DNA and proteins cannot be attributed to blind
>> >>>chance.(sorry) The
>> >>> odds are beyond astronomical.

It's actually always "written" forwards, that's the whole point of
Okazaki fragments. DNA can only be built in one direction i.e. 5'->3',
so the template strand must be read in the opposite direction i.e.
3'->5'.

>
>
>
>-----------------
>
>RNA primase
>
>DNA PolymeraseIII
>DNA Polymerase I
>DNA Ligase
>
>-----------------
>
>Now I haven't looked at how long theses sequences are yet.
>

>But the "Okazaki fragment" cannot be written correctly without any
>one of them.
>
>So in essence we require a "specific" % of some sequence to have a
>working model.
>
>Now, say we pick "DNA Polymerase I" as a test case.
>
>
>Because this is a *required* essential protein. And tehre is no way
>the
>Okazaki fragment can be completed without it.
>
>You have 4^(whatever that sequence length is).
>
>Which, I am guessing is a very very very very large number.
>
>And selection doesn't cut it, because the "Okazaki fragment" is
>either
>written or it isn't.
>
>
>
>
>Your turn.
>

You are assuming that Okazaki fragments have always been a necessary
part of DNA replication. That is not a valid assumption, so your above
dilemma vanishes.

If the DNA strand were short enough then both strands could be copied
without Okazaki fragments being needed. One strand copies 3'->5' and
the other strand does the same from its 3'->5' end. So no fragments
would be generated.

In effect Okazaki fragments is an efficiency hack that allows the DNA to
be copied in parallel (well nearly anyway) all the way along from one
end to the other. Without it DNA would have to copy from the opposite
ends, leaving a lot of single stranded DNA hanging around as it did so.
It would also need primers which matched both ends. Neither of those
are particularly a problem but copying both strands (roughly) at the
same time is faster and avoids the problem of leaving single stranded
DNA hanging around in the cell longer than necessary.

Now it may be that *modern* DNA needs it because it has come to rely on
it, but there is no reason to believe that it was always like that. The
fragment trick may be one of the things that allows DNA to get to the
length it does, along with the evolution of topoisomerase.

So on to your question as to whether the "Okazaki fragment" is "either
written or it isn't". In the extreme case where one entire strand is
copied and the copying of the second strand waits until the first is
finished then the *entire* second strand is in effect a "Okazaki
fragment". So the answer is that at least one must be written.

From there it would be easy for a primer to start the copying process
partway along the orphan strand (producing 2 Okazaki fragments) and so
on. When the fragments meet then joint will be made because the DNA
repair systems will simply see it as damaged DNA that needs fixing.

Note that some bacteria have Okazaki fragments which are orders of
magnitude longer than ours. That indicates that they haven't had as
much selective pressure to increase the number, so they left it as large
chunks.

I wouldn't be surprised if some bacteria don't use the fragment trick at
all, but I haven't looked.
--
sapient_...@spamsights.org ICQ #17887309 * Save the net *
Grok: http://spam.abuse.net http://www.cauce.org * nuke a spammer *
Find: http://www.samspade.org http://www.netdemon.net * today *
Kill: http://spamsights.org http://spews.org http://spamhaus.org

Sapient Fridge

unread,
Oct 18, 2008, 7:28:20 AM10/18/08
to
In message <PO4Kk.51259$vX2....@bignews6.bellsouth.net>, "(M)-adman"
<gr...@hotmail.ed> writes

>Kleuskes & Moos wrote:
>> On 17 okt, 15:19, "\(M\)-adman" <g...@hotmail.ed> wrote:
>> <snip>
>>
>>>>>> So I see you have abandoned all those other threads you starter
>>>
>>>>> I am not answering trolls
>>>
>>>> rnorman a troll?
>>>> There's a novel idea!
>>
>> <unmarked snippage>
>>>
>>> I have my reasons
>>>
>>
>> Main one being you don't know how to answer all those tricky
>> questions?
>
>nope
>
>>How to take a point someone else makes?
>\
>nope. that is not correct either
>
>>Because you don't
>> want to admit you've been told off by people who actually *know* what
>> they're talking about?
>
>You are not a programer.

I am though, and I can tell that what you are spouting is garbage.

Mutations are random, but the construction of DNA sequences over
generations isn't. Natural selection chooses the best from what is
available and the next generation gets that as it's starting point, and
so on.

By your logic you should tell the world's card players that they are
wasting their time because the chances of any particular hand being
dealt to them is so small as to be impossible.

Charles Brenner

unread,
Oct 18, 2008, 7:34:37 AM10/18/08
to
On Oct 18, 3:46 am, "\(M\)-adman" <g...@hotmail.ed> wrote:
> r norman wrote:
> > On Fri, 17 Oct 2008 20:47:54 -0500, "\(M\)-adman" <g...@hotmail.ed>

> > wrote:
>
> >> r norman wrote:
> >>> On Fri, 17 Oct 2008 11:23:38 -0700 (PDT), spintronic

If you want to prove it wrong, then your example should be something
like "staircase." Most people would immediately see why but for you,
I'm going to have to spell it out:

"Staircase" ends in "-ase". But "staircase" is not an enzyme!
Therefore it is not strictly true that "all names ending in -ase
denote enzymes".

> >If you understood logic you would understand the
> > distinction between "all -ase names are enzymes" and "all enzymes have
> > -ase names".

A pretty clear distinction, one would think. Seems obvious enough
but ...

> > Papaya is a fruit, papain is an enzyme. You are wrong.
>
> Does Papin end in -ase? No.

Truly remarkable. He still misses the distinction even immediately
after quoting it.

Charles

Charles Brenner

unread,
Oct 18, 2008, 7:44:41 AM10/18/08
to

I like this form of argument:

Spintronic mistakes an enzyme for a gene.
Challenged, he sticks to his guns and offers to show the sequence to
prove it's a gene.
The challenger knowing there is none calls the bluff.
Spintronic replies "Find it yourself!"

Confused? Bluffing again? Simply stupid? Still, seems like a debating
technique with potentially wide application.

Charles

Seanpit

unread,
Oct 18, 2008, 9:40:30 AM10/18/08
to
On Oct 16, 5:39 pm, "\(M\)-adman" <g...@hotmail.ed> wrote:
>
> > See the following link for a more detailed argument for the "Methinks
> > it is Like a Weasel" evolution algorithm:
>
> >http://www.detectingdesign.com/methinksitislikeaweasel.html
>
> thanks, i'll take a look.
>
> Natural selection is random, unpredictable, depends on too many other
> circumstances.

NS is not random or unpredictable. It is actually very predictable -
especially under experimental conditions.

> Randomness and code sequences do not mix. One will break the other.

Not true when you put NS into the mix. NS is a preservative force.
It overcomes the random mixing of the information of the gene pool by
RM. It is also able to incorporate the lucky beneficial mutations
into the gene pool. It is just that these beneficial mutations don't
ever come across anything beyond very low levels of functional
complexity.

>
> --
> A cup of coffee and some truth with:
>
> ·.¸Adman¸.·
> ^^^^^^^^^^^

Sean Pitman
www.DetectingDesign.com

r norman

unread,
Oct 18, 2008, 9:39:59 AM10/18/08
to
On Sat, 18 Oct 2008 05:46:47 -0500, "\(M\)-adman" <gr...@hotmail.ed>
wrote:

I forgot to mention that some of the classical enzymes, the first ones
known, have names not ending in -ase: rennin, pepsin, trypsin... One
chemistry education source about enzymes says: "Do not be overly
concerned about enzyme names, but be able to recognize a substance as
an enzyme by its "-ase" ending."
http://www.elmhurst.edu/~chm/vchembook/570enzymes.html

One important enzyme discovered well after the -ase convention had
been established does not have a common name ending in -ase. That is
the one acted on by ACE inhibitors.

I repeat: there is a difference between saying "all -ase names are
enzymes" and "all enzymes have -ase names". You continue to fail to
recognize that difference. My conclusion is that you are either a
total idiot or you are a troll (using 'or' in its inclusive sense, you
are most likely both).

heekster

unread,
Oct 18, 2008, 10:26:10 AM10/18/08
to

This is what happens when one drinks too much turpentine as a child.


spintronic

unread,
Oct 18, 2008, 11:23:59 AM10/18/08
to
On Oct 18, 12:23 am, Prof Weird <pol...@msx.dept-med.pitt.edu> wrote:
> On Oct 17, 2:59 pm, spintronic <spintro...@hotmail.com> wrote:
>

> > You are a boon, so I will ask very simple questions.
>
> > "Can DNA, Okazaki fragment's, be duplicated without DNA
> > "Polymerase I" in modern cells
>

> No.

See. He agrees with me.


> DNA sequence can vary by up to about 30% and STILL 'code' for the same
> protein - the code is degenerate (one amino acid can be 'coded' for by
> more than one DNA sequence : GTA, GTC, GTG and GTT all stand in for
> Valine).  Strike one for spintwittian math (which relies on PERFECT
> match at the DNA level).

Idiot.


Go back have a read. You may find a little symbol that looks like
this --->%<--- in my original question.

Score =
0 to weirdo.
2 to spinny.

spintronic

unread,
Oct 18, 2008, 11:20:22 AM10/18/08
to
On Oct 17, 9:52 pm, John Harshman <jharshman.diespam...@pacbell.net>
> have you figured out yet that not all life has Okazaki fragments?- Hide quoted text -

>
> - Show quoted text -

http://uk.youtube.com/watch?v=4jtmOZaIvS0&feature=related
56 seconds

Anyway I'm not gonna argue such a *stupid* point that we both agree
on.

All "weirdo" has done is distract from the argument by sending you in
the
wrong direction.

So I will ask again.


Lagging strand.

Cannot be copied without specific proteins.

I think we picked DNA polymerase 1.

The argument went.

The lagging strand cannot be copied without specific proteins.

Remove one.

Say "DNA polymerase I".

The lagging strand is now not copied.

So we have an essential protein with a specific sequence.

4^(sequence length) = very large number.

It is loading more messages.
0 new messages